Targeting of tumors with homing peptides fused to Gaussia luciferase as a tool for imaging in vivo
1
Targeting of tumors with homing peptides fused to Gaussia luciferase as a tool for imaging in vivo Joseph S. Danner, 1 Jim Stauffer, PhD 1 1 Experimental Therapeutics Section, NCI-Frederick, Frederick, MD Peptide Target Localization F3 Nucleolin Tumor/ tumor vasculature RGD α V β 3 Integrin Tumor/ tumor vasculature pHLIP Acidic Microenvironment Membrane insertion at low pH Fig. 1-Targeting Peptides. F3 is shown to bind nucleolin, which is shuttled between the nucleus and the plasma membrane (Christian, 2003). RGD is a ligand for the integrin receptor αV β3 (Xiong, 2001) and is found to be expressed on the cell surface of tumors and tumor vasculature. pHLIP undergoes a conformational change at pH<7.0, such as the acidic microenvironment produced by tumors, allowing it to integrate itself into the plasma membrane (Andreev, 2007). References Andreev, O.A., Dupuy, A.D., Segala, M., Sandugu, S., Serra, D.A., Chichester, C.O. et al. 2007. Mechanism and uses of a membrane peptide that targets tumors and other acidic tissues in vivo. PNAS 104(19): 7893-7898. Benoit, R.M., Wilhelm, R.N., Scherer-Becker, D., Ostermeier, C. 2006. An improved method for fast, robust, and seamless integration of DNA fragments into multiple plasmids. Protein Expression and Purification 45: 66-71. Christian, S., Pilch, J., Akerman, M.E., Porkka, K., Laakonen, P., Ruoslahti, E. 2003. Nucleolin expressed at the cell surface is a marker of endothelial cells in angiogenic blood vessels. Journal of Cell Biology 163(4): 871-878. Tannous, B.A., Kim, E.D., Fernandez, J.L., Weissleder, R., Breakefield, X.O. 2005. Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo. Molecular Therapy 11(3): 435-443. Venisnik, K.M., Olafsen, T., Gambhir, S.S., Wu, A.M. 2007. Fusion of Gaussia luciferase to an engineered anti-carcinoembryonic antigen (CEA) antibody for in vivo optical imaging. Molecular Imaging And Biology 9(5):267- 277. Xiong, J.P., Stehle, T., Diefenbach, B., Zhang, R., Dunker, R., et al. 2001. Crystal structure of the extracellular segment of integrin alphaV beta3. Science 294: 339-345. Fig. 3- Assembly PCR & Seamless Integration of Target Peptides. Oligos were annealed by slow cooling (30 minutes) from 100°C to 22°C in a preliminary step. PCR was used to extend the gaps and linearize the GLuc target vector. Seamless integration enables the directional insertion of the targeting peptides into a target vector at any desired position (Benoit, 2006). Oligos were designed such that they share a short region of homology (15-20 basepairs) with the GLuc target vector at the insertion site. A simple recombination event, mediated by the BD In- Fusion enzyme and regions of homology, seamlessly integrates the fragment into the destination vector without the use of restriction enzymes. Additionally, the entire procedure can be completed in just two steps rendering it more efficient than previous procedures that integrate fragments of interest at a predetermined site and require the use of restriction enzymes. PCR with Flanking Primers 30 Repeat with Gel Purified Fragment Gradually Anneal/ PCR 8 Cycles PCR/Dpn1- Linearized GLuc Vector 5'-AAGGGGGCCGGTGGTGACTCTGGTGGCGGTGGCTCGGGCGGAGGTGGGTCG AGGAGCGCCAAGCTGAGCGCCAAGCCTGCCCCTCCTAAGCCTGAGCCTAAGCCTAAGAAGGC -3' 3'- CCGCCTCCACCCAGCCGGTTCCACTTCCTGCTCGGAGTCTCCTCCTCGCGGTTCGACTC ACTCGGATTCGGATTCTTCCGGGGACGGTTCTTCATTCGCCGGCGA GCTCGTA-5' + In-Fusion In-Fusion 1. 2. 