1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

Title

A novel glycosylphosphatidylinositol-anchored glycoside hydrolase from Ustilago

esculenta functions in β-1,3-glucan degradation.

Running title

GPI-anchored β-1,3-glucanase from U. esculenta.

Authors

Masahiro Nakajima1, 3, Tetsuro Yamashita2, Machiko Takahashi1, Yuki Nakano1 and

Takumi Takeda1*

Affiliations

1 Iwate Biotechnology Research Center, 22-174-4 Kitakami, Iwate 024-0003, Japan.

2 Iwate University, 3-18-8 Ueda Morioka, Iwate 020-8550, Japan.

Present address

3 Tokyo University of Science, 2641 Yamazaki Noda, Chiba 278-8510, Japan.

*Corresponding author

Takumi Takeda

22-174-4, Narita, Kitakami, Iwate 024-0003, Japan.

Phone: +81 (197) 68-2911

Fax: +81 (197) 68-3811

E-mail: ttakeda@ibrc.or.jp.

1

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00483-12 AEM Accepts, published online ahead of print on 8 June 2012

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

2

Abstract 25

A glycoside hydrolase responsible for laminarin degradation was partially purified to 26

homogeneity from a Ustilato esculenta culture filtrate by weak cation-exchange, strong 27

cation-exchange and size-exclusion chromatography. Three proteins in 28

enzymatically-active fractions were digested with chymotrypsin followed by 29

LC/MS/MS analysis, resulting in the identification of three peptide sequences that 30

shared significant similarity to a putative β-1,3-glucanase, a member of glucoside 31

hydrolase family (GH) 16 from Sporisorium reilianum SRZ2. A gene encoding a 32

laminarin-degrading enzyme from U. esculenta, lam16A, was isolated by PCR using 33

degenerate primers designed based on the S. reilianum SRZ2 β-1,3-glucanase gene. 34

Lam16A possesses a GH16 catalytic domain with an N-terminal signal peptide and a 35

C-terminal glycosylphosphatidylinositol (GPI) anchor peptide. Recombinant Lam16A 36

fused to an N-terminal FLAG peptide (Lam16A-FLAG) overexpressed in Aspergillus 37

oryzae exhibited hydrolytic activity towards β-1,3-glucan specifically, and was 38

localized both in the extracellular and in the membrane fractions, but not in the cell wall 39

fraction. Lam16A without GPI anchor signal peptide was secreted extracellularly and 40

not detected in the membrane fraction. Membrane-anchored Lam16A-FLAG was 41

released completely by treatment with phosphatidylinositol-specific phospholipase C. 42

These results suggest that Lam16A is anchored in the plasma membrane in order to 43

modify β-1,3-glucan associated with the inner cell wall, and that Lam16A is also used 44

for catabolism of β-1,3-glucan after its release in the extracellular medium. 45

46

47

48

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

3

INTRODUCTION 49

β-1,3-Glucan occurs widely as a major component of the cell wall of most fungi. 50

Extracellular β-1,3-glucan forming a gel-like sheath is produced by Phanerochaete 51

chrysosporium (35, 37, 44). Plants produce a form of cell wall-associated β-1,3-glucan, 52

called callose, in response to biotic or abiotic stress (11), while some algae accumulate 53

β-1,3-glucan as a storage polysaccharide (29). 54

Several glycoside hydrolases are involved in β-1,3-glucan biosynthesis and 55

degradation. Hydrolysis of β-1,3-glucan can be performed by the combined action of 56

endo-β-1,3-glucanases and β-glucosidases, which are found in glycoside hydrolase 57

family (GH) 16, 17, 55, 64 and 81, and GH3 and 5, respectively, based on the Cazy 58

database (http://www.cazy.org/). β-1,3-Glucanosyltransferase from Aspergillus 59

fumigatus, a member of the GH72 family, catalyzes hydrolysis of β-1,3-glucan, and 60

simultaneously produces an insoluble β-1,3-glucan from laminarioligosaccharides by a 61

transglycosylation reaction (19). Modification of β-1,3-glucan by these enzymes is 62

thought to play a significant role in cell wall morphogenesis and in nutrient (carbon) 63

acquisition. 64

Glycosylphosphatidylinositol (GPI) anchoring is a posttranslational lipid 65

modification that anchors proteins to the plasma membrane. A number of examples are 66

known, including a variety of glycoside hydrolases, such as endo-β-1,3-glucanase and 67

chitinase in GH16, 17, 72 and 81 (13, 36, 45), and proteins involved in transmembrane 68

signaling, e.g., receptors and adhesion molecules (3, 26, 33). The core structure of the 69

GPI anchor moiety is highly conserved from yeast to mammals (39). GPI anchoring to 70

proteins occurs in the endoplasmic reticulum. Then GPI-anchored proteins transit the 71

secretory pathway to reach the cell surface (33). The GPI anchor moiety is further 72

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

4

modified during transport. The remodeling process is essential for the proper 73

association of GPI-anchored proteins with lipid microdomains (lipid rafts), areas rich in 74

sphingolipids and sterols formed by localized phase separation in the plasma membrane 75

(10, 40). GPI-anchored proteins bound to the membrane have a longer turnover rate 76

than membrane proteins with proteinaceous transmembrane anchor (5, 23, 38). Side 77

chains in the GPI anchor moiety allow for a high packing density of the tethered 78

proteins (25). 79

Proteomic analysis has revealed that many proteins possessing a GPI anchor signal 80

peptide are covalently linked to the cell wall (6, 12, 14, 15, 25, 48). Crh1p and Crh2p, 81

which are putative GPI-anchored enzymes belonging to the GH16 family, are covalently 82

linked to the cell wall of Saccharomyces cerevisiae, and catalyze transglycosylation of 83

chitin to β-1,3-glucose branches of the β-1,6-glucan backbone (7). Deletion of genes 84

encoding Crh family proteins caused a remarkable reduction of β-1,6-glucan in the cell 85

wall of Candida albicans (34). These observations suggest the involvement of Crh1p 86

and Crh2p in cell wall organization. Thus, GPI-anchored glucoside hydrolases are found 87

to localize to the plasma membrane or cell wall through a GPI anchor moiety. However, 88

the significance of the hydrolytic activity of GPI-anchored glycoside hydrolases 89

remains unknown. In this study, to our knowledge, we identify and characterize for the 90

first time, a GPI-anchored β-1,3-glucanase (Lam16A) from Ustilago esculenta that is 91

localized to the membrane via a GPI anchor, but which is also secreted extracellularly. 92

The basidiomyceteous fungus Ustilago esculenta is infectious towards Zizania 93

latifolia (aquatic grass) and causes smut gall in the flowering stem, interfering with 94

inflorescence and seed production, resulting in an increase in the size and the number of 95

host cells (9, 46). Cell wall-degrading enzymes derived from U. esculenta have been 96

