www.sciencesignaling.org/cgi/content/full/5/216/ra22/DC1

Supplementary Materials for

Cellular Inhibitors of Apoptosis Are Global Regulators of NF-κκκκB and MAPK Activation by Members of the TNF Family of Receptors

Eugene Varfolomeev, Tatiana Goncharov, Heather Maecker, Kerry Zobel, László G.

Kömüves, Kurt Deshayes, Domagoj Vucic*

*To whom correspondence should be addressed. E-mail: domagoj@gene.com

Published 20 March 2012, Sci. Signal. 5, ra22 (2012) DOI: 10.1126/scisignal.2001878

The PDF file includes:

Materials and Methods Fig. S1. Characterization of commercial antibodies against c-IAP1, c-IAP2, TRAF2, TRAF3, TRAF6, IKK2, NEMO, TAK1, and HOIP. Fig. S2. Characterization of the cell surface expression of members of the TNFR family. Fig. S3. c-IAPs are required for canonical NF-κB, JNK, and p38 activation by TNF-α, TWEAK, LIGHT, CD27L, and CD30L. Fig. S4. TRAF6 and c-IAP proteins mediate CD40-dependent activation of the canonical NF-κB pathway. Fig. S5. TNF-α–, TWEAK-, and LIGHT-stimulated NF-κB and JNK activation depends on c-IAP1 and c-IAP2. Fig. S6. Loss of c-IAP proteins results in reduced expression of genes regulated by members of the TNF family. Fig. S7. c-IAP proteins regulate the function of complexes involving TNFR family members. Fig. S8. TNF-α–, TWEAK-, and LIGHT-stimulated NF-κB and JNK activation depends on NEMO and HOIP. Fig. S9. Differential effects of the signaling of TNFR family members on the stability of c-IAP1, c-IAP2, TRAF2, and TRAF3 proteins. Fig. S10. Proteasome and lysosome inhibitors stabilize c-IAP and TRAF proteins during signaling by TNF family members. Fig. S11. Membrane targeting of TRAF2 or c-IAP1 reduces their cytoplasmic abundance and enables noncanonical NF-κB signaling. Fig. S12. BR3 signaling triggers the translocation of TRAF3 to the insoluble fraction.

Fig. S13. BAFF- and BR3-dependent signaling regulates the cellular localization of TRAF3. Fig. S14. The RING domain of TRAF3 is not critical for TRAF3-mediated regulation of noncanonical NF-κB signaling. Fig. S15. Signaling pathways of members of the TNFR superfamily. Table S1. Summary of the antibodies against c-IAP1, c-IAP2, TRAF2, TRAF6, TRAF3, IKK2, NEMO, TAK1, and HOIP. Table S2. Summary of the cell surface expression of TNFR family members. References