3. GLuc Target Peptide 4. Recombination Event 5'-AAGGGGGCCGGTGGTGACTCTGGTGGCGGTGGCTCGGGCGGAGGTGGGTCG AGGAGCGCCAAGCTGAGCGCCAAGCCTGCCCCTCCTAAGCCTGAGCCTAAGCCTAAGAAGGC -3' 3'- CCGCCTCCACCCAGCCGGTTCCACTTCCTGCTCGGAGTCTCCTCCTCGCGGTTCGACTC ACTCGGATTCGGATTCTTCCGGGGACGGTTCTTCATTCGCCGGCGA GCTCGTA-5' 5'-AAGGGGGCCGGTGGTGACTCTGGTGGCGGTGGCTCGGGCGGAGGTGGGTCG AGGAGCGCCAAGCTGAGCGCCAAGCCTGCCCCTCCTAAGCCTGAGCCTAAGCCTAAGAAGGC -3' 3'- CCGCCTCCACCCAGCCGGTTCCACTTCCTGCTCGGAGTCTCCTCCTCGCGGTTCGACTC ACTCGGATTCGGATTCTTCCGGGGACGGTTCTTCATTCGCCGGCGA GCTCGTA-5' Fig. 2- Tumor Targeting. Gaussia luciferase is secreted due to a short secretion signal on its N-terminus. A linker confers flexibility upon the protein by utilizing glycine and arginine residues with non-bulky side chains. Acting as a molecular tether, the linker used in our experiments limits steric hindrance and allows GLuc and the target peptide to move freely and associate with its target molecule. The fusion protein localizes as a result of the target peptide which homes in on its target. Fusion protein that has accumulated at the tumor site can be visualized . GLuc Targeting Peptide Secretion Signal Flexible Linker (Gly 4 -Arg-Gly) 3 pHLIP F3 pHLIP RGD F3 pHLIP RGD pHLIP Empty Vector A) Mini Prep Screening B) PCR Screening Fig. 4- Screening for Clones. Two screening methods were utilized to identify clones containing the GLuc fused inserts. A) Colonies plated overnight on ampicillin plates were selected and purified by mini prep. Vectors were then subjected to a XhoI / HindIII digest and screened for those containing the desired insert. B) Colonies were subjected to PCR screening in which vector DNA was amplified. Potential clones were then digested (XhoI/ HindIII) and analyzed alongside the empty GLuc vector to confirm inserts were of the desired size. Introduction Tumor cells possess a few unique markers that enable distinction between disease and host tissues. The ability to target these markers presents a wide array of possibilities including novel imaging procedures and therapy. To date, many tumor specific markers have been identified and extensively studied. Carcinogenic embryonic antigen (CEA) is one such marker found on the surface of these diseased tissues. Gaussia luciferase (GLuc) has been previously used to image this tumor marker in vivo. GLuc has been shown to have 1,000-fold greater sensitivity than firefly luciferase (Tannous, 2005) making it easily detectible in vivo. Additionally, the use of GLuc is non-invasive and can be easily imaged in small animals. Previous studies have fused diabodies specific for CEA to GLuc in an effort to monitor expression levels of CEA on the surface of tumors (Venisnik, 2007). Such studies demonstrate “proof of principle” for methods capable of delivering biologicals to specific sites. Hydrodynamic gene delivery is a technique that allows intravenously injected DNA to be taken up and expressed by the liver. In the present study, we have taken advantage of hydrodynamically delivered expression vectors encoding certain peptides fused to Gaussia luciferase that possess the ability to home in on their target molecules which are encountered in the tumor microenvironment. These targeting peptides can then be imaged in vivo at the sites at which they accumulate using the Xenogen IVIS system to detect luciferase activity. Fig. 5- Sequencing of GLuc Fused Target Peptides. Clones were sequenced and compared to predicted sequences. Targeting peptides F3 and pHLIP had amino acid sequences with complete identity to the predicted sequences. RGD showed a single point mutation in a wobble position generating a silent mutation. The RGD amino acid sequence however