IL-4 Indirectly Suppresses IL-2 Production by Human T

Lymphocytes via Peroxisome Proliferator-Activated Receptor

γ Activated by Macrophage Derived 12/15-lipoxygenase

Ligands

Xiao Yi Yang∗, Li Hua Wang†, Kelly Mihalic*, Weihua Xiao*, Taosheng Chen*, Peng Li‡, Larry M. Wahl§ and William L. Farrar†,¶

From ∗Intramural Research Support Program, SAIC Frederick; †Cytokine Molecular Mechanisms Section, Laboratory of Molecular Immunoregulation; ‡Laboratory of Medicinal Chemistry, National Cancer Institute-Frederick, National Institutes of Health, Frederick, MD 21702. §Immunopathology Section, National Institute of Dental Research, National Institutes of Health, Bethesda, MD 20892

¶To whom reprint requests should be addressed. Email: farrar@mail.ncifcrf.gov

William L Farrar, Ph.D. Cytokine Molecular Mechanisms Section Laboratory of Molecular Immunoregulation National Cancer Institute P.O. Box B, Bldg. 560, Rm. 31-76 Frederick, MD 21702 Tel.: 301-846-1503 Fax: 301-846-6019, 6187 E-mail: farrar@mail.ncifcrf.gov.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

2

ABSTRACT The respective development of either T helper type 1 (Th1) or Th2 cells is

believed to be mediated by the effects of cytokines acting directly on Th precursors

(Thp). We have generated evidence for an indirect monocyte-dependent

immunoregulatory pathway. Recently, IL-4 has been shown to produce "new" potential

peroxisome proliferator-activated receptor γ (PPARγ) ligands by inducing macrophage

12/15-lipoxygenase (12/15-LO). We have previously shown that the activated PPARγ is a

profound inhibitor of IL-2 transcription in human T lymphocytes. It is hypothetically

possible that IL-4 might indirectly affect IL-2 production by Thp cells via macrophage

derived PPARγ ligands. Using human monocytes and T lymphocytes from same donors,

we have found that monocyte 12/15-LO products mediate the indirect inhibitory effect of

IL-4 on anti-CD3 or PHA/PMA stimulated IL-2 production by T lymphocytes. We

further analyzed which major 12/15-LO metabolites contributed to the above inhibition.

13-HODE, a 12/15-LO product, markedly blocked IL-2 production by human blood T

lymphocytes, but not Jurkat T cells. Moreover, the IL-4-conditioned macrophage medium

contained a sufficient amount of 13-HODE and anti-13-HODE antibody indeed

neutralized the inhibitory effects of the IL-4-conditional medium on T-cell IL-2

production. Using human T lymphocytes and the PPARγ transfected Jurkat T cells, we

demonstrated the specific inhibition by 13-HODE of the transcription factors NFAT and

NF-κB, the IL-2 promoter reporter, and IL-2 production. However, 15-HETE had little

inhibitory effect. The potency of such inhibitory effects correlates well with the

capability of the above metabolic lipids to activate PPARγ. These data provide a

mechanism whereby IL-4 may indirectly affect Thp function via PPARγ activated by

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

macrophage products of the 12/15-LO pathway. 13-HODE, but not 15-HETE,

participated as the major biological mediator in the crosstalk between monocytes and T

lymphocytes.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

T helper lymphocytes can be divided into two functional subsets consisting of Th1

and Th2 cells on the basis of the immunoregulatory cytokines that these T cells produce

(1-3). Some of these immunoregulatory cytokines possess cross-regulatory properties and

can enhance or suppress cytokine production by Th1 or Th2 subset. Thp cells are the

pluripotent precursors of Th1 and Th2 cells (4). Moreover, the development of either Th1

or Th2 helper cells is believed to be determined by the effects of cytokines directly on

helper Thp cells. IL-4 is principally produced by helper T cells of the Th2 phenotype. IL-

4 has been shown to be a pleiotropic lymphokine with an array of biologic effects on

multiple cell lineages (5,6). IL-4 can function as a growth factor for activated T cells

including promoting T cell proliferation and IL-2 production (7,8). Importantly, all of the

effects of IL-4 on human T cells have been inferred from experiments using mixed

population of cells. Inasmuch as IL-4 has been shown to have effects on a variety of cell

types, including monocyte/macrophages and B cells that can function as accessory cells.

IL-4 can inhibit IL-2 synthesis by Con A-stimulating CD4+ human T cells in the

presence of accessory cells (9,10). It is hypothetically possible that the effect of IL-4 on

human T cell activation is indirect and mediated by one of these accessory cells.

The monocyte/macrophage is well recognized as essential in the regulation of

lymphocyte function. Some aspects of this regulation involve the release of soluble

mediators by monocyte macrophages. Interestingly, IL-4 has been shown to induce

12/15-lipoxygenase in monocytes/macrophages, which in turn produce "new" potential

peroxisome proliferator-activated receptor γ (PPARγ) ligands (11). PPARγ is a unique

member of ligand-dependent nuclear receptor family that has been implicated in the

modulation of critical aspects of development and homeostasis, including adipocyte

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

differentiation, glucose metabolism and macrophage development and function (12-15).