Materials and Methods Plasmids, transfections, and cellular fractionation Using the plasmid pEF6/V5-HisA (Invitrogen) as a backbone and pRK-Myr-3xFpK-FLICE (1) as a PCR template, the following constructs were generated by PCR subcloning: pEF-3×FLAG-c-IAP1, pEF-3×FLAG-c-IAP1 RGm (H588A) (2), pEF-Myr-FpK-3×FLAG-c-IAP1, pEF-Myr-FpK-3×FLAG-c-IAP1 RGm, pEF-Myr-3×FpK-3×FLAG-c-IAP1, pEF-Myr-3×FpK-3×FLAG-c-IAP1 RGm, pEF-FpK-3×FLAG-c-IAP1, pEF-FpK-3×FLAG-c-IAP1 RGm, pEF-Myc-TRAF2, pEF-Myc-TRAF2∆R (3), pEF-Myr-FpK-Myc-TRAF2, pEF-Myr-FpK-Myc-TRAF2∆R, pEF-Myr-3×FpK-Myc-TRAF2, pEF-Myr-3×FpK-Myc-TRAF2∆R, pEF-FpK-Myc-TRAF2, pEF-FpK-Myc-TRAF2∆R, pEF-FLAG-TRAF3, pEF-Myr-FLAG-TRAF3, pEF-Myr-FpK-FLAG-TRAF3, pEF-Myr-FpK-FLAG-TRAF3 RGm (4), pEF-Myr-3×FpK-FLAG-TRAF3, pEF-Myr-3×FpK-FLAG-TRAF3 RGm. All constructs were verified by sequencing of the entire insert. HEK 293T cells were transfected with FuGENE6 (Roche). RPMI-8226 cells, KMS-28PE cells, and TRAF2 knockout MEFs were transfected by electroporation with Amaxa nucleofactor technology (Lonza). Cellular fractionation was performed with NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology) according to the manufacturer instructions. Immunoprecipitations To immunoprecipitate endogenous receptor-associated complexes, the indicated cells (1 to 3 × 108 cells for each time point) were left untreated or were treated with 1 µg/ml of TL1A, antibody against CD40, or with appropriate ligands crosslinked with antibodies against FLAG or the His tag (FLAG-TNF-α, FLAG-TWEAK, and His-LIGHT) for 5 or 30 min. After washing with phosphate-buffered saline (PBS), cells were lysed in 1% Triton X-100 buffer. Cellular lysates were pre-cleared with agarose beads and immunoprecipitated with antibody against DR3 and protein-A/G beads or with protein-A/G beads for other ligand-antibody combinations. To immunoprecipitate BR3-associated complex, cells were treated with FLAG-BAFF (2 µg/ml) that was crosslinked with antibody against FLAG. After washing with PBS, cells were lysed in Buffer 1 [0.5% Triton X-100, 100 mM NaCl, 40 mM tris-HCl (pH 7.5), 1 mM CaCl2, 1 mM MgCl2, complete EDTA-free protease inhibitor mixture (Roche)] for 20 min on ice. Triton-soluble and -insoluble fractions were separated by centrifugation at 14,000g for 10 min. The Triton-insoluble pellets were resolubilized in lysis Buffer 2 [1% Triton X-100, 0.1% SDS, 100 mM NaCl, 40 mM tris-HCl (pH 7.5), 1 mM CaCl2, 1 mM MgCl2, complete EDTA-free protease inhibitor mixture and 20 U/ml DNase], sonicated, and clarified by centrifugation at 14,000g for 10 min to remove the remaining insoluble materials. Cellular lysates were pre-cleared with agarose beads and immunoprecipitated with protein-A/G beads. Immunoprecipitated protein complexes were washed several times in lysis buffer, resolved by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by Western blotting with the indicated antibodies. Analysis of gene expression by quantitative real-time PCR Cells were treated as indicated and RNA was prepared with the RNeasy Mini Kit (Qiagen) following standard protocols. Fold-changes in the abundances of mRNAs for MCP1, TNF-α, RelB, and IL-8 were determined as described previously (2). Statistical