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

5

proposed to be involved in depolymerization of cell wall polysaccharides that induces 97

elongation of hyphae and results in host cell wall degradation and loosening during 98

plant cell enlargement (8, 27, 43). The action of endo-β-1,3-glucanase could contribute 99

to cell wall modification of the fungus and of the plant host, as well as to 100

saccharification in concert with β-glucosidases (32). The function of Lam16A in 101

saccharification in cultured cells of U. esculenta and on cell wall depolymerization 102

during smut gall formation in Z. latifolia infected with U. esculenta is also considered. 103

104

MATERIALS AND METHODS 105

Strain, culture conditions, and carbohydrates 106

U. esculenta (NBRC 9887) and A. oryzae (RIB-40) were obtained from the National 107

Institute of Technology and Evaluation (NITE, Chiba, Japan). Z. latifolia infected with 108

U. esculenta was gratefully provided by Mr. Okubo. U. esculenta was grown in 1 L of 109

modified Czapek-Dox medium (3% sucrose, 24 mM NaNO3, 7.4 mM KH2PO4, 2.0 mM 110

MgSO4, 6.7 mM KCl, 36 μM FeSO4 7H2O and 10 µM thiamine, pH 6.5) for 3 days at 111

25 ˚C at 130 rpm. 112

Laminarin (Sigma-Aldrich, MO, USA), carboxymethyl (CM) cellulose 113

(Sigma-Aldrich) and hydroxyethyl (HE) cellulose (Sigma-Aldrich) were purchased 114

from Sigma-Aldrich (MO, USA), and CM-pachyman, CM-curdlan, lichenan, 115

pachyman, barley 1,3-1,4-β-glucan, tamarind xyloglucan, arabinogalactan, arabinan and 116

polygalacturonate were obtained from Megazyme (Wicklow, Ireland), and 117

laminarioligosaccharides with degree of polymerization 2-7 (Seikagaku Biobusiness, 118

Tokyo, Japan). Rice xylan was extracted from rice cell walls with 24 % (w/v) KOH 119

containing 0.05 % (w/v) NaBH4 after treatment with 4 % (w/v) KOH containing 0.05 % 120

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

6

NaBH4. 121

122

Purification of laminarin-degrading enzymes 123

Culture filtrates of U. esculenta were collected through cheesecloth, equilibrated with 124

10 mM sodium phosphate buffer (pH 7.0) and loaded onto an anion-exchange column 125

(MonoQ HR 5/5, 5 × 50 mm, 1 ml, GE Healthcare, Buckinghamshire, UK). The 126

unbound fraction eluted from the MonoQ column was equilibrated with 10 mM sodium 127

phosphate buffer (pH 6.0) by ultrafiltration (Amicon Ultra-15, Millipore, MA, USA) 128

and loaded onto a weak cation-exchange column (Toyopearl CM-650, 1 ml, TOSOH, 129

Tokyo, Japan) equilibrated with the same buffer. The unbound fraction eluted from the 130

CM-650 column was equilibrated with 10 mM sodium acetate buffer (pH 4.0) by 131

ultrafiltration and loaded onto a strong cation-exchange column (UNOsphereTM S, 1 ml, 132

Bio-rad, CA, USA) equilibrated with the same buffer. After washing with the same 133

buffer, bound proteins were eluted with a linear gradient of 0-0.05 M NaCl for 5 min 134

and 0.05-0.25 M NaCl for 25 min in the same buffer at a flow rate of 1 ml/min. The 135

eluate was collected in 1 ml portion. 136

137

Assay for hydrolytic activity 138

Hydrolytic activity of the laminarin-degrading enzyme was assayed by aniline blue 139

staining during the purification procedure as described previously (22). Reaction 140

mixtures (25 μl) comprised of enzyme fraction (5 μl), 0.1 % (w/v) laminarin and 100 141

mM sodium phosphate (pH 6.0) were incubated at 30 ℃ for 1 h (weak cation exchange 142

fractions) or 3.8 h (strong cation exchange fractions), after which 100 μl of aniline blue 143

(0.033 %, w/v) in 0.17 N HCl, and 0.5 M glycine-NaOH (pH 9.5) were added. Residual 144

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

7

laminarin was measured as fluorescence (400 nm excitation and 480 nm emission) of 145

the laminarin-aniline blue complex after a 30 min incubation at 50 ℃ (SpectraMax 190 146

spectrophotometer, Molecular Devices, CA, USA). 147

Hydrolytic activity toward polysaccharides was measured by the increase in 148

reducing ends according to the PAHBAH method using p-hydroxybenzoic acid 149

hydrazide (24). A reaction mixture (40 μl) containing enzyme preparation (0.063 μg), 150

0.02 % (w/v) polysaccharide, 0.01 % (w/v) BSA and 100 mM sodium acetate (pH 5.0) 151

was incubated at 30 ℃ for 30 min. After centrifugation at 22,000 × g for 1 min, the 152

supernatant (30 μl) was mixed with 90 μl of 1% (w/v) 4-hydroxybenzoic 153

hydrazide-HCl. The mixture was boiled for 5 min and absorbance was measured at 410 154

nm. The increase in reducing ends was calculated based on a glucose standard curve. 155

Laminarioligosaccharide hydrolysis was assayed in the same way as for other 156

polysaccharides except that the substrate concentration was 1 mM. The reaction was 157

stopped by incubation at 80 ℃ for 5 min. The reaction solution was diluted 10-fold with 158

distilled water and analyzed by HPLC (Dionex ICS-3000, Dionex, CA, USA) equipped 159

with an anion exchange column (CarboPac PA-1, 4×250 mm, Dionex). Samples were 160

eluted using a gradient of 0-300 mM sodium acetate for 30 min in the presence of 100 161

mM NaOH at a flow rate of 0.5 ml/min. Activity was determined by the sum of released 162

laminaribiose and laminaritriose. Quantification of peak areas corresponding to each 163

sugar was based on standard calibration curves for laminarioligosaccharides (degree of 164

polymerization = 2-7). 165

166

Protein assay 167

Protein concentrations were determined by the bicinchoninic acid method using the 168

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

8

BCA protein assay reagent (Thermo Fisher Scientific, MA, USA). BSA was used as 169

standard protein. Total proteins and glycoproteins after SDS-PAGE were visualized by 170

Sypro Ruby and periodic acid-Schiff (PAS) staining using Pro-Q Emerald 300 171

Glycoprotein Gel Stain Kit (Invitrogen), respectively. 172

173

Effect of temperature and pH on recombinant Lam16A-His7 activity 174

The effect of temperature on hydrolytic activity of Lam16A-His7 was determined by 175

performing the assay at 0-60 ˚C for 10-90 min in 100 mM sodium acetate buffer (pH 176

5.0) and laminarin as substrate followed by the PAHBAH assay. The effect of pH on the 177

activity was determined by incubation at 30 ºC for 30 min in the presence of sodium 178

acetate (pH 3.5-5.0), MES-NaOH (pH5.0-6.0) or sodium phosphate (pH 6.0-7.0). 179

Temperature and pH stability of Lam16A-His7 were determined as activity after 180

pre-incubation of Lam16A-His7 (5.2 μg/ml) in 100 mM sodium acetate buffer (pH 5.0) 181

at various temperatures for 1 h containing 0.01 % BSA or pre-incubation in sodium 182

acetate (pH 3.5-5.0), MES-HCl (pH5.0-6.0), sodium phosphate (pH 6.0-7.0) or Tris-HCl 183