Previously, we have shown the expression of PPARγ in human T cells. Using a range of

synthetic and natural PPARγ ligands, including troglitazone and 15d-prostaglandin J2

(15d-PGJ2), we have demonstrated that activation of PPARγ could block IL-2 production

in T cells by inhibiting NFAT mediated transcription of the IL-2 gene. Activated PPARγ

physically associated with NFAT, blocking IL-2 promoter activity. This represented a

novel mechanism and function of the PPARγ nuclear receptor in T cell biology (16). It is

well known that IL-4 exerts immunomodulatory effects on monocytes and T cells. These

observations led us to hypothesize that IL-4 might indirectly affect the production of IL-2

by Thp helper cells by inducing the production of these potential PPARγ ligands by

macrophage 12/15-lipoxygenase, which in turn interfere with the subsequent

development of T helper cells.

Materials and Methods

Materials-Human IL-4 was from PeproTech Inc. 13-HODE and 15-HETE were from

Cayman Chemical. PD146176 and Troglitazone were the gifts from Dr. J. Cornicelli and

M.A. Caballero of Parke-Davis. Anti-13-HODE antibody and 13-HODE immunoassay

kit were from Oxford Biomedical Research.

Cell culture-Human peripheral blood monocytes and T lymphocytes were obtained from

same healthy donors and cultured in RPMI with 10% fetal calf serum (Sigma), 2 mM L-

glutamine, and penicillin-streptomycin (50 IU/ml and 50 µg/ml, respectively. Life

Technologies, Inc.). Jurkat T cells were maintained under the same conditions. 3T3-L1

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

preadipocytes were cultured, maintained, and differentiated as described previously by

Hamm JK et al (17) and Shao and Lazar (18).

IL-2 measured by ELISA-T cells were grown to approximately 2.5 x 106 cell/ml and

treated with anti-CD3 or PHA/PMA in the presence or absence of the different ligands

for 24 hours. Cell supernatants were collected and assayed for IL-2 by ELISA using

Endogen kits (Wolburn).

Determination of 13-HODE levels by ELISA (19,20)-13-HODE was extracted from each

sample at 4°C as follows. The solution was acidified to a pH of 3.5–4.0. The organic

phase of the solution was extracted using water-saturated ethyl acetate. Samples were

dried completely under nitrogen, then reconstituted with a mixture of 25 µl methanol, 975

µl dilution buffer and 50 µl chloroform. The pH was adjusted to 7.2 and the samples were

stored at –20°C. The plates pre-coated with anti-13-HODE antibodies were used to

measure 13-HODE levels at room temperature. Serial dilutions of sample extracts were

prepared and 100 µl volumes of each dilution were added to wells. An aliquot of 100 µl

of a 13-HODE–horseradish peroxidase (HRP) conjugate (1:1000) was added to each well

and the plates were incubated for 2 h at room temperature. Wells were washed twice with

wash buffer, then 200 µl of 3,3',5,5'-tetramethylbenzidine reagent was added. After

incubated for 20 min, the reaction was terminated by adding 50 µl of 1 N sulfuric acid.

The absorbance was measured using a microtiter plate reader at 450 nm.

Electrophoretic mobility shift assay (EMSA) (21,22)-The nuclear extractions from

primary T cells were prepared as described (19). The sequences of the oligonucleotides

(5’ to 3’) used as probes were CACCCCCATATTATTTTTCCAGCATT (NFAT) or

AGTTGAGGGGACTTTCCAGGC (NF-κB). 32P-labeled double-stranded

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

oligonucleotides were then incubated with 5 µg of nuclear extracted proteins in 15 µl of

binding cocktail (50 mM Tris-Cl, pH 7.4, 25 mM MgCl2, 5 mM DTT, 50% glycerol) at 4

°C for 2 h. The DNA-protein complexes were resolved in a 5% polyacrylamide gel.

Transient transfection-Transient transfections of human blood T lymphocytes upon

stimulation with a concentration of PHA (1 µg/ml) were performed by the method

described by Hughes et al (23) and Cron et al (24). For Jurkat T cells, transfection was

performed according to the manufacturer’s instructions for Fugene-6 (Boehringer

Mannheim). Briefly, FuGene-6 was mixed with the plasmid DNA at the ratio of 2:1. The

mixture was incubated for 20 min at room temperature, and then added to cell culture

flask containing 2×107 cells. After 6 hrs, cells were washed twice with RPMI-1640,

replaced in normal medium and seeded in 12-well plate. Cells were treated with or

without different ligands for an additional 24 hrs in the present or absence of PHA/PMA.

Luciferase reporter assays (25)-The transfected cells were pelleted, lysed, and then

centrifuged at 12,000×g in a microcentrifuge for 2 min at 4 °C. The supernatant was

transferred into a new tube, and 20 µl lysate was mixed with 100 µl luciferase assay

reagent in cuvettes for the luminometer. The luciferase assay measurement was

normalized by the protein amount.