significance was determined with the Student’s t test. The following sequences were used for detection, where “F” indicates the forward primer and “R” indicates the reverse primer: human TNF-α: 5′-CCTGCCCCAATCCCTTTATT (F), 5′-CCCCAATTCTCTTTTTGAGCC (R), 5′-FAM-CCCCCTCCTTCAGACACCCTCAACC-TAMRA (probe); RelB: 5′- GCCGAATTAACAAGGAAAGC (F), 5′- CCTTGTCGCAGAGCAAGTAG (R), 5′-FAM-CTCCTCGCCACCGGTGCAC-TAMRA (probe); IL-8: 5′- TGCTAGCCAGGATCCACAAGT (F), 5′- TGTGAGGTAAGATGGTGGCTAATACT (R), 5′-FAM-TCCACTGTGCCTTGGTTTCTCCTTTATTTCTAAGT-TAMRA (probe); MCP1: 5′-GGGAAATTGCTTTTCCTCTTGA (F), 5′-CTTTGTATTAATGATTCTTGCAAAGACC (R), 5′-FAM-CCACAGTTCTACCCCTGGGATGTTTTGA–TAMRA (probe); RPL19: 5′-AGCGGATTCTCATGGAACA (F), 5′-CTGGTCAGCCAGGAGCTT (R), 5′-FAM-TCCACAAGCTGAAGGCAGACAAGG-TAMRA (probe); mouse MCP1: 5′-TCAGCCAGATGCAGTTAACGC (F), 5′-TGATCCTCTTGTAGCTCTCCAGC (R), 5′-FAM-CCACTCACCTGCTGCTACTCATTCACCA-TAMRA (probe); mouse GAPDH 5′-GGCATTGCTCTCAATGACAA (F), 5′-CTGTTGCTGTAGCCGTATTCA (R), 5′-FAM-TGTCATACCAGGAAATGAGCTTGACAAAG-TAMRA (probe). Confocal microscopy Cells were cultured for 48 hours and then were left untreated or were treated for 1 hour with crosslinked antibody against CD40 (2 µg/ml) or crosslinked BAFF (2 µg/ml). Cells were then washed, fixed in 4% paraformaldehyde for 15 min at room temperature, permeabilized with 0.25% Triton X-100 for 5 min at room temperature, blocked with 5% bovine serum albumin (BSA) in PBS with 0.05% Tween 20 (PBS-T) for 15 min at room temperature, and incubated with the indicated primary antibody (10 µg/ml) in blocking buffer at 4°C overnight. This was followed by incubation with a 1:250 dilution of Alexa Fluor 532–conjugated goat antibody against rabbit antibody as a secondary reagent. Cells were then washed and slides were mounted with coverslips with ProLong Gold antifade reagent with DAPI (Molecular Probes, Invitrogen). Cells were analyzed with a LEICA TCS SPE confocal microscope with a 63× ACS APO oil-immersion objective (NA=1.3). Single optical sections (pinhole: 1 AU, thickness: 0.896 micron) were acquired of randomly selected fields [with the DAPI channel to find and focus the region of interest (ROI)]. All images were collected with the following settings for the DAPI channel: 405 laser at 20% output; 430 to 500 nm detector window; gain setting: 1000; offset: -10. For the Alexa Fluor 532 channel, the settings were: 532 laser at 60% output; 540 to 610 nm detector window; gain 900; offset: -20. All images were collected uniformly using these settings. Flow cytometric analysis Antibodies were added according to the manufacturer’s instructions to 1 to 2 × 106 cells per 100 µl of FACS Wash Buffer (0.5% BSA, 0.1% NaN3 in PBS) and incubated in the dark for 30 to 45 min. After two washes with FACS Wash Buffer, cells were resuspended in 250 µl of FACS Wash Buffer and analyzed with a FACSCalibur flow cytometer (BD Biosciences). The following antibodies were used for FACS analysis: phycoerythrin

(PE)-conjugated antibody against human BCMA (FAB19) and PE-conjugated goat immunoglobulin G (IgG) isotype control antibody (IC108P) from R&D Systems; PE-conjugated antibody against human CD40 (555589), biotinylated antibody against human CD120a (550900), allophycocyanin (APC)-conjugated antibody against human CD20 (559776), PE-conjugated mouse IgG1 isotype control antibody (555749), biotinylated mouse IgG2a isotype control (553455), PE-conjugated streptavidin (554061), PE-conjugated mouse IgG2b isotype control (555743), APC-conjugated mouse IgG2b isotype control (555745), and PE-conjugated mouse IgG2a isotype control (340766) from BD Biosciences; PE-conjugated antibody against human DR3 (12-6603), PE-conjugated antibody against human TACI (12-9217), and PE-conjugated antibody against human FN14 (12-9018) from eBiosciences; and PE-conjugated antibody against human BAFF-R (316906) from BioLegend.

Fig. S1.