(pH 7.0-8.0) at 30 ºC for 1 h in the presence of 0.01% BSA. 184

185

Kinetic analysis of Lam16A 186

Kinetic parameters of Lam16A (1.0 μg/ml) on laminariheptaose (0.15-5.0 μM) were 187

determined by regression analysis using KaleidaGraph version 3.51 with the following 188

equation based on a Michaelis–Menten equation: v/[E0] = Km[S] / (Km + [S]), where v is 189

the initial velocity of the production of laminaribiose and laminaritriose, and [E0] is 190

enzyme concentration. 191

192

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

9

DNA amplification and cloning 193

Genomic DNA was extracted from U. esculenta cultured cells using a Plant Genome 194

DNA Extraction Kit (G-Bioscience, MO, USA). Total RNAs were prepared from U. 195

esculenta and Z. latifolia using an RNeasy Plant Mini kit (Qiagen, Hilden, Germany) 196

and treated with DNaseI (Invitrogen, CA, USA) for 15 min at 22 ˚C. First strand cDNA 197

was synthesized from total RNA with an oligo(dT)18 primer using SuperScriptIII 198

reverse transcriptase (Invitrogen). PCRs were performed in a reaction mixture 199

containing PrimeStarGXL DNA polymerase (Takara Bio, Shiga, Japan), PrimeStarGXL 200

DNA polymerase buffer, 0.1 mM each dNTP, 0.3 μM primer pairs and DNA template. 201

For amplification of the 5’ and 3’ regions of lam16A, PCR was performed using 202

genomic DNA and primers 5'-GAGCTwsyTGsCTGCTGAksT-3' and 203

5'-GGCACCACsGGmAAgGGcGTCCGCGTkTGG-3' for the 5' region, and 204

5'-TGTACrGykTGCAwyrTmC-3' and 205

5'-CCAmACGCGGACgCCcTTkCCsGTGGTGCC-3' for the 3' region. Primers were 206

designed based on the Sporisorium reilianum SRZ2 β-glucanase gene sequence. 207

Primers 5'-GAAACACTTGACGCATTCCGCCTCCTG-3' and 208

5'-GGTGGGGTTTGCATTGTCCAGAATCGC-3' were designed based on the 5’ and 3’ 209

regions and were used to amplify the complete open reading frame from U. esculenta 210

cDNA pools. The amplified DNA was cloned into a pGEM T-easy vector (Promega) 211

and was used to transform Escherichia coli (DH5α) by heat-shock followed by 212

selection on LB + ampicillin (50 μg/ml) plates. PCR products and plasmid constructs 213

were sequenced using a 3130 Genetic analyzer (Applied Biosystems, CA, USA). 214

215

Sequence analysis 216

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

10

Conserved domains were searched at the National Center for Biotechnology 217

Information website (NCBI, http://www.ncbi.nlm.nih.gov/). N-terminal signal 218

sequences were predicted by SignalP 4.0 Server 219

(http://www.cbs.dtu.dk/services/SignalP/). NetNGlyc 1.0 Server 220

(http://www.cbs.dtu.dk/services/NetNGlyc/) and NetOGlyc 3.1 Server 221

(http://www.cbs.dtu.dk/services/NetOGlyc/) were used to predict glycosylation sites. 222

GPI anchor signal sequences were predicted by the fungal big-II predictor 223

(http://mendel.imp.univie.ac.at/gpi/fungi_server.html). SOSUI engine ver. 1.10 224

(http://bp.nuap.nagoya-u.ac.jp/sosui/) was used for prediction of protein localization. 225

Thirty-six amino acid sequences in GH16 were aligned using ClustalW software 226

(http://www.ebi.ac.uk/Tools/msa/clustalw2/). 227

228

Overexpression of recombinant Lam16A 229

C-terminal his7-tagged lam16A (lam16A-His7) and N-terminal FLAG-tagged 230

(lam16A-FLAG) fusions were generated by PCR using primers 231

5'-GTGGTGATGGCTAGGAGCCAGCGAAGCCATCACTGCAGCG-3' and 232

5'-TTAGTGATGGTGATGGTGGTGATGGCTAGGAGCCAGCG-3' or 5'- 233

GGCCGCGCCCTCGCCGGCGACTATAAGGACGATGACGATAAGGCCAACTGG234

ACACAGACCGCCGTC-3', respectively, and were cloned into a pAmyB expression 235

vector (47) linearized by NaeI using an In-Fusion PCR cloning kit (Clontech, CA, 236

USA). A. oryzae was transformed with the plasmid as described (16, 47). Transformants 237

were selected on Czapek-Dox plates supplemented with 0.1 mg/ml pyrithiamine and 238

cultured in YPM medium containing 100 μg/ml ampicillin at 25 ºC for 3 days at 130 239

rpm as described previously (41). 240

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

11

241

Purification of the recombinant Lam16A-His7 242

Culture filtrates obtained after 3 days of growth of the A. oryzae transformant 243

expressing Lam16A-His7 were used for purifying Lam16A-His7 using 244

polyhistidine-binding resin (TALON metal affinity resin, Clontech, CA, USA) as 245

described previously (42). Purified Lam16A-His7 was concentrated and equilibrated in 246

20 mM sodium phosphate buffer (pH 6.0) by ultrafiltration before use. 247

248

Fractionation of the recombinant Lam16A 249

A. oryzae transformants overexpressing Lam16A-FLAG or Lam16AΔGPI-FLAG were 250

cultured for 2 days in YPM medium at 25 ºC. The culture filtrate (40 ml) obtained 251

following filtration of cells through cheesecloth was concentrated to 500 μl by 252

ultrafiltration and used as the extracellular fraction. The recombinant protein from the 253

extracellular fraction was concentrated for immunoblot analysis as follows. Fractions 254

(200 μl) were mixed with 50 μl of anti-FLAG M2 affinity gel (Sigma-Aldrich) 255

equilibrated with 50 mM Tris-HCl (pH 7.5) containing 150 mM NaCl on ice for 30 min. 256

After washing three times with 400 μl of the same buffer, bound proteins were eluted 257

with 40 μl of 2 % (w/v) SDS solution. 258

U. esculenta cells were homogenized with Lysing Matrix C (MP Biochemicals Japan, 259

Tokyo, Japan) in 50 mM sodium phosphate buffer (pH 6.0) containing 0.5 M NaCl 260

(buffer A) with vigorous shaking at 6 s-1 in two 20 sec pulses and centrifuged at 7,400 × 261

g for 5 min. The pellet, cell wall fraction (700 mg of wet cell, equivalent to 70 ml 262

culture medium), was suspended in 3 ml of 50 mM Tris–HCl (pH 7.4) containing 150 263

mM NaCl, 5 mM EDTA and 2 % (w/v) SDS, and boiled for 10 min. The pellet was 264

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

12

obtained by centrifugation at 5,000 × g. This procedure was repeated twice. The 265

resulting pellet was washed five times with 100 mM sodium acetate (pH 5.5) containing 266