Western blot analysis (26)-Samples were applied to 7.5% SDS gels and transferred to

PVDF membranes (Millipore). Membranes were blocked overnight in TBS-Tween with

5% non-fat dry milk and incubated with anti-human 15-LO antibodies (Calbiochem),

anti-PPARγ monoclonal antibody (Santa Cruze), anti-NFATc (PharMingen), or anti-NF-

kB (p65 or p50) (Santa Cruze) at 4 °C overnight. After washing, membranes were stained

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

with horseradish peroxidase-conjugated secondary antibodies. Protein detection was

performed with an ECL detection system.

Results

IL-4 indirectly inhibits anti-CD3 or PHA/PMA stimulated IL-2 production by T

lymphocytes via monocyte 12/15-LO products-To examine the possibility and

physiological relevance of the regulation of the soluble mediators released by IL-4-

treated monocyte/macrophages on T lymphocyte activation, we first tested the effect of

products from IL-4-treated macrophages on IL-2 production by fresh human T

lymphocytes. Human peripheral blood monocytes and T lymphocytes were obtained from

the same donor. Human blood monocytes were cultured with or without IL-4 for 96 hours

(11). Human T lymphocytes were stimulated with the human anti-CD3 antibody or

PHA/PMA plus the above macrophage-conditioned medium. After 24 hours, the

supernatants were collected and tested their IL-2 content by ELISA. As shown in Fig.1a,

T cells stimulated with anti-CD3 or PHA/PMA in conditioned medium from IL-4-treated

macrophages produced significantly less (-62.2% or -44.5%, respectively) IL-2.

However, this inhibition was reversed by medium conditioned by macrophages treated

with IL-4 and PD146176, the specific 12/15-LO inhibitor, when compared with non-IL-

4-treated macrophages. Direct treatment with PD146176 or IL-4 on purified T cells had

no observable inhibitory effects (data not shown). Furthermore, western blot analysis

showed the expression of 12/15-LO by IL-4-induced monocytes, but not by blood

primary T lymphocytes or Jurkat T cells (Fig.1b), which was consistent with the previous

reports that IL-4 induces 12/15-LO expression on human monocyte (27), but not human

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

lymphocytes (28). T-lymphocytes isolated from human blood probably do not metabolize

polyunsaturated fatty acid via the lipoxgenase pathway (29). These findings suggest that

monocyte 12/15-LO products contribute to an indirect inhibitory effect of IL-4 on IL-2

production by T lymphocytes.

Effect of 12/15-LO metabolites on IL-2 production by fresh human T lymphocytes-12/15-

lipoxygenase generates bioactive lipid mediators from free polyunsaturated fatty acids in

human monocytes/macrophages (30). 13-hydroxyoctadecadienoic acid (13-HODE) and

15-hydroxyeicosatetraenoic acid (15-HETE) are the major metabolites formed from

exogenous linoleic acid and arachidonic acid. To clarify the mechanism underlying these

inhibitory effects of macrophage 12/15-lipoxygenase products on T cell activation, we

compared the direct effects of the above IL-4/macrophage induced 12/15-lipoxygenase

products on T cell activation. Human peripheral blood T cells were stimulated with

PHA/PMA and cultured with various concentrations of different ligands for 24 h. As

shown in Fig. 2, 13-HODE markedly decreased anti-CD3 or PHA/PMA-induced IL-2

synthesis in a dose dependent manner. In contrast, 15-HETE showed very weak

inhibitory effects on anti-CD3 or PHA/PMA induced T cell activation. These results

suggest 13-HODE but not 15-HETE, is a major bioactive mediator, present in 12/15-

lipoxygenase macrophage products interfering with T lymphocyte activation

A reasonably high level of exogenous 13-HODE is required to achieve significant

inhibition of IL-2 production by T cells. Thus, it is critical to determine if the conditioned

medium does contain a sufficient amount of 13-HODE. We measured the concentration

of 13-HODE in the conditioned medium by a competitive ELISA. As shown in Table1,

IL-4 could increase the amount of 13-HODE to an approximately concentration of 40

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

µM, which was corresponding well with ED50 of exogenous 13-HODE used in our

experiments. However, in the presence of PD146176, the formation of 13-HODE induced

by IL-4 was significantly decreased. Furthermore, because the anti-13-HODE antibody

used in this study was reported previously to react with 13-HODE in human prostate

tissues, we thus asked if the anti-13-HODE antibody does affect the inhibition of the IL-

4-induced monocyte conditional medium on IL-2 production by T-cells. Fig.1a also

showed the addition of anti-13-HODE antibody indeed neutralized the inhibitory effects

of the IL-4-induced monocyte conditional medium on IL-2 production by anti-CD3 or

PHA/PMA stimulated T-cells. By contrast, when anti-13-HODE antibody was substituted

with control normal goat serum, the decrease in T cell IL-2 production caused by IL-4-

induced monocyte conditional medium was still remained the same level (data not

shown). These results confirmed 13-HODE produced by IL-4-induced macrophages is

significant enough to down-regulate T cell activation.