Fig. S1. (continued)

Fig. S1. (continued)

Fig. S1. Characterization of commercial antibodies against c-IAP1, c-IAP2, TRAF2, TRAF3, TRAF6, IKK2, NEMO, TAK1, and HOIP. (A to C) Proteins samples were derived from Ramos cells treated for 6 hours with BV6 (4 µM) or from EFM192A cells 48 hours after transfection with c-IAP1- and c-IAP2-specific siRNAs or with control siRNA. The abundance of c-IAP proteins was determined by Western blotting analysis

with antibodies against (A) c-IAP1, (B) c-IAP2, or (C) all c-IAP species. (D) Protein samples were derived from wild-type or TRAF2-deficient MEFs and from EFM192A cells transfected with TRAF2-specific or control siRNAs. The abundances of mouse and human TRAF2 were analyzed by Western blotting. (E to J) Protein samples were derived from (E to J) HT1080 cells and (G) A2058 cells transfected with (E) TRAF6-, (F) TAK1-, (G) TRAF3-, (H) IKK2-, (I) NEMO-, or (J) HOIP-specific siRNAs or with control siRNA. The abundances of human (E) TRAF6, (F) TAK1, (G) TRAF3, (H) IKK2, (I) NEMO, and (J) HOIP proteins were determined by Western blotting. The full list and a description of the antibodies used are given in table S1. Asterisks mark the antibodies that specifically recognized the corresponding proteins, and arrows point to the proteins of interest. Data are representative of at least two experiments.

Fig. S2. Characterization of the cell surface expression of members of the TNFR family. (A) The purity of isolated tonsilar B cells was determined by flow cytometric analysis with antibody against human CD20. The numbers shown indicate the percentages of cells within the lymphocyte gate as determined by forward and side scatter. (B) Tonsilar B cells and Daudi cells were incubated with antibodies against the indicated members of TNFR family and were analyzed by flow cytometry. (C) HKB-11 cells stably expressing control plasmid or plasmid encoding BR3 were treated with BAFF for the indicated times. The abundances of BR3 and p100/p52 were determined by Western blotting analysis. Data are representative of three experiments.

Fig. S3. c-IAPs are required for canonical NF-κB, JNK, and p38 activation by TNF-α, TWEAK, LIGHT, CD27L, and CD30L. (A to D) The indicated cell lines were pretreated with DMSO or BV6 (2.5 µM) for 15 hours, after which they were treated with (A) TNF-α (20 ng/ml), (B) TWEAK (100 ng/ml), (C) LIGHT (100 ng/ml), or (D) CD27L (100 ng/ml) for the indicated times. The abundances of c-IAP1, c-IAP2, IκB, pJNK, and p38 were determined by Western blotting with the indicated antibodies. Data are representative of at least four experiments.

Fig. S4. TRAF6 and c-IAP proteins mediate CD40-dependent activation of the canonical NF-κB pathway. -11 cells stably expressing CD40 were transfected with control, TRAF6-specific, or c-IAP1- and c-IAP2-specific siRNAs and were treated with DMSO or BV6 (2 µM) for 15 hours as indicated. On the next day, cells were stimulated with crosslinked antibody against CD40 (0.5 µg/ml) for the indicated times. Cells were collected, lysed, and analyzed by Western blotting with antibodies specific for TRAF6, c-IAP1, IκB, actin. Data are representative of four experiments.

HKB

and

Fig. S5. TNF-α–, TWEAK-, and LIGHT-stimulated NF-κB and JNK activation depends on c-IAP1 and c-IAP2. HT1080 cells were transfected with c-IAP1- and c-IAP2-specific siRNAs or with scrambled, control (Contr.) siRNA. Forty-eight hours later, cells were treated with (A) recombinant TNF-α (20 ng/ml), (B) recombinant TWEAK (100 ng/ml), or (C) recombinant LIGHT (100 ng/ml). The abundances of c-IAP1, TRAF2, TRAF3, total IκB, and pJNK were determined by Western blotting analysis. Data are representative of four experiments.