1 mM EDTA and treated with a mixture of Yatalase (5.4 mg, 30 U, Takara Bio) and 267

Lysing enzyme (3 mg, Sigma-Aldrich) in 1.2 ml of 10 mM sodium phosphate (pH 6.0) 268

containing 150 mM NaCl at 37 ℃ for 2 h. The supernatant (100 μl) obtained after 269

centrifugation for 5 min at 22,000 X g and 4 ℃ was subjected to cold acetone 270

precipitation. The precipitate obtained after centrifugation at 22,000 X g for 10 min was 271

dissolved in 10 μl of SDS-PAGE sample buffer. The supernatant after centrifugation of 272

the homogenized cells described above was centrifuged at 22,000 X g for 15 min and 273

the pellet was collected as a membrane fraction. 274

The membrane fraction was washed with buffer A three times, suspended in 300 μl of 275

the buffer A containing 1 % (v/v) Triton X-100, and held 1 h at 4 ˚C. The supernatant 276

obtained by centrifugation at 22,000 X g for 15 min was used as a membrane-solubilized 277

fraction. The membrane-solubilized fraction (100 μl) was subjected to cold acetone 278

precipitation. The pellet obtained by centrifugation at 22,000 X g for 5 min was air-dried 279

and dissolved in 20 μl of SDS-PAGE sample buffer before immunoblot analysis. 280

281

Phosphatidylinositol-specific phospholipase C treatment of membrane fraction 282

The membrane fraction was incubated in 100 μl of 50 mM Tris-HCl (pH 7.5) containing 283

5 mM EDTA and phosphatidylinositol-specific phospholipase C (PI-PLC, 0.4 U, 284

Sigma-Aldrich) at 30 ˚C for 1 h. Heat-inactivated PI-PLC (80 ℃ for 5 min) was used as 285

a control. Following centrifugation of the reaction mixture at 22,000 X g for 10 min, the 286

supernatant contained the PI-PLC-soluble fraction. The pellet was washed three times 287

with 100 μl of buffer A, and then incubated in 100 μl of buffer A containing 1 % Triton 288

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

13

X-100 on ice for 1 h. The supernatant obtained after centrifugation of this solution at 289

22,000 X g for 10 min was precipitated with acetone and the pellet was used as the 290

PI-PLC-insoluble fraction for immunoblot analysis. 291

292

Immunological analysis 293

Proteins were subjected to SDS-PAGE followed by blotting onto a membrane. The 294

membrane was pre-incubated in PBST (25 mM Tris-HCl, pH 7.5, 100 mM NaCl, 0.1 % 295

(v/v) Tween 20) containing 1.5 % (w/v) nonfat milk for 1 h at room temperature and 296

then incubated for 1 h with horseradish peroxidase-conjugated monoclonal antibody 297

against the polyhistidine-tag (Qiagen) or the FLAG-tag (Sigma-Aldrich) diluted 298

1:10,000 in PBST. After washing the membrane four times with PBST for 10 min, the 299

antibody-antigen complex was detected using an ECL Advanced Detection Kit (GE 300

Healthcare) and a Luminescent Image Analyzer LAS-4000 (Fujifilm, Tokyo, Japan). 301

302

Effect of Lam16A on glucose production from laminarin by UeBgl3A 303

Reaction mixtures (20 μl) containing Lam16A (0-2.0 μg), ricombinant U. esculenta 304

β-glucosidase (UeBgl3A, 0.02 μg) produced by A. oryzae (31), 0.1 % (w/v) laminarin 305

and 100 mM sodium phosphate (pH 6.0) were incubated at 30 ˚C for 30 min. The 306

amount of glucose was determined using a glucose oxidase assay kit (Megazyme) and 307

calculated based on glucose calibration curve. 308

309

RT-PCR of lam16A gene 310

Extraction of total RNA from Z. latifolia galls at different hypertrophic stages (before 311

hypertrophy, 1, 20, and 170 g in fresh weight) and first strand cDNA synthesis were 312

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

14

carried out as described above. RT-PCR was performed using primers: 313

5'-ACTCGTCGCCATGGAACGATCTTTCGG-3' and 314

5'-GTTTGCGGTGCTACCACCAATAGTGTAG-3'. Actin DNA was amplified by PCR 315

using primers: 5'-GACGGACAGGTGATCACCATTGGCAAC-3' and 316

5'-CTCCTGCTTCGAGATCCACATCTGCTG-3' to standardize reaction conditions. 317

318

Nucleotide sequence accession number. 319

A gene encoding Lam16A have been deposited in DNA Data Bank of Japan (DDBJ) 320

under accession number AB691944. 321

322

RESULTS 323

Purification of laminarin-degrading enzyme 324

In a previous study, we reported that U. esculenta secreted enzymes responsible for 325

laminarin degradation in culture medium containing glucose as sole carbon source (32). 326

In the present study, we investigated a protein from a U. esculenta culture filtrate with 327

endo-hydrolyzing activity on laminarin. When the culture filtrate was loaded onto an 328

anion-exchange column, laminarin-degrading activity was detected in the unbound 329

fraction. Application of the unbound fraction onto Toyopearl CM-650, a weak 330

cation-exchange column, also resulted in laminarin-degrading activity eluting in the 331

unbound fraction (Fig. 1A). When the major enzymatically-active fraction (fraction 2, 332

Fig. 1A) was loaded onto UNO sphere S, a strong cation-exchange column, the major 333

activity was detected in fractions 11-13 in which three major proteins of 60, 40, and 30 334

kDa were observed by silver staining (Fig. 1B). 335

336

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

15

Identification of laminarin-degrading enzyme 337

The three major proteins were subjected to chymotrypsin digestion and analyzed by 338

LC/MS/MS (see materials and methods in the supplementary material). Three peptide 339

sequences from the 60 kDa protein, in which two contained one mismatch each, were 340

identical to those found in a putative GH16 β-1,3-glucanase from S. reilianum SRZ2 341

(Table 1). Two peptide sequences were obtained from the 40 kDa protein, one of which 342

is annotated as a phosphatidylethanolamine-binding protein. The other showed no 343

conserved domains based on a domain search at the NCBI website. One peptide 344

sequence obtained from the 30 kDa protein is not annotated as any conserved domains. 345

Thus, it was concluded that the 60 kDa protein was responsible for laminarin 346

degradation. 347

348

Sequence analysis 349

The gene encoding the 60 kDa protein, U. esculenta laminarin-degrading enzyme 350

belonging to GH16 (Lam16A), was amplified by PCR from a U. esculenta cDNA pool 351

using degenerate primers based on the S. reilianum SRZ2 GH16 β-glucanase gene. The 352

cloned DNA consisted of 1,196 bp including a predicted open reading frame of 1,173 353

bp. The translated amino acid sequence indicates that Lam16A contains the conserved 354

GH16 catalytic domain, secretion signal peptide consisting of 25 amino acids at the 355