Inhibition of 12/15-LO metabolites on IL-2 production and promoter activity in PPARγ-

dependent manner- Since IL-4 strongly produced novel PPARγ ligands by 12/15-LO in

monocytes (11), we determined whether inhibition of 12/15-lipoxygenase products on T

lymphocytes was through PPARγ. We performed western blot analysis to confirm the

expression of PPARγ on human T lymphocytes. As shown in Figure 3a, differentiated

3T3-L1 cells, which express both PPARγ1 and PPARγ2 isoforms (17,18,31,32), were

used as a positive control for the expression of PPARγ. Human T lymphocytes and

monocytes, but not Jurkat T cells, contained PPARγ protein, which was consistent with

the Northern Blot results described by Greene ME et al (33). We next tested the effect of

13-HODE on IL-2 production by Jurkat T cells, which lacks PPARγ, to verify the

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

11

necessity of PPARγ expression for the repressive effects of PPARγ ligands observed on

human T lymphocytes. Figure 3b showed 13-HODE and troglitazone did not decrease the

production of IL-2 by Jurkat T cells. These results indicated that PPARγ might be

involved in inhibition of 12/15-LO metabolites, as PPARγ ligands, on human T

lymphocytes.

To determine whether the inhibitory effect of 12/15-lipoxygenase products on IL-2

synthesis can be ascribed, at least in part, to disruption of IL-2 promoter (34, 35) activity,

the purified human blood T lymphocytes, upon stimulation with a concentration of PHA

(1 µg/ml) that is insufficient to cause significant IL-2 secretion (23, 24), were transfected

with IL-2 promoter luciferase reporter constructs. PMA/PHA treatment resulted in a

marked increase in IL-2 promoter activity. 13-HODE, but not 15-HETE, was able to

largely block IL-2 promoter activity in human T lymphocytes. (Fig. 4), which was in

parallel to the observation on the inhibition of other PPARγ ligands on PPARγ-

transfected Jurkat T cells (16). This data suggests that the inhibitory effect of 12/15-

lipoxygenase products on IL-2 synthesis was due to disruption of IL-2 promoter activity

in human T lymphocytes even in the absence of overexpression of PPARγ.

Effect of 12/15-LO products on DNA binding and transcriptional activation of NFAT and

NF-κB-The IL-2 promoter contains five NFAT binding sites, an NF-κB binding site, and

two Oct-1 sites (35-37). It has been previously shown that, among these factors, NFAT is

obligatory for the induction of IL-2 expression during T cell activation (38-40).

Previously, we have shown that activation of PPARγ with 15d-PGJ2 and troglitazone

block NFAT by forming a complex (16). Therefore, we evaluated the effect of 13-HODE

and 15-HETE on DNA binding and transcriptional activity of NFAT. As shown by

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12

EMSA in Fig. 5a, the specific binding of an NFAT probe corresponding to the human IL-

2 promoter was strongly induced by PHA/PMA in human T lymphocytes, which could be

shifted by anti-NFATc. Equivalent nuclear extracts from 13-HODE treated cells

displayed diminished binding capacity by the [32P]-radiolabeled probes. This indicated

13-HODE could block the DNA binding activity of NFAT. In contrast, western blot

analysis showed that the expression of NFAT (Fig.5b) did not change with 13-HODE and

15-HETE treatment. Furthermore, the transcriptional activation of NFAT was measured

on PPARγ-transfected Jurkat T cells (16,41) by a reporter construct directed by the

NFAT distal site of the IL-2 promoter. PHA/PMA strongly induced transactivation of

NFAT. The treatment of 13-HODE could abrogate the transcriptional activity of NFAT

induced by PHA/PMA in the presence of PPARγ over-expression (Fig.5c). However, 15-

HETE did not significantly inhibit DNA binding and transcriptional activity of NFAT.

Interestingly, the inhibitory effect of the above 12/15-LO metabolic lipids correlates well

with their capability to activate PPARγ.

To determine whether transcription factor NF-κB was equally inhibited by 13-HODE

and 15-HETE in T cells, the DNA binding and transcriptional activity of NF-κB was

examined. For this case, nuclear cell extracts were incubated with the NF-κB DNA

binding element and supershifted with the p65 or p50 antibody to confirm the identity.

The antibody directed against p50 (not p65) could significantly supershift the NF-κB

DNA binding. 13-HODE, but not 15-HETE was effective at inhibiting PHA/PMA-

inducible NF-κB DNA binding activity (Fig.6a), although the above 12/15-LO metabolic

lipids did not affect the protein level of NF-κB (Fig.6b) in human T lymphocytes.

Moreover, we analyzed NF-κB transactivation by a luciferase reporter gene. As shown in

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

13

Fig.6c, NF-κB transcription activity following PHA/PMA stimulation was inhibited by

13-HODE but not 15-HETE in the overexpression of PPARγ. Thus, there appears to be a

selective disruption of the transcriptional regulation of the IL-2 promoter mediated by

specific 12/15-lipoxygenase products repressing IL-2 production by human T cells.