remains conserved. Flexible Linker pHLIP F3 RGD pHLIP Flexible Linker RGD Flexible Linker F3 Conclusions •GLuc is secreted by the liver. •GLuc activity is not compromised by the addition of a flexible linker and target peptide. •pHLIP integrates itself into acidic membranes. GLuc activity is detected in the stomach and secum of injected mice (data not shown). •Absence of liver activity indicates intracellular transport has not taken place at this time point. •Only autofluorescence is detected in CAGEN control mice. The auto-oxidation of coelenterazine in serum emits low levels of detectable light. •GLuc:F3 and GLuc:RGD have yet to be imaged and analyzed. Hydrodynamic Injection 1. •GLuc control (x3 mice) •GLuc: pHLIP (x3 mice) •GLuc:F3 (x3 mice) •GLuc: RGD (x3 mice) •CAGEN (empty vector control) (x3 mice) Liver GLuc GLuc GLuc GLuc Liver 2. Injected DNA GLuc is secreted by the liver GLuc GLuc GLuc GLuc 3. GLuc accumulates at the tumor site Methods 4. Coelenterazine injection GLuc GLuc GLuc GLuc 5. GLuc emits detectable light Xenogen imaging 6. Fig. 6- In vivo Imaging of Hydrodynamically Injected Mice. Balb/c mice were intravenously injected via tail vein with GLuc DNA construct. Hydrodynamic injection delivers DNA to the liver and in the process damages liver tissues. Gaussia luciferase is then secreted from the liver and is delivered to tumor sites through the blood stream. GLuc targeting peptides accumulate at the tumor site where they bind to their target molecules. A second tail vein injection delivers the Gaussia luciferase substrate coelenterazine to the tumor site where GLuc has accumulated and emits detectable light. Mice were anesthetized and imaged using the Xenogen IVIS spectrum. GLuc pHLIP CAGEN
-
Upload
joseph-s-danner -
Category
Documents
-
view
91 -
download
1
Transcript of Targeting of tumors with homing peptides fused to Gaussia luciferase as a tool for imaging in vivo
Targeting of tumors with homing peptides fused to Gaussia luciferase as a tool for imaging in vivo Joseph S. Danner,1 Jim Stauffer, PhD 1
1Experimental Therapeutics Section, NCI-Frederick, Frederick, MD
Peptide Target LocalizationF3 Nucleolin Tumor/ tumor vasculature
RGD αV β3 Integrin Tumor/ tumor vasculaturepHLIP Acidic Microenvironment Membrane insertion at low pH
Fig. 1-Targeting Peptides. F3 is shown to bind nucleolin, which is shuttled between the nucleus and the plasma membrane (Christian, 2003). RGD is a ligand for the integrin receptor αV β3 (Xiong, 2001) and is found to be expressed on the cell surface of tumors and tumor vasculature. pHLIP undergoes a conformational change at pH<7.0, such as the acidic microenvironment produced by tumors, allowing it to integrate itself into the plasma membrane (Andreev, 2007).
References
Andreev, O.A., Dupuy, A.D., Segala, M., Sandugu, S., Serra, D.A., Chichester, C.O. et al. 2007. Mechanism and uses of a membrane peptide that targets tumors and other acidic tissues in vivo. PNAS 104(19): 7893-7898.
Benoit, R.M., Wilhelm, R.N., Scherer-Becker, D., Ostermeier, C. 2006. An improved method for fast, robust, and seamless integration of DNA fragments into multiple plasmids. Protein Expression and Purification 45: 66-71.
Christian, S., Pilch, J., Akerman, M.E., Porkka, K., Laakonen, P., Ruoslahti, E. 2003. Nucleolin expressed at the cell surface is a marker of endothelial cells in angiogenic blood vessels. Journal of Cell Biology 163(4): 871-878.
Tannous, B.A., Kim, E.D., Fernandez, J.L., Weissleder, R., Breakefield, X.O. 2005. Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo. Molecular Therapy 11(3): 435-443.
