Supplemental Figure 1. The lateral root number in ... 2015/05/22  · Supplemental Data....

Click here to load reader

  • date post

  • Category


  • view

  • download


Embed Size (px)

Transcript of Supplemental Figure 1. The lateral root number in ... 2015/05/22  · Supplemental Data....

  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    Supplemental Figure 1. The lateral root number in WT, brm-1, brm-3, and

    brm-5 roots at 10 DAG.

    Supplemental Figure 2. The expression of CycB1;1 and CycB1;3 in 3 DAG WT,

    brm-3 and brm-5 roots. Bar=50 μm.

  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    Supplemental Figure 3. Cellular organization of WT (Col-0), brm-3, brm-5 and

    brm-1 root tips at 3 DAG using propidium iodide staining (A) and the length of

    4th columella cell of the WT (Col-0), brm-3 and brm-5 root tips at 3 DAG (B).

    The QC (white triangle) and columella cell areas (white asterisk) are indicated.

    Bars = 20 μm. The 4th columella cell of brm-1 root tips could not be identified.

    Data shown are means ± SD (n =20).

  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    Supplemental Figure 4. The expression of PIN2 in WT (Col-0) and brm-3 root

    tips at 3 DAG (A) and the expression of root development related genes in WT

    (Col-0) and brm-1 5-day-old seedlings. Bars = 20 μm.

  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    Supplemental Figure 5. The expression pattern of SHR and SCR in WT and

    brm-3 (A, C) and the phenotype of shr-1 brm-3 (B), scr-1 brm-3 (D), shr-1

    brm-1 (E) and scr-1 brm-1 (F) double mutants. Bars = 20 μm (A, C) and 1 cm (B,

    D, E, F).

  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    Supplemental Figure 6. The phenotype of plt1-4 plt2-2 brm-3 (A) and plt1-4

    plt2-2 brm-1 (B) triple mutants at 7 DAG. Bars = 1 cm.

    Supplemental Figure 7. The phenotype of Col-0 and BRMpro:BRM:GFP/brm-1

  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    seedlings at 10 DAG . Bars = 0.5 cm.

    Supplemental Figure 8. ChIP-qPCR analysis of BRM targeting to PIN3, PIN4

    and PIN7 (A) and H3K27me3 levels of PIN3, PIN4 and PIN7 loci in brm-3

    mutant roots (B). Data are mean values ± standard deviation of three

    replicates. Similar results were obtained for at least two additional independent

    experiments. Asterisks denote Student’s t- test significant difference between

    Col-0 and BRMpro: BRM:GFP/Col-0 roots (p

  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    Supplemental Figure 9. BRM does not target to PLT1 and PLT2 directly.

    Supplemental Figure 10. The normal expression of QC25 and QC46 in WT

  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    (Col-0) and brm-3 root tips at 3 DAG. Bars = 25 μm.

    Supplemental Table 1. Primers used for RT-qPCR



    Forward Reverse





















    Supplemental Table 2. Primers used for ChIP-qPCR



    Forward Reverse

    Length of


  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    PLT1-P1 gaggacgtgagttcccataatc gcaaattaattatcactcacaatg 132 bp


    PLT1-P3 ttccacttaattaggttttgtc ttatacgattcgatgcactcac 150 bp



    PLT1-P6 tcaatttagagggggccttt cccataaaaccctaaccctca 120 bp

    PLT2-P1 taaacgagggacgtgagtt cgcttccaactagaaaaagtc 130 bp

    PLT2-P2 ccaagaaaagggaaATGAA GGTTTTGAAAAGGGTTGTCG 148 bp


    PLT2-P4 tcggactatgcactcagGTG tcatgaaaatttgaaataacttacCG 130 bp


    PLT2-P6 acaagtattaggatcggctgga ccctcgaggactctgataacc 120 bp

    PIN1-P1 gggataaattgatcaaccgaat ggtggagctttggggatagt 140 bp

    PIN1-P2 ttccctcttcaccacttctctc ACGGAACCATAGCCGTCATA 128 bp



    PIN1-P5 tgccctttttgttgaaaacc aaggtaaaacttgctgagctcct 127 bp

    PIN2-P1 ccaatcttccttatcccaaga ggtccataatttttcgaagtgc 137 bp

    PIN2-P2 tctctcgccggaaaaagtaa GTGTGAATATCCCCCACCAC 132 bp


    PIN2-P4 ttaaatagatataagaatcgatt aattattattattttgttaaaaga 146 bp

    PIN2-P5 ttgcaaataaaaggcgatacg attaatgcgacattgcatgg 128 bp

  • Supplemental Data. Yang et al. (2015). Plant Cell 10.1105/tpc.15.00091


    PIN3-P1 aaaatcaagcacatgaatgtcac tcgactgattgaaacggaca 122 bp

    PIN3-P2 cactgctcccaagtcctctc AGGATCATGGCCACGTAGAG 147 bp



    PIN3-P5 acgcagataaggaggagcaa cccgaacctaatcaaagaaca 153 bp

    PIN4-P1 gagttttctggagggacgtg cgtagtattcgccaaagttcc 129 bp

    PIN4-P2 tcctcttcaccgaatccttg cggtgggttttggagtttag 144 bp

    PIN4-P3 ctgagaaaaccaaaaatcatgaatac tcctcttcaccgaatccttg 120 bp

    PIN4-P4 tgaccctctgacccagacat ggatttgagaaaattgacagca 127 bp

    PIN4-P5 TCTTGGCCTTTGAattggtc cttccactctttcccacgaa 121 bp

    PIN7-P1 aagttttggaccggcattta caatgaattttgtgaatccttga 140 bp

    PIN7-P2 tgttaaaagcttccgtcatca AGGACGGTGTAGAGGTCGTG 140 bp


    PIN7-P4 ggtgggatgacatagctcgt aacaagtgctgaatgatgcaa 153 bp

    PIN7-P5 tctgcttggctgaagaggat ggatcctcaaatcaaatcttgg 125 bp

    TA3 ctgcgtggaagtctgtcaaa ctatgccacagggcagttt 106bp






    150 bp