Discussion

IL-2 is primarily a product of the Thp and Th1 subclasses of helper T cells. IL-2

production is indicative of T cell activation and is the major autocrine and paracrine

growth factor for T cells. Therefore, the regulation of IL-2 production is key event for

control of T cell survival, clonal expansion, and functional differentiation and

development (34,35). It has been reported that the Th2 cytokine IL-4 plays a critical role

in the development of T helper cells by regulating IL-2 production by Thp cells in both a

direct and an indirect manner (4-7). Moreover, IL-4 largely potently decreases the

transcriptional activation of IL-2 in response to Con-A in normal human peripheral blood

T cells in the presence of 10% accessory cells. These observations suggest that

monocytes/macrophages, as typical accessory cells, are of central importance in the

initiation, development, and outcome of the immune response and are also a target for

type-1 and type-2 cytokines in the immune response (9-10). The data presented in this

study support an important role of macrophages in the indirect pathway of IL-4 in

inhibiting IL-2 production by fresh human peripheral blood T cells. Furthermore, we

provided evidence that monocyte/macrophage 12/15-lipoxygenase products mediate this

indirect inhibitory effect of IL-4 on IL-2 production by T lymphocytes and requires the

expression of PPARγ in Thp lymphocytes.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14

IL-4 is a potent modulator of monocyte function through modulating the metabolism

of polyunsaturated fatty acids. IL-4 can induce 12/15-lipoxygenase (42) and suppress

prostaglandin H synthase (cyclooxygenases)-2 (43,44), but phospholipase A2 is not

coupled to IL-4 receptor signaling (45) in monocytes. Very recently, Spanbroek reported

that IL-4 determines eicosanoid formation in differentiating dendritic cells derived from

hematopoietic progenitor cells and human blood monocytes by up-regulation of 15-LO

and down-regulation of 5-LO (46). The enzyme 15-lipoxygenase is unique among the

human lipoxygenases in that it is capable of oxygenating polyenoic fatty acids esterified

to membrane lipids or lipoproteins, and hence it may have biological roles distinct from

its action on free arachidonic acid. 12/15-lipoxygenase has been implicated in a number

of cellular processes, including degradation of intracellular organelles and oxidation of

low-density lipoprotein, and in a wide variety of disease states such as atherosclerosis,

asthma, and psoriasis (27). 15-LO was also shown to mediate nonsteroidal anti-

inflammatory drug-induced apoptosis independently of cyclooxygenase-2 in colon cancer

cells (47). Human 15-lipoxygenase is a potential effector molecule for IL-4. Although

the enzyme activity of 12/15-LO is low or undetectable in quiescent peripheral blood

monocytes, IL-4 specifically induces 12/15-LO mRNA, protein expression (Fig.1b) and

enzymatic activity and dramatically increased the formation of 13-HODE and 15-HETE

in cultured monocytes probably through a Stat6-dependent pathway (42). 13-HODE may

also be present in even higher amounts because linoleic acid may be the preferred

substrate for human 15-LO. Using a competitive ELISA, we have found IL-4 indeed

increase the level of 13-HODE in monocytes (Table 1). Moreover, anti-HODE also could

neutralize the inhibitory effect of IL-4-treated monocyte conditional medium on IL-2

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

15

production by T cells (Fig.1a). Recently, Nagy et al.(48) and Tontonoz et al. (49)

reported that 13-HODE, which is formed by 15-LO and by oxidation of lipid component

in cells, is a potent endogenous activator and ligand for PPARγ. However, 15-HETE was

only a weak activation of PPARγ. Using human T lymphocytes and PPARγ transfected

Jurkat T cells, we confirmed the capability of the above 12/15-LO products to activate

PPARγ in human T lymphocytes.

PPARγ is a ligand-dependent transcription factor and activated by diverse synthetic

and naturally occurring substances. Although most studies concern the regulation of

glucose and lipid metabolism (48-50) by PPARγ, research studies over the past year have

suggested that this nuclear receptor might also play a number of additional roles in

inflammation, atherosclerosis, and cancer (51-55). Previously, we have reported the role

of PPARγ in T lymphocyte activation including inhibition of IL-2 production and PHA-

induced cell proliferation. In this study, we have been able to confirm the expression of

PPARγ in human blood T lymphocytes and demonstrate an inhibitory effect of these

novel PPARγ ligands produced by the monocyte 12/15-lipoxygenase on T cell IL-2

production and activity of the IL-2 promoter reporter. Furthermore, EMSA and luciferase

reporter analysis revealed that the above 12/15-LO products suppressed IL-2 promoter by

antagonizing the DNA binding activities and transactivation of the transcription factors