N-terminus, and a GPI anchor signal peptide consisting of 29 amino acids at the 356

C-terminus. The N-terminal isoleucine in the amino acid sequence 357

NRAGGGIIAMERSF from S. reilianum SRZ2 is replaced by leucine in Lam16A. This 358

mismatch occurs due to the fact that isoleucine and leucine have the same molecular 359

weight. A phylogenetic tree of GH16 proteins shows that Lam16A belongs to the 360

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

16

Basidiomycetes group, with clear separation from Crh family proteins and characterized 361

β-1,3-glucanases, largely from eukaryotes (Fig. S1 in the supplementary material). 362

Among Lam16A homologs, the GPI anchor signal peptide is found only in proteins 363

from the Ustilaginomycotina subphylum. 364

365

Enzymatic properties of recombinant Lam16A-His7 366

In order to generate recombinant Lam16A, five C-terminal amino acid residues from 367

Lam16A were replaced by heptahistidine residues (His7) because native Lam16A fused 368

with C-terminal His7 could not be achieved (data not shown). Recombinant 369

Lam16A-His7 overexpressed in A. oryzae was purified using polyhistidine affinity 370

chromatography before determining enzymatic properties. Purified Lam16A-His7 371

exhibited a single broad band around 110 kDa by Sypro Ruby staining (Fig. S2A). 372

Immunoblot analysis using an antibody against polyhistidine showed a single band of 373

the identical molecular mass observed by Sypro Ruby staining (Fig. S2B). The enzyme 374

was detected clearly by glycoprotein analysis (Fig. S2C), indicating that recombinant 375

Lam16A-His7 was highly glycosylated because Lam16A-His7 has a calculated 376

molecular weight of 39 kDa, with 7 potential N-glycosylation sites and 9 potensial 377

O-glycosylation sites. 378

Maximum hydrolytic activity on laminarin was observed at pH 5.0 and 40 ºC (Fig. 379

2A and B). The enzyme retained over 80 % residual activity after incubation at 10-40 ˚C 380

and pH 3.5-7.0 for 1h (Fig. 2C and D). 381

382

Substrate specificity 383

Hydrolytic activity towards polysaccharides was determined to investigate substrate 384

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

17

specificity, Lam16A-His7 exhibited activity only on β-1,3-glucan among the 385

polysaccharides tested (Table 2), indicating that the enzyme is highly specific for 386

β-1,3-glucan hydrolysis. Activity towards laminarioligosaccharides showed that 387

Lam16A-His7 preferentially hydrolyzed laminarioligosaccharides with degree of 388

polymerization >4 (Table 2). Lam16A exhibited the highest activity towards 389

laminariheptaose among tested, showing 0.61±0.21 mM for Km and 21±2.2 for kcat. The 390

end products generated from the hydrolysis of laminarioligosaccharides were 391

laminaribiose and laminaritriose, and transglycosylation activity towards 392

laminarioligosaccharides was not observed (data not shown). 393

394

Effect of GPI anchor signal peptide on localization of Lam16A-FLAG 395

Lam16A localization in an A. oryzae transformant overexpressing Lam16A-FLAG or 396

Lam16AΔGPI-FLAG was determined immunologically in order to investigate the role 397

of the putative GPI anchor signal peptide. Lam16A-FLAG was found in the membrane 398

and extracellular fractions but not in the cell wall fraction, whereas 399

Lam16AΔGPI-FLAG was detected only in the extracellular fraction (Fig. 3A). 400

Similarly, higher hydrolytic activity towards laminarin was detected in the membrane 401

fraction from the transformant overexpressing Lam16A-FLAG and in the extracellular 402

fraction from the transformant overexpressing Lam16AΔGPI-FLAG (Fig. 3B and C). 403

The results from the enzyme assay are consistent with those from the immunoblot 404

analysis. These results indicates that the GPI anchor signal peptide plays a significant 405

role in localization of Lam16A in the membrane. 406

407

Effect of PI-PLC treatment on localization of Lam16A-FLAG 408

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

18

The effect of PI-PLC treatment on Lam16A-FLAG localization was examined. PI-PLC 409

treatment resulted in Lam16A-FLAG localizing in the PI-PLC-soluble fraction, whereas 410

the enzyme remained in the membrane fraction after treatment with heat-inactivated 411

PI-PLC (Fig. 4). Immunoblot analysis revealed two and three bands representing 412

Lam16A-FLAG likely due to a variable degree of glycosylation. These results imply 413

that digestion of the GPI anchor with PI-PLC released Lam16A from the membrane. 414

415

Enhanced glucose production by the action of Lam16A. 416

Glucose production from laminarin using purified Lam16A and UeBgl3A was assayed 417

(Fig. 5). UeBgl3A produced 1.78 μg glucose from laminarin in this experiment whereas 418

Lam16A (2.0 μg) only released 0.64 μg glucose. The levels of glucose production was 419

increased as the content of added Lam16A increased. Maximal glucose production (6.94 420

μg) was attained in the presence of 1.0 μg Lam16A, about 4-fold higher than that 421

produced by UeBgl3A only. The result suggests that production of 422

laminarioligosaccharides from laminarin by the action of Lam16A enhanced glucose 423

production by UeBgl3A. 424

Expression of lam16A and UeBgl3A was examined by PCR to investigate involvement 425

during Z. latifolia gall formation. High levels of lam16A transcripts were detected at the 426

initial stage of gall formation (Fig. 6) and UeBgl3A was expressed constitutively. The 427

result may suggests that Lam16A is involved in cell wall loosening which leads to 428

massive cell expansion, and in metabolyzing β-1,3-glucan with cooperative action of 429

UeBgl3A. 430

431

DISCUSSION 432

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

19

U. esculenta grown in liquid medium secretes enzymes involved in laminarin 433

degradation. Lam16A was able to degrade β-1,3-glucan specifically and preferred 434

substrates with degree of polymerization >4. UeBgl3A, a β-glucosidase from U. 435

esculenta, produces glucose from a variety of β-glucosides. Laminarioligosaccharides 436

with degree of polymerization 2-4 have been reported to be easily hydrolyzed substrates 437

by this enzyme (32). The cooperative activity of Lam16A and UeBgl3A is suggested to 438

be involved in digestion of β-1,3-glucan to glucose efficiently during growth of U. 439

esculenta in culture medium and in Z. latifolia (Fig. 5 and 6). 440

Lam16A was partially purified from the culture filtrate, indicating that the enzyme is 441

secreted extracellularly. However, amino acid sequence analysis of Lam16A revealed a 442

C-terminal GPI anchor signal peptide that indicates a plasma membrane location. 443

Recent proteomic analyses have shown that many proteins possessing GPI anchor 444

signal peptides from Aspergillus nidulans and S. cerevisiae are covalently linked to the 445

cell wall (6, 12, 14, 15, 17, 48), suggesting a possible cell wall location for Lam16A. 446