Venisnik, K.M., Olafsen, T., Gambhir, S.S., Wu, A.M. 2007. Fusion of Gaussia luciferase to an engineered anti-carcinoembryonic antigen (CEA) antibody for in vivo optical imaging. Molecular Imaging And Biology 9(5):267-277.
Xiong, J.P., Stehle, T., Diefenbach, B., Zhang, R., Dunker, R., et al. 2001. Crystal structure of the extracellular segment of integrin alphaV beta3. Science 294: 339-345.
Fig. 3- Assembly PCR & Seamless Integration of Target Peptides. Oligos were annealed by slow cooling (30 minutes) from 100°C to 22°C in a preliminary step. PCR was used to extend the gaps and linearize the GLuc target vector. Seamless integration enables the directional insertion of the targeting peptides into a target vector at any desired position (Benoit, 2006). Oligos were designed such that they share a short region of homology (15-20 basepairs) with the GLuc target vector at the insertion site. A simple recombination event, mediated by the BD In-Fusion enzyme and regions of homology, seamlessly integrates the fragment into the destination vector without the use of restriction enzymes. Additionally, the entire procedure can be completed in just two steps rendering it more efficient than previous procedures that integrate fragments of interest at a predetermined site and require the use of restriction enzymes.
PCR with Flanking Primers 30 Repeat with Gel Purified Fragment
Gradually Anneal/ PCR 8 Cycles
PCR/Dpn1- Linearized GLuc
Vector
5'-AAGGGGGCCGGTGGTGACTCTGGTGGCGGTGGCTCGGGCGGAGGTGGGTCG AGGAGCGCCAAGCTGAGCGCCAAGCCTGCCCCTCCTAAGCCTGAGCCTAAGCCTAAGAAGGC-3' 3'- CCGCCTCCACCCAGCCGGTTCCACTTCCTGCTCGGAGTCTCCTCCTCGCGGTTCGACTC ACTCGGATTCGGATTCTTCCGGGGACGGTTCTTCATTCGCCGGCGA GCTCGTA-5'
+ In-FusionIn-Fusion
1.
2.
3.
GLuc TargetPeptide
4.
Recombination Event
5'-AAGGGGGCCGGTGGTGACTCTGGTGGCGGTGGCTCGGGCGGAGGTGGGTCG AGGAGCGCCAAGCTGAGCGCCAAGCCTGCCCCTCCTAAGCCTGAGCCTAAGCCTAAGAAGGC-3' 3'- CCGCCTCCACCCAGCCGGTTCCACTTCCTGCTCGGAGTCTCCTCCTCGCGGTTCGACTC ACTCGGATTCGGATTCTTCCGGGGACGGTTCTTCATTCGCCGGCGA GCTCGTA-5'
5'-AAGGGGGCCGGTGGTGACTCTGGTGGCGGTGGCTCGGGCGGAGGTGGGTCG AGGAGCGCCAAGCTGAGCGCCAAGCCTGCCCCTCCTAAGCCTGAGCCTAAGCCTAAGAAGGC-3' 3'- CCGCCTCCACCCAGCCGGTTCCACTTCCTGCTCGGAGTCTCCTCCTCGCGGTTCGACTC ACTCGGATTCGGATTCTTCCGGGGACGGTTCTTCATTCGCCGGCGA GCTCGTA-5'
Fig. 2- Tumor Targeting. Gaussia luciferase is secreted due to a short secretion signal on its N-terminus. A linker confers flexibility upon the protein by utilizing glycine and arginine residues with non-bulky side chains. Acting as a molecular tether, the linker used in our experiments limits steric hindrance and allows GLuc and the target peptide to move freely and associate with its target molecule. The fusion protein localizes as a result of the target peptide which homes in on its target. Fusion protein that has accumulated at the tumor site can be visualized .