Fig. S6. Loss of c-IAP proteins results in reduced expression of genes regulated by members of the TNF family. (A to D) Quantitative real-time PCR analysis of the abundances of the indicated mRNAs was performed with RNA samples derived from the indicated cell lines that were left untreated or were pretreated overnight with BV6 (4 µM), after which they were incubated with (A) TNFα (20 ng/ml) for 4 hours, (B) TWEAK (100 ng/ml) for 7 hours, (C) LIGHT (100 ng/ml) for 4 hours, or (D) antibody against CD40 (500 ng/ml) for 4 hours. Values for the indicated mRNA abundances were normalized to that of RPL19 mRNA, an internal control. **P < 0.01; *P < 0.05; ns, not significant. Data are representative of two experiments.

Fig. S7. c-IAP proteins regulate the function of complexes involving TNFR family members. Lysates from HT1080 cells treated with FLAG-TNFα or FLAG-TWEAK, Ku812F cells treated with TL1A, Daudi cells treated with antibody against CD40, and HT29 cells treated with His-LIGHT, which were used to prepare ligand-receptor complexes for Fig. 3, were analyzed by Western blotting with the indicated antibodies. Data are representative of at least four experiments.

Fig. S8. TNFα–, TWEAK-, and LIGHT-stimulated NF-κB and JNK activation depends on NEMO and HOIP. HT1080 cells were transfected with HOIP- or NEMO-specific siRNAs or with scrambled (Contr.) siRNA. Forty-eight hours later, cells were treated with recombinant TNF-α (20 ng/ml), recombinant TWEAK (100 ng/ml), or recombinant LIGHT (100 ng/ml). The abundances of c-IAP1, HOIP, NEMO, and total IκB proteins were determined by Western blotting analysis. Data are representative of two experiments.

Fig. S9.

Fig. S9. Differential effects of the signaling of TNFR family members on the stability of c-IAP1, c-IAP2, TRAF2, and TRAF3 proteins. (A to C) The indicated cell lines were pretreated with BV6 (2.5 µM) for 12 hours or MG132 (20 µM) for 30 min, followed by incubation with (A) TNFα (20 ng/ml), (B) TWEAK (100 ng/ml), or (C) antibody against CD40 (500 ng/ml) or mouse CD40L (400 ng/ml). The abundances of c-IAP1, c-IAP2, TRAF2, TRAF3, IκB, pJNK, and pp38 proteins were determined by Western blotting analysis. The antibody against TRAF3 used in these experiments (C20, described in table S1 and fig. S1G) recognizes TRAF2 and TRAF3 proteins. Data are representative of at least three experiments.

Fig. S10.

Fig. S10. Proteasome and lysosome inhibitors stabilize c-IAP and TRAF proteins during signaling by TNF family members. (A to C) The indicated cell lines were pretreated with (A to C) MG132 (20 µM), (B) lactacystin (Lac, 10 µM), (A) epoxomicin (Epo, 1 µM), (A to C) CA-074Me (20 µM), or their combination for 30 min followed by incubation with (A) TWEAK (100 ng/ml), (B) LIGHT (100 ng/ml), or (C) CD40L (400 ng/ml) for the indicated times. Cultured cells were collected and lysed in 1% Triton X100 buffer (1% Tr) followed by extractions of the remaining cellular pellets in 1% SDS buffer (1% SDS). Primary cells were collected and directly lysed in 1% SDS buffers. The abundances of c-IAP1, c-IAP2, TRAF2, TRAF3, and p100/p52 were determined by Western blotting analysis. Actin, cadherin (A) and (B), and HSP90 (C) were used as loading controls. Data are representative of two experiments.