While computational predictions would be helpful, to our knowledge, systematic 447

sequence-based predictions of cell wall localization have not yet been performed for 448

proteins in any organism. To investigate the function of a possible GPI anchor signal 449

peptide in Lam16A, localization of recombinant Lam16A-FLAG and 450

Lam16AΔGPI-FLAG in A. oryzae was detected immunologically. Most of the 451

Lam16A-FLAG protein was found in the membrane and extracellular fractions (Fig. 452

3A). Conversely, Lam16AΔGPI-FLAG, lacking the GPI anchor signal peptide, was 453

found only in the extracellular fraction. Furthermore, treatment of the membrane 454

fraction from A. oryzae with PI-PLC released Lam16A-FLAG to the PI-PLC-soluble 455

fraction (Fig. 4). These results lead to the conclusion that the GPI anchor signal peptide 456

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

20

in Lam16A plays a significant role in its membrane localization with GPI anchor. 457

GPI-anchored proteins in A. fumigatus have been reported to be released from 458

membrane preparations by endogenous PI-PLC (4). Similarly, Lam16A found in the 459

extracellular fractions from U. esculenta and A. oryzae might be released by the action 460

of an endogenous PI-PLC. Proteolytic release of Lam16A might also occur by analogy 461

to yeast Crh2p that is released from the membrane depending on due to the activity of 462

the transmembrane protease Yps1p (30). Hydrolytic activity of the membrane fraction 463

from A. oryzae overexpressing Lam16A-FLAG was much higher than that from the 464

Lam16AΔGPI-FLAG-overexpressing strain (Fig. 3B), indicating that Lam16A in the 465

membrane is enzymatically-active. Based on these results, we propose that Lam16A is 466

transferred to the plasma membrane where the enzyme acts hydrolysis of β-1,3-glucan 467

and that the enzyme is used even after released extracellularly. 468

Lam16A-His7 was found to hydrolyze β-1,3-glucan specifically, and to act most 469

efficiently on substrates of degree of polymerization >4 (Table 2). This suggests 470

cooperative activity with UeBgl3A that acts preferentially on laminarioligosaccharides 471

of degree of polymerization 2-4 to produce glucose. Lam16A did not exhibit 472

transglycosylation activity towards laminarioligosaccharides unlike Eng2 possessing 473

GPI anchor signal peptide, a GH16 endo-β-1,3(4)-glucanase with transglycosylation 474

activity towards laminaritetraose (18) or Crh family proteins (7). Such a range of 475

activity may have evolved by a process of accumulated DNA substitutions as seen in the 476

diversity of amino acid sequences in the GH16 phylogenetic tree (Fig. S1), in which the 477

GPI anchor signal is conserved only in the Ustilaginomycotina subphylum among the 478

Basidiomycetes cluster. 479

Together these results suggest that GPI-anchored Lam16A modifies the inner 480

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

21

surface of endogenous cell wall, and afterwards is secreted to cleave β-1,3-glucan 481

randomly to loosen the cell wall of the pathogen and/or the host, allowing for catabolic 482

use of β-1,3-glucan through cooperative action of β-glucosidases. This possibility is 483

supported by observations that Utr2, Crh11 and Crh12, all GPI-anchored cell wall 484

proteins, play significant roles in cell wall formation (6, 34), and pea cellulase localizes 485

at inner surface of cell wall in auxin-treated pea epicotyl (2). Furthermore, as 486

β-1,3-glucan and its sulfated derivative form become elicitor molecules that induce 487

defense responses in various plants, their catabolism would play an important additional 488

role in depressing the activation of host defense mechanisms (1, 20, 21, 28). During gall 489

formation, Lam16A could function to modify the U. esculenta cell wall and to degrade 490

plant β-1,3-glucan (callose) in the host cell wall. 491

Synthesis and degradation of callose are involved in plant growth and development, 492

plasmodesmata regulation, and stress response (11), even though callose is only a minor 493

cell wall component. The action of Lam16A may also cause morphological changes, 494

especially during gall formation in Z. latifolia when lam16A is highly expressed. We 495

anticipate that the findings reported herein on localization and hydrolytic activity of a 496

novel GPI-anchored β-1,3-glucanase will lead to a greater understanding of the 497

significance of cell wall modification by hydrolytic enzymes during hyphal extension 498

and fungal growth, and their effects on host plant morphogenesis. 499

500

ACKNOWLEDGEMENTS 501

We thank R. Oba, M. Kikuchi and M. Iwai for technical assistance in preparing plasmid 502

DNA and transforming A. oryzae. 503

504

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

22

FUNDING 505

This work was supported in part by grant No. 23780111 from the Japanese Society for 506

the Promotion of Science. 507

508

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

23

REFERENCES 509

1. Aziz A, Poinssot B, Daire X, Adrian M, Bezier A, Lambert B, Joubert JM, Pugin 510

A. 2003. Laminarin elicits defense responses in grapevine and induces protection 511

against Botrytis cinerea and Plasmopara viticola. Mol. Plant-Microbe Interact. 512

16:1118-28. 513

2. Bal AK, Verma DPS, Byrne H, Maclachlan G. 1976. Subcellular localization of 514

cellulases in auxin-treated pea. J. Cell Biol. 69:97-105. 515

3. Bhatnagar RS, Gordon JI. 1997. Understanding covalent modifications of proteins 516

by lipids: where cell biology and biophysics mingle. Trends Cell Biol. 7:14-20. 517

4. Bruneau JM, Magnin T, Tagat E, Legrand R, Bernard M, Diaquin M, Fudali C, 518

Latge JP. 2001. Proteome analysis of Aspergillus fumigatus identifies 519

glycosylphosphatidylinositol-anchored proteins associated to the cell wall biosynthesis. 520

Electrophoresis 22:2812-23. 521

5. Bulow R, Nonnengasser C, Overath P. 1989. Release of the variant surface 522

glycoprotein during differentiation of bloodstream to procyclic forms of Trypanosoma 523

brucei. Mol. Biochem. Parasitol. 32:85-92. 524

6. Cabib E, Blanco N, Grau C, Rodriguez-Pena JM, Arroyo J. 2007. Crh1p and 525

Crh2p are required for the cross-linking of chitin to β(1-6)glucan in the Saccharomyces 526

cerevisiae cell wall. Mol. Microbiol. 63:921-35. 527

7. Cabib E, Farkas V, Kosik O, Blanco N, Arroyo J, McPhie P. 2008. Assembly of 528

the yeast cell wall. Crh1p and Crh2p act as transglycosylases in vivo and in vitro. J. Biol. 529

Chem. 283:29859-72. 530

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

24

8. Carpita NC, Gibeaut DM. 1993. Structural models of primary cell walls in 531

flowering plants: consistency of molecular structure with the physical properties of the 532

walls during growth. Plant J. 3:1-30. 533

9. Chan TS, Thrower LB. 1980. The host-parasite relationship between Zizania 534

caduciflora Turcz. and Ustilago esculenta P. Henn., II. Ustilago esculenta in culture. 535