GLuc
Targeting Peptide
Secretion Signal
Flexible Linker(Gly4-Arg-Gly)3
pHL
IP
F3 pHLIP RGD
F3 pHLIP RGD
pHLIP EmptyVector
A) M
ini P
rep
Scre
enin
gB
) PC
R S
cree
ning
Fig. 4- Screening for Clones. Two screening methods were utilized to identify clones containing the GLuc fused inserts. A) Colonies plated overnight on ampicillin plates were selected and purified by mini prep. Vectors were then subjected to a XhoI / HindIII digest and screened for those containing the desired insert. B) Colonies were subjected to PCR screening in which vector DNA was amplified. Potential clones were then digested (XhoI/ HindIII) and analyzed alongside the empty GLuc vector to confirm inserts were of the desired size.
IntroductionTumor cells possess a few unique markers that enable distinction between disease and host tissues. The ability to target these markers presents a wide array of possibilities including novel imaging procedures and therapy. To date, many tumor specific markers have been identified and extensively studied. Carcinogenic embryonic antigen (CEA) is one such marker found on the surface of these diseased tissues. Gaussia luciferase (GLuc) has been previously used to image this tumor marker in vivo. GLuc has been shown to have 1,000-fold greater sensitivity than firefly luciferase (Tannous, 2005) making it easily detectible in vivo. Additionally, the use of GLuc is non-invasive and can be easily imaged in small animals. Previous studies have fused diabodies specific for CEA to GLuc in an effort to monitor expression levels of CEA on the surface of tumors (Venisnik, 2007). Such studies demonstrate “proof of principle” for methods capable of delivering biologicals to specific sites. Hydrodynamic gene delivery is a technique that allows intravenously injected DNA to be taken up and expressed by the liver. In the present study, we have taken advantage of hydrodynamically delivered expression vectors encoding certain peptides fused to Gaussia luciferase that possess the ability to home in on their target molecules which are encountered in the tumor microenvironment. These targeting peptides can then be imaged in vivo at the sites at which they accumulate using the Xenogen IVIS system to detect luciferase activity.
Fig. 5- Sequencing of GLuc Fused Target Peptides. Clones were sequenced and compared to predicted sequences. Targeting peptides F3 and pHLIP had amino acid sequences with complete identity to the predicted sequences. RGD showed a single point mutation in a wobble position generating a silent mutation. The RGD amino acid sequence however remains conserved.
Flexible Linker pHLIP
F3
RGD
pHLIP
Flexible Linker RGD
Flexible Linker F3
Conclusions
•GLuc is secreted by the liver.
•GLuc activity is not compromised by the addition of a flexible linker and target peptide.
•pHLIP integrates itself into acidic membranes. GLuc activity is detected in the stomach and secum of injected mice (data not shown). •Absence of liver activity indicates intracellular transport has not taken place at this time point.
•Only autofluorescence is detected in CAGEN control mice. The auto-oxidation of coelenterazine in serum emits low levels of detectable light.
•GLuc:F3 and GLuc:RGD have yet to be imaged and analyzed.
Hydrodynamic Injection1.
•GLuc control (x3 mice)
•GLuc: pHLIP (x3 mice)
•GLuc:F3 (x3 mice)
•GLuc: RGD (x3 mice)
•CAGEN (empty vector control) (x3 mice)
Liver
GLuc
GLuc
GLucGLuc
Liver
2.
Injected DNA
GLuc is secreted by the liver
GLuc
GLuc
GLuc
GLuc
3. GLuc accumulates at the tumor site
Methods
4. Coelenterazine injection
GLuc
GLuc
GLuc
GLuc 5. GLuc emits detectable light
Xenogen imaging6.
Fig. 6- In vivo Imaging of Hydrodynamically Injected Mice. Balb/c mice were intravenously injected via tail vein with GLuc DNA construct. Hydrodynamic injection delivers DNA to the liver and in the process damages liver tissues. Gaussia luciferase is then secreted from the liver and is delivered to tumor sites through the blood stream. GLuc targeting peptides accumulate at the tumor site where they bind to their target molecules. A second tail vein injection delivers the Gaussia luciferase substrate coelenterazine to the tumor site where GLuc has accumulated and emits detectable light. Mice were anesthetized and imaged using the Xenogen IVIS spectrum.
GLuc pHLIP CAGEN