Fig. S11. Membrane targeting of TRAF2 or c-IAP1 reduces their cytoplasmic abundance and enables noncanonical NF-κB signaling. (A) Membrane targeting of c-IAP1 does not inhibit noncanonical NF-κB signaling. KMS-28PE cells were transiently transfected with empty plasmid, plasmid encoding FLAG-c-IAP1, or plasmid encoding membrane-targeted Myr-FLAG-c-IAP1. Forty-eight hours later, nuclear, cytoplasmic, and membrane cellular fractions were analyzed by Western blotting with the indicated antibodies. (B) Membrane targeting of TRAF2 causes a reduction in the abundances of TRAF2 and c-IAP1 proteins. HEK 293T cells were transiently transfected with empty plasmid, plasmid encoding c-IAP1, or plasmid encoding the c-IAP1 RING mutant (c-IAP1m), or with empty vector alone or plasmid encoding TRAF2, plasmid encoding TRAF2∆R (RING domain deletion), plasmid encoding Myr-Fpk-TRAF2, or plasmid

encoding Myr-Fpk-TRAF2∆R. Forty-eight hours later, cells were harvested and cellular lysates were analyzed by Western blotting with antibody against the FLAG tag (for c-IAP1 constructs) and antibody against the Myc (for TRAF2 constructs). (C) Membrane targeting of TRAF2 or TRAF2∆R does not inhibit noncanonical NF-κB signaling. TRAF2 knockout MEFs were transiently transfected with empty plasmid or with plasmid encoding TRAF2, TRAF2∆R, membrane-targeted Myr-3xFpkTRAF2, or Myr-3xFpkTRAF2∆R. Forty-eight hours later, nuclear, cytoplasmic, and membrane cellular fractions were analyzed by Western blotting with the indicated antibodies. (D) Quantitative real-time PCR analysis of MCP1 mRNA abundance was performed with RNA samples derived from the experiment described in fig. S11C. The abundance of the MCP1 mRNA was normalized to that of a GAPDH mRNA internal control. Bars with a number indicate statistical significance. Data are representative of three experiments.

Fig. S12. BR3 signaling triggers the translocation of TRAF3 to the insoluble fraction. (A) NALM-6 and WSU-FSCCL cells were treated for 16 hours with recombinant BAFF, agonistic antibody against BR3, or agonistic antibody against TACI (all at 2 µg/ml). The abundance of p100/p52 protein was determined by Western blotting analysis. (B) WSU-FSCCL cells were treated with recombinant BAFF or agonistic antibody against BR3 (both at 2 µg/ml) for the indicated times. Cells were collected and lysed in CEB (Cyt.) followed by extraction of the remaining cellular pellets in 1% SDS buffer (1% SDS). The abundances of c-IAP1, TRAF2, TRAF3, HSP90, SP1, and calreticulin (calret.) were determined by Western blotting analysis. (C) NALM-6 cells were pretreated with MG132 (20 µM), CA-074Me (20 µM), or both inhibitors for 30 min, after which they were incubated with recombinant BAFF or agonistic antibody against BR3 (both at 2 µg/ml) for the indicated times. The abundances of c-IAP1, TRAF2, TRAF3, p100/p52, HSP90, SP1, and calreticulin were determined by Western blotting analysis. Data are representative of two experiments.

Fig. S13. BAFF- and BR3-dependent signaling regulates the cellular localization of TRAF3. (A to J) HKB-11-CD40 and HKB-11-BR3 cells were left untreated (NT) or were treated with crosslinked antibody against CD40 or cross-linked BAFF (2 µg/ml) for

1 hour, as indicated. Cells were subjected to immunofluorescence staining with (A to D and I) rabbit antibody against TRAF3, (E to H) rabbit antibody against TRAF2, or (J) Alexa Fluor 532–conjugated antibody against rabbit antibody as a secondary reagent. TRAF2- and TRAF3-specific staining is shown in red, whereas blue corresponds to DAPI-labeled nuclei. Scale bar: 27.5 µm. Data are representative of three experiments.