New Phytol. 85:209-216. 536

10. Chatterjee S, Mayor S. 2001. The GPI-anchor and protein sorting. Cell Mol. Life 537

Sci. 58:1969-87. 538

11. Chen XY, Kim JY. 2009. Callose synthesis in higher plants. Plant Signal Behav. 539

4:489-92. 540

12. de Groot PW, Brandt BW, Horiuchi H, Ram AF, de Koster CG, Klis FM. 2009. 541

Comprehensive genomic analysis of cell wall genes in Aspergillus nidulans. Fungal 542

Genet. Biol. 46:S72-81. 543

13. de Groot PW, Hellingwerf KJ, Klis FM. 2003. Genome-wide identification of 544

fungal GPI proteins. Yeast 20:781-96. 545

14. Fujii T, Shimoi H, Iimura Y. 1999. Structure of the glucan-binding sugar chain of 546

Tip1p, a cell wall protein of Saccharomyces cerevisiae. Biochim. Biophys. Acta 547

1427:133-44. 548

15. Fujita M, Jigami Y. 2008. Lipid remodeling of GPI-anchored proteins and its 549

function. Biochim. Biophys. Acta 1780:410-20. 550

16. Gomi K, Imura Y, Hara S. 1987. Integrative transformation of Aspergillus oryzae 551

with a plasmid containing the Aspergillus nidulans argB gene. Agri. Biol. Chem. 552

51:2549-2555. 553

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

25

17. Hamada K, Fukuchi S, Arisawa M, Baba M, Kitada K. 1998. Screening for 554

glycosylphosphatidylinositol (GPI)-dependent cell wall proteins in Saccharomyces 555

cerevisiae. Mol. Gen. Genet. 258:53-9. 556

18. Hartl L, Gastebois A, Aimanianda V, Latge JP. 2010. Characterization of the 557

GPI-anchored endo β-1,3-glucanase Eng2 of Aspergillus fumigatus. Fungal Genet. Biol. 558

48:185-91. 559

19. Hartland RP, Fontaine T, Debeaupuis JP, Simenel C, Delepierre M, Latge JP. 560

1996. A novel β-(1-3)-glucanosyltransferase from the cell wall of Aspergillus fumigatus. 561

J. Biol. Chem. 271:26843-9. 562

20. Inui H, Yamaguchi Y, Hirano S. 1997. Elicitor actions of 563

N-acetylchitooligosaccharides and laminarioligosaccharides for chitinase and 564

L-phenylalanine ammonia-lyase induction in rice suspension culture. Biosci. Biotechnol. 565

Biochem. 61:975-8. 566

21. Klarzynski O, Plesse B, Joubert JM, Yvin JC, Kopp M, Kloareg B, Fritig B. 567

2000. Linear β-1,3 glucans are elicitors of defense responses in tobacco. Plant Physiol. 568

124:1027-38. 569

22. Ko YT, Cheng WY. 2005. Fluorescence versus Radioactivity for Assaying 570

Antifungal compound inhibited yeast 1,3-β-glucan synthase activity. J. Food Drug Anal. 571

13:184-191. 572

23. Lemansky P, Fatemi SH, Gorican B, Meyale S, Rossero R, Tartakoff AM. 1990. 573

Dynamics and longevity of the glycolipid-anchored membrane protein, Thy-1. J. Cell 574

Biol. 110:1525-31. 575

24. Lever M. 1972. A new reaction for colorimetric determination of carbohydrates. 576

Anal. Biochem. 47:273-9. 577

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

26

25. McConville MJ, Ferguson MA. 1993. The structure, biosynthesis and function of 578

glycosylated phosphatidylinositols in the parasitic protozoa and higher eukaryotes. 579

Biochem. J. 294:305-24. 580

26. McLaughlin S, Aderem A. 1995. The myristoyl-electrostatic switch: a modulator 581

of reversible protein-membrane interactions. Trends Biochem. Sci. 20:272-6. 582

27. McQueen-Mason S, Durachko DM, Cosgrove DJ. 1992. Two endogenous 583

proteins that induce cell wall extension in plants. Plant Cell 4:1425-33. 584

28. Menard R, Alban S, de Ruffray P, Jamois F, Franz G, Fritig B, Yvin JC, 585

Kauffmann S. 2004. β-1,3-Glucan sulfate, but not β-1,3-glucan, induces the salicylic 586

acid signaling pathway in tobacco and Arabidopsis. Plant Cell 16:3020-32. 587

29. Michel G, Tonon T, Scornet D, Cock JM, Kloareg B. 2010. Central and storage 588

carbon metabolism of the brown alga Ectocarpus siliculosus: insights into the origin 589

and evolution of storage carbohydrates in Eukaryotes. New Phytol. 188:67-81. 590

30. Miller KA, DiDone L, Krysan DJ. 2010. Extracellular secretion of overexpressed 591

glycosylphosphatidylinositol-linked cell wall protein Utr2/Crh2p as a novel protein 592

quality control mechanism in Saccharomyces cerevisiae. Eukaryot. Cell 9:1669-79. 593

31. Mills K, Mills PB, Clayton PT, Johnson AW, Whitehouse DB, Winchester BG. 594

2001. Identification of α1-antitrypsin variants in plasma with the use of proteomic 595

technology. Clin. Chem. 47:2012-22. 596

32. Nakajima M, Yamashita T, Takahashi M, Nakano Y, Takeda T. 2011. 597

Identification, cloning, and characterization of β-glucosidase from Ustilago esculenta. 598

Appl. Microbiol. Biotechnol. 93:1989-1998. 599

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

27

33. Orlean P, Menon AK. 2007. GPI anchoring of protein in yeast and mammalian 600

cells, or: how we learned to stop worrying and love glycophospholipids. J. Lipid Res. 601

48:993-1011. 602

34. Pardini G, De Groot PW, Coste AT, Karababa M, Klis FM, de Koster CG, 603

Sanglard D. 2006. The CRH family coding for cell wall glycosylphosphatidylinositol 604

proteins with a predicted transglycosidase domain affects cell wall organization and 605

virulence of Candida albicans. J. Biol. Chem. 281:40399-411. 606

35. Pitson SM, Seviour RJ, McDougall BM. 1993. Noncellulolytic fungal 607

β-glucanases: their physiology and regulation. Enzyme Microb. Technol. 15:178-92. 608

36. Ragni E, Fontaine T, Gissi C, Latge JP, Popolo L. 2007. The Gas family of 609

proteins of Saccharomyces cerevisiae: characterization and evolutionary analysis. Yeast 610

24:297-308. 611

37. Ruel K, Joseleau JP. 1991. Involvement of an extracellular glucan sheath during 612

degradation of populus wood by Phanerochaete chrysosporium. Appl. Environ. 613

Microbiol. 57:374-84. 614

38. Seyfang A, Mecke D, Duszenko M. 1990. Degradation, recycling, and shedding of 615

Trypanosoma brucei variant surface glycoprotein. J. Protozool. 37:546-52. 616

39. Shukla SD, Coleman R, Finean JB, Michell RH. 1980. Selective release of 617

plasma-membrane enzymes from rat hepatocytes by a phosphatidylinositol-specific 618

phospholipase C. Biochem. J. 187:277-80. 619

40. Simons K, Ikonen E. 1997. Functional rafts in cell membranes. Nature 387:569-72. 620

41. Takahashi M, Takahashi H, Nakano Y, Konishi T, Terauchi R, Takeda T. 2010. 621

Characterization of a cellobiohydrolase (MoCel6A) produced by Magnaporthe oryzae. 622