NFAT and NF-κB in a PPARγ-dependent manner. Importantly, the potency of such

inhibitory effects correlates well with the capability of the above metabolic lipids to

activate PPARγ. These findings suggest that activation of PPARγ in T cells by 12/15-LO

macrophage products is a key means by which IL-4 indirectly inhibits Thp cell function.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

16

In summary, we have identified and molecularly characterized a previously

undescribed immunoregulatory circuit. Cytokines, such as IL-4, may upregulate ligands

that activate the PPARγ receptor expressed in T lymphocytes and exert profound indirect

effects on T lymphocyte biology via non-steroidal nuclear receptors.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17

Acknowledgments

We are very grateful to G. Crabtree, R. Evans, and A. Elbrecht for providing us with critical

plasmids. We also acknowledge Dr. Joost Oppenheim for his critical review of the

manuscript and Dr. J. M. Wang for kindly discussion. This project has been funded in whole

or in part with Federal funds from the NCI/NIH under Contract NO1-CO-56000.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

18

Abbreviations:

IL-2, interleukin-2; ELISA, enzyme-linked immunosorbent assay; EMSA, electrophoretic mobility shift assay; 15-HETE, 15-hydroxytetraenoic acid; 13-HODE, 13-hydroxy octadecadienoic acid; LO, lipoxygenase; NFAT, nuclear factor of activated T cells; NF-κB, nuclear factor-kappa binding; PHA, phytohemagglutinin; PMA, phorbol 12-myristate 13-acetate; PPAR, peroxisome proliferator-activated receptor; Th cell, T helper cell.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

19

Footnotes

The content of this publication does not necessarily reflect the views or policies of the

Department of Health and Human Services, nor does mention of trade names,

commercial products, or organizations imply endorsement by the U.S. government.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

20

References

1. Morel, P.A., and Oriss T.B. (1998) Crit. Rev. Immunol. 18, 275-303.

2. Murphy, K.M., Ouyang, W., Farrar, J.D., Yang, J., Ranganath, S., Asnagli, H.,

Afkarian, M., Murphy, T.L. (2000) Annu. Rev. Immunol.18, 451-494

3. Haraguchi, S., Good, R.A., James-Yarish, M., Cianciolo, G.J., and Day, N.K.

(1995) Proc. Natl. Acad. Sci. USA 92, 3611-3615

4. Brown, M.A., and Hural, J. (1997) Crit. Rev. Immunol. 17, 1-32

5. Nelms, K., Keegan, A.D., Zamorano, J., Ryan, J.J., and Paul, W.E. (1999)

Annu. Rev. Immunol. 17, 701-738

6. Peterson, J.D., Herzenberg, L.A., Vasquez, K., and Waltenbaugh, C. (1998)

Proc. Natl. Acad. Sci. USA 95, 3071-3076

7. Kawakami, Y., Custer, M.C., Rosenberg, S.A., and Lotze, M.T. (1989) J.

Immunol. 142, 3452-3461

8. Mitchell, L.C., Davis, L.S., and Lipsky, P.E. (1989) J. Immunol. 142, 1548-

1557

9. Martinez, O.M., Gibbons, R.S., Garovoy, M.R., and Aronson, F.R. (1990) J.

Immunol. 144, 2211-5

10. Gaya, A., DelaCalle, O., Yague, J., Alsinet, E., Fernandez, M.D., Romero, M.,

Fabregat, V., Martorell, J., and Vives, J. (1991) J. Immunol. 146, 4209-14

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

21

11. Huang, J.T., Welch, J.S., Ricote, M., Binder, C.J., Willson, T.M., Kelly, C.,

Witztum, J.L., Funk, C.D., Conrad, D., and Glass CK. (1999) Nature 400,

378-382

12. Schoonjans, K., Martin, G., Staels, B., and Auwerx, J. (1997) Curr. Opin.

Lipidol 8,159-166

13. Lemberger, T., Desvergne, B. and Wahli, W. (1996) Annu. Rev. Cell Dev.

Biol. 12, 335-63.

14. Spiegelman, B. M. (1998) Cell 93,153-155.

15. Clark, R.B., Bishop-Bailey, D., Estrada-Hernandez, T., Hla, T., Puddington,

L., and Padula, S.J. (2000) J. Immunol. 164, 1364-71

16. Yang, X.Y., Wang, L.H., Chen, T., Hodge, D.R., Resau, J.H., DaSilva, L., and

Farrar, W.L. (2000) J. Biol. Chem. 275, 4541-4

17. Hamm, J.K., Park, B.H., and Farmer, S.R. (2001) J. Biol. Chem. 276, 18464-

18471

18. Shao, D., and Lazar, M.A. (1997) J. Biol. Chem. 272, 21473-21478

19. Spindler, S.A., Clark, K.S., Callewaert, D.M., and Reddy, R.G. (1996)

Biochem. Biophys. Res. Commun. 218, 187-91

20. Shureiqi, I., Wojno, K.J., Poore, J.A., Reddy, R.G., Moussalli, M.J., Spindler,

S.A., Greenson, J.K., Normolle, D., Hasan, A.A., Lawrence, T.S., and

Brenner, D.E. (1999) Carcinogenesis 20,1985-95

21. Wang, L. H., Kirken, R. A., Erwin, R. A., Yu, C. R., and Farrar, W. L. (1999)

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

22

J Immunol. 162, 3897-3904

22. Roederer, M., Raju, P.A., Mitra, D.K., Herzenberg, L.A., and

Herzenberg.L.A. (1997) J. Clin. Invest. 99,1555-1564.