Fig. S14. The RING domain of TRAF3 is not critical for TRAF3-mediated regulation of noncanonical NF-κB signaling. (A) HEK 293T cells were transiently transfected with empty plasmid or with plasmids encoding the indicated TRAF3 constructs. Forty-eight hours later, cells were treated for 1 hour with FK1012H2 (250 nM) and cellular lysates were analyzed by Western blotting with antibody against the FLAG tag. (B) RPMI-8226 cells were transiently transfected with empty plasmid or with plasmids encoding the indicated TRAF3 constructs. Forty-eight hours later, nuclear and cytoplasmic cellular fractions were analyzed by Western blotting with indicated antibodies. Data are representative of three experiments.

Fig. S15. Signaling pathways of members of the TNFR superfamily. TNFR1 and DR3 recruit TRAF2, and through TRAF2 the c-IAP proteins, as essential E3 ubiquitin ligases in signaling complexes that activate canonical NF-κB and JNK signaling. The second proposed group of TNFRs is represented by FN14, LT-βR, and the CD30 receptors, which recruit TRAF2 and TRAF3 to their receptor-associated complexes and depend on c-IAP proteins as critical E3 ubiquitin ligases to stimulate canonical and noncanonical NF-κB and JNK pathways. The third group of receptors is represented by CD40, which associates with TRAF2, TRAF3, and TRAF6. CD40 relies on c-IAP proteins, TRAF6, or both to promote ubiquitination for receptor signaling, which can activate canonical and noncanonical NF-κB and JNK pathways. BR3 binds to TRAF3 and promotes its removal from its cytoplasmic inhibitory complex, thus enabling activation of noncanonical NF-κB signaling.

Table S1. Summary of the antibodies against c-IAP1, c-IAP2, TRAF2, TRAF6, TRAF3, IKK2, NEMO, TAK1, and HOIP. Antibody numbers correspond to the numbers shown in fig. S1. DNS, data not shown; NT, not tested. Bold font indicates antibodies that were used in the current study. Protein Antibody # Manufacture Catalog #/clone Species recognition

Human Mouse c-IAP1 1 Alexis 803-335-

c100/1E1-1-10 Yes Yes, DNS

2 Proteintech Group

10022-1-AP Yes No, DNS

3 R&D AF8181 Yes No, DNS 4 Santa Cruz sc-7943/H-83 No No, DNS c-IAP2 1 Novus NB110-

57030/E40 Yes No, DNS

2 R&D AF8171 No No, DNS Pan c-IAP1/2 1 Santa Cruz sc-12410/A-13 No No, DNS 2 R&D MAB3400/315301 Yes Yes, DNS TRAF2 1 IMGENEX IMG-162 Yes Yes 2 Santa Cruz sc-7181/H-249 Yes Yes 3 Cell Signaling 4712 Yes Yes 4 Novus NB110-57130 No No 5 Stressgen AAP-422 Yes Yes 6 BD 558890 Yes No TRAF6 1 Santa Cruz sc-8409/D-10 No NT 2 Santa Cruz sc-33896/K-16 No NT 3 Santa Cruz sc-33895/S-20 No NT 4 Santa Cruz sc-7221/H-274 Yes NT 5 Santa Cruz sc-33897/C-16 No NT 6 Zymed 38-0900 Yes NT 7 Novus NB100-56179 No NT 8 Cell Signaling 4743 No NT 9 Zymed 38-0300 No NT 10 Imgenex IMG-5674-2 Y NT 11 Serotec AHP939T Y NT 12 Sigma HPA019805 Y NT 13 Epitomics S2500 No NT 14 Millipore 06110 No NT 15 Millipore 04451 Y NT 16 Aviva ARP30226 No NT 17 Cell Signaling 8028 Y NT 18 Enzo ALX210028 No NT 19 Enzo ADIAAP426 Y NT TAK1 1 Santa Cruz sc-1839/M17 No NT 2 Santa Cruz sc-7162/M579 Yes NT 3 Bethyl A301-916A Yes NT 4 Cell Signaling 4565 Yes NT 5 R&D MAB5307 Yes NT 6 Proteintech