Appl. Environ. Microbiol. 76:6583-6590. 623

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

28

42. Takeda T, Takahashi M, Nakanishi-Masuno T, Nakano Y, Saitoh H, Hirabuchi 624

A, Fujisawa S, Terauchi R. 2010. Characterization of endo-1,3-1,4-β-glucanases in 625

GH family 12 from Magnaporthe oryzae. Appl. Microbiol. Biotechnol. 88:1113-1123. 626

43. Takeda T, Furuta Y, Awano T, Mizuno K, Mitsuishi Y, Hayashi T. 2002. 627

Suppression and acceleration of cell elongation by integration of xyloglucans in pea 628

stem segments. Proc. Natl. Acad. Sci. USA 99:9055-60. 629

44. Vasur J, Kawai R, Andersson E, Igarashi K, Sandgren M, Samejima M, 630

Stahlberg J. 2009. X-ray crystal structures of Phanerochaete chrysosporium 631

Laminarinase 16A in complex with products from lichenin and laminarin hydrolysis. 632

FEBS J. 276:3858-69. 633

45. Yamazaki H, Tanaka A, Kaneko J, Ohta A, Horiuchi H. 2008. Aspergillus 634

nidulans ChiA is a glycosylphosphatidylinositol (GPI)-anchored chitinase specifically 635

localized at polarized growth sites. Fungal Genet. Biol. 45:963-72. 636

46. Yang HC, Leu LS. 1978. Formation and histopathology of galls induced by 637

Ustilago esculenta in Zizania latifolia. Phytopathology 68:1572-1576. 638

47. Yano A, Kikuchi S, Nakagawa Y, Sakamoto Y, Sato T. 2009. Secretory 639

expression of the non-secretory-type Lentinula edodes laccase by Aspergillus oryzae. 640

Microbiol. Res. 164:642-9. 641

48. Yin QY, de Groot PW, Dekker HL, de Jong L, Klis FM, de Koster CG. 2005. 642

Comprehensive proteomic analysis of Saccharomyces cerevisiae cell walls: 643

identification of proteins covalently attached via glycosylphosphatidylinositol remnants 644

or mild alkali-sensitive linkages. J. Biol. Chem. 280:20894-901. 645

646

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

29

FIGURE LEGENDS 647

FIG. 1. Fractionation of enzymes with laminarin-hydrolyzing activity in the U. 648

esculenta culture filtrate. 649

Fractions obtained by weak (A) and strong (B) cation-exchange chromatography were 650

subjected to SDS-PAGE followed by silver staining (upper panels), and were then 651

assayed for laminarin-degrading activity (lower panels). M refers to protein size 652

standards. Arrows indicate bands supplied for LC/MS/MS analysis (see materials and 653

methods in the supplementary material). 654

655

FIG. 2. Effect of temperature and pH on hydrolytic activity of recombinant 656

Lam16A-His7. 657

Hydrolytic activity of Lam16A toward laminarin was assayed under various conditions. 658

(A) Optimal temperature was determined after reaction mixtures containing laminarin, 659

sodium acetate buffer (100 mM, pH5.0) and Lam16A (0.02 μg) were incubated for 660

10-90 min at 10-60 ˚C. (B) Optimal pH was determined by incubating with sodium 661

acetate (pH 4.0-5.0), MES-NaOH (pH 5.0-6.0) or sodium phosphate (pH 6.0-7.0) at 30 662

˚C for 30 min. (C) Temperature and (D) pH stability for Lam16A was determined by 663

assaying hydrolytic activity after incubation at indicated temperature or with buffer 664

(sodium acetate; pH 3.5-5.0, MES-NaOH; pH 5.0-6.0, sodium phosphate; pH 6.0-7.0, 665

Tris-HCl; pH 7.0-8.0) for 1 h. Data are means of 3 individual determinations ± SE. 666

667

FIG. 3. Effect of GPI anchor signal peptide on localization of Lam16A. 668

(A) Immunoblot analysis of Lam16A-FLAG (GPI) and Lam16AΔGPI-FLAG (ΔGPI). 669

E, M, and C represent extracellular, membrane, and cell wall fractions, respectively. 670

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

30

Each fraction is equivalent to 6 ml of culture. Hydrolytic activity of the membrane (B) 671

and extracellular (C) fractions was determined using laminarin as a substrate. 672

673

FIG. 4. Effect of PI-PLC treatment on membrane-bound Lam16A-FLAG. 674

The letters + and − represent active and inactivated PI-PLC, respectively. Top and 675

bottom columns represent PI-PLC-soluble and insoluble fractions, respectively. 676

677

FIG. 5. Effect of Lam16A on glucose production by UeBgl3A. 678

The amount of glucose released from laminarin by UeBgl3A (0.02 μg) was determined 679

in the presence of Lam16A (0-2.0 μg). 680

681

FIG. 6. Gene expression analysis of lam16A during Z. latifolia gall formation. 682

(A) Z. latifolia galls at various hypertrophic stages were used for RT-PCR. 1, Before 683

hypertrophy; 2, 3, and 4, 1 g, 20 g, and 170 g gall fresh weight (late stage of 684

hypertrophy), respectively. Bars represent 5 cm. (B) Transcript levels of lam16A and 685

UeBgl3A were analyzed by RT-PCR. Amplified DNA fragments were stained with 686

ethydium bromide. 687

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

1

TABLE 1 Peptide sequences obtained by LC/MS/MS analysis 1

Peptide sequence Species Accession number Annotation

GTTGKGVRVW S. reilianum SRZ2 CBQ72681.1 GH16 β-glucanase

NRAGGGIIAMERSF S. reilianum SRZ2 CBQ72681.1 GH16 β-glucanase

NQSGCNAQYPACSY S. reilianum SRZ2 CBQ72681.1 GH16 β-glucanase

Underlined indicates mismatched amino acid. 2 3

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

2

TABLE 2 Substrate specificity of Lam16A 4

Substrate Specific activity

(U/mg)

Relative activity

(%)

Laminarin 0.02% 6.2 ± 0.28 100

Laminaribiose N.D.a

Laminaritriose N.D.

Laminaritetraose 0.95 ± 0.11 15

Laminaripentaose 5.7 ± 0.56 92

Laminarihexaose 12 ± 0.27 190

Laminariheptaose 16 ± 2.4 260

CM-curdlan 0.02% 10 ± 0.083 165

CM-pachyman 0.02% 4.1 ± 0.17 66 5

a N. D. indicates that the activity was less than 0.1 U/mg of specfic activity. 6

Specific activity of Lam16A towards lichenan, barley β-glucan, CM-cellulose, 7

HE-cellulose, tamarind xyloglucan, arabinan, arabinogalactan, polygalacturonate, xylan 8

or pachyman as substrates was less than 0.1 U/mg. 9 on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

on January 31, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from