23. Hughes, C.C.W., and Pober, J.S. (1996) J. Biol. Chem. 271, 5369-5377

24. Cron, R.Q., Schubert, L.A., Lewis, D.B., and Hughes, C.C. (1997) J Immunol.

Methods 205,145-150

25. Wang, L.H., Yang, X.Y., Mihalic, K., Xiao, W., Li, D., and Farrar, W.L.

(2001) J. Biol. Chem. 276, 31839-31844

26. Wang, L.H., Kirken, R.A., Yang, X.Y., Erwin, R.A., DaSilva, L., Yu, C.R.,

and Farrar, W.L. (2000) Blood 95, 3816-3822.

27. Conrad, D. J., Kühn, H., Mulkin, M., Highland, E., and Sigal, E. (1992) Proc.

Natl. Acad. Sci. USA 89, 217–221

28. Brinckmann, R., Topp, M.S., Zalan, I., Heydeck, D., Ludwig, P., Kuhn, H.,

Berdel, W.E., and Habenicht, J.R. (1996) Biochem. J. 318, 305-12

29. Goldyne, M.E., Burrish, G.F., Poubelle, P., and Borgeat, P. (1984) J. Biol.

Chem. 259, 8815-8819

30. Conrad, D.J. (1999) Clin. Rev. Allergy Immunol. 17, 71-89.

31. Tontonoz, P., Graves, R.A., Budavari, A.I., Erdjument-Bromage, H., Lui, M.,

Hu, E., Tempst, P., and Spiegelman BM. (1994) Nucleic Acids Res. 22, 5628-

5634

32. Hsi, L.C., Wilson, L., Nixon, J., and Eling, T.E. (2001) J. Biol. Chem. 276,

34545-34552

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

23

33. Greene, M.E., Blumberg, B., McBride, O.W., Yi, H.F., Kronquist, K., Kwan,

K., Hsieh, L., Greene, G., and Nimer, S.D. (1995) Gene Expr. 4, 281-299

34. Jain, J., Loh, C. and Rao, A. (1995) Curr. Opin. Immunol. 7,333-342.

35. Crabtree, G. R. (1999) Cell 96, 611-614.

36. Rao, A., Luo, C., and Hogan, P. G. (1997) Annu. Rev. Immunol. 15, 707-747.

37. Rooney, J. W., Sun, Y. L., Glimcher, L. H., and Hoey, T. (1995) Mol. Cell.

Biol. 15, 6299 6310.

38. Bierer, B. E., Mattila, P. S., Standaert, R. F., Herzenberg, L. A., Burakoff, S.

J., Crabtree, G., and Schreiber, S. L. (1990) Proc. Natl. Acad. Sci. USA 87,

9231 9235.

39. Alroy, I., Towers, T.L., and Freedman, L.P. (1995) Mol. Cell Biol. 15, 5789-

5799

40. Towers, T.L., Staeva, T.P., and Freedman, L.P. (1999) Mol. Cell Biol. 19,

4191-4199

41. Elbrecht, A., Chen, Y., Cullinan, C.A., Hayes, N., Leibowitz, M.D., Moller,

D.E., and Berger, J. (1996) Biochem. Biophys. Res. Commun. 224,431-437

42. Heydeck, D., Thomas, L., Schnurr, K., Trebus, F., Thierfelder, W.E., Ihle,

J.N., and Kuhn, H. (1998) Blood 92, 2503-2510

43. Mertz, P.M., Corcoran, ML, McCluskey, K.M., Zhang, Y., Wong, H.L.,

Lotze, M.T., DeWitt, D.L., Wahl, S.M., and Wahl, L.M. (1996) Cell Immunol.

173, 252-260

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

24

44. Niiro, H., Otsuka, T., Ogami, E., Yamaoka, K., Nagano, S., Akahoshi, M.,

Nakashima, H., Arinobu, Y., Izuhara, K., and Niho, Y. (1998) Biochem.

Biophys. Res. Commun. 250, 200-205

45. Ho, J.L., Zhu, B., He, S., Du, B., and Rothman, R. (1994) J. Exp. Med. 180,

1457-1469

46. Spanbroek, R., Hildner, M., Kohler, A., Muller, A., Zintl, F., Kuhn, H.,

Radmark, O., Samuelsson, B., and Habenicht, A.J. (2001) Proc. Natl. Acad.

Sci. USA 98, 5152-5157

47. Shureiqi I., Chen, D., Lotan, R., Yang, P., Newman, R.A., Fischer, S.M., and

Lippman, S.M. (2000) Cancer Res. 60, 6846-6850

48. Nagy, L., Tontonoz, P., Alvarez, J.G., Chen, H., and Evans, R.M. (1998) Cell

93, 229-240.