Group 12330-2AP No NT

TRAF3 1 Santa Cruz Sc-1828/H-122 Yes Yes 2 Abnova H00007187-

M01/1C5 Yes Yes

3 Santa Cruz sc-947/M-20 No No 4 abcam Ab36988-100 No No 5 abcam Ab58368-100 No No 6 Santa Cruz sc-949/C-20 Yes Yes, DNS 7 AbFrontier LF-PA41205 No No 8 AbFrontier LF-PA41204 No No 9 Novus H00007187-M01 No No 10 Sigma SAB3500376 No No

11 Epitomics S1981 Yes Yes

12 Invitrogen 700121 Yes No

13 Novus NB100-56175 No No

14 Novus NBP-19746 No No

IKK2 1 IMGENEX IMG-129A/10AG2

Yes NT

2 IMGENEX IMG-5570-1 No NT

3 Bethyl A301-827A Yes NT

4 Sigma HPA001249 Yes NT

5 Abnova MAB0799/42D1 No NT

6 Biovision 3186-100 No NT

7 Cell Signaling 2684 Yes NT

8 R&D AF4535 Yes NT

Nemo 1 BD 611306 Yes Yes, DNS

2 R&D AF2684 Yes Yes, DNS

3 Santa Cruz sc-8330/FL-419 Yes Yes, DNS

HOIP 1 Sigma SAB2102031 Yes NT

2 Sigma SAB2500889 Yes NT

3 Novus NB00-1094 Yes NT

Table S2. Summary of the cell surface expression of TNFR family members. The cell-surface abundances of the indicated molecules for the indicated cell lines were determined by flow cytometry and were calculated as the ratio of the portion of the cells that was stained with the molecule-specific antibody to the portion of the cells that was stained with isotype control antibodies. The relative amounts of cell-surface expression are designated as follows: XXX designates cells with the greatest cell-surface abundance of a given marker (ratio >10.1), XX indicates intermediate cell-surface abundance (ratio of 5.1 to 10), whereas X indicates the lowest cell-surface abundance (ratio of 1.5 to 5). NT, not tested; Tons, tonsils.

Cells BCMA BR3 TACI CD40 DR3 Fn14 TNFR1 LTβR A2058 X XXX X X HT1080 XXX XXX X HT29 NT NT NT NT XXX X X Daudi X XXX X X Ku812F X X X X XXX X Nalm-6 X XXX X X Ramos XX XXX X XX X X WSU-FCCL X XXX X X X Tons. B cells X XXX X XXX XXX HKB-11-BR3 XXX X NT NT NT NT HKB-11-CD40 X X XXX NT NT NT NT

References 1. M. Muzio, B. R. Stockwell, H. R. Stennicke, G. S. Salvesen, V. M. Dixit, An induced proximity model for caspase-8 activation. J. Biol. Chem. 273, 2926–2930 (1998). 2. E. Varfolomeev, J. W. Blankenship, S. M. Wayson, A. V. Fedorova, N. Kayagaki, P. Garg, K. Zobel, J. N. Dynek, L. O. Elliott, H. J. Wallweber, J. A. Flygare, W. J. Fairbrother, K. Deshayes, V. M. Dixit, D. Vucic, IAP antagonists induce autoubiquitination of c-IAPs, NF-κB activation, and TNFα-dependent apoptosis. Cell 131, 669–681 (2007). 3. M. Rothe, V. Sarma, V. M. Dixit, D. V. Goeddel, TRAF2-mediated activation of NF-kappa B by TNF receptor 2 and CD40. Science 269, 1424–1427 (1995). 4. N. Kayagaki, Q. Phung, S. Chan, R. Chaudhari, C. Quan, K. M. O'Rourke, M. Eby, E. Pietras, G. Cheng, J. F. Bazan, Z. Zhang, D. Arnott, V. M. Dixit, DUBA: a deubiquitinase that regulates type I interferon production. Science 318, 1628–1632 (2007).