49. Tontonoz, P., Nagy, L., Alvarez, J.G., Thomazy, V. A. and Evans, R.M.

(1998) Cell 93, 241-252.

50. Forman, B.M., Tontonoz, P., Chen, J., Brun, R.P., Spiegelman, B.M., Evans,

R.M. (1995) Cell 83, 803-812

51. Kersten, S., Desvergne, B., and Wahli, W. (2000) Nature 405,421-424.

52. Brun, R. P., Kim, J. B., Hu, E., and Spiegelman B. M. (1997) Curr. Opin.

Lipidol. 8, 212-218.

53. Jiang, C., Ting, A. T., and Seed, B. (1998) Nature 391, 82-86.

54. Ricote, M., Li, A. C., Willson, T. M., Kelly, C. J., and Glass, C. K. (1998)

Nature 391, 79-82.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

25

55. Zhang, X., Wang, J.M., Gong, W.H., Mukaida, N., and Young, H.A. (2001) J.

Immunol. 166, 7104-7111

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

26

Figure legends

Figure 1. (a) IL-4-treated macrophage products modulate IL-2 production by fresh

human T lymphocytes. Human monocytes were cultured with or without IL-4 and treated

with PD146176, the specific 12/15-LO inhibitor, for 96 hours. Human T lymphocytes

were cultured with the above macrophage-conditioned medium in the absence or

presence of anti-13-HODE, and stimulated with anti-CD3 or PHA/PMA. After 24 hours,

the supernatants were collected and tested for IL-2 titer by ELISA. (b) Comparison of

15-LO protein expression in human peripheral blood monocytes, peripheral blood T

lymphocytes and Jurkat T cells.

Figure 2. Effects of 13-HODE and 15-HETE on IL-2 production by fresh human T

lymphocytes. Freshly prepared human T cells were incubated in medium containing 13-

HODE or 15-HETE and stimulated by PHA/PMA or anti-CD3 for 24 hrs. The

concentration of IL-2 released into the medium was determined by ELISA. Error bars

show mean±standard deviation of the three determinations.

Figure 3. (a) Protein expression of PPARγ in human peripheral blood monocytes (lane

A), peripheral blood T lymphocytes (lane B), and Jurkat T cells (lane C) was assayed by

Western Blot. 3T3-L1 preadipocytes on day 0 (PreAd, lane 2) and adipocytes on day 7

(Ad, lane 1) after adipogenic stimulation with differentiation medium are shown for

comparison. (b) 13-HODE and 15-HETE do not inhibit IL-2 production by Jurkat T cells.

Jurkat T cells were incubated in medium containing 13-HODE (37 µM), 15-HETE (37

µM) or troglitazone (10 µM), and stimulated by PHA/PMA for 24 hrs. The concentration

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

27

of IL-2 released into the medium was determined by ELISA. Error bars show

mean±standard deviation of the three determinations.

Figure 4. The inhibition of 13-HODE, compared to 15-HETE on IL-2 promoter activity

in human blood T lymphocytes. Human blood T lymphocytes were transfected with an

IL-2 promoter-luciferase reporter plasmid according to the method described by Hughes

et al. Cells were treated with 13-HODE (37 µM), 15-HETE (37 µM) or troglitazone (10

µM), stimulated by PHA/PMA as shown, and collected for analysis of reporter gene

activity 24 h later.

Figure 5. Effect of 13-HODE and 15-HETE on DNA binding and transcriptional

activation of NFAT. (a) DNA binding of transcription factors NFAT induced by

PHA/PMA in human peripheral blood T cells as demonstrated by EMSA analysis.

Human peripheral blood T cells were treated with DMSO-control or 13-HODE (37 µM)

or 15-HETE (37 µM) and incubated with medium (-) or PHA/PMA (+) for 2 hrs at 37 °C.

Nuclear extracts corresponding to 5 µg of protein were incubated with a [32P]-labeled

oligonucleotide NF-AT probe. Arrow indicates migrational location of each-DNA

complex. (b) The above nuclear extracts from human T lymphocytes were separated by

SDS-PAGE and immunoblotted by anti-NFATc. (c) Jurkat cells were co-transfected with

a reporter construct directed by the NFAT distal site of the IL-2 promoter and a PPARγ-

expression plasmid. Cells were treated with different ligands, stimulated by PHA/PMA,

as shown, and collected for analysis of reporter gene activity 24 h later.

Figure 6. Effects of 13-HODE and 15-HETE on DNA binding and transcriptional

activation of NF-κB. (a) DNA binding of transcription factors NFAT induced by

PHA/PMA in human peripheral blood T cells as demonstrated by EMSA analysis.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

28

Human peripheral blood T cells were treated with DMSO-control or 13-HODE (37 µM)

or 15-HETE (37 µM) and incubated with medium (-) or PHA/PMA (+) for 2 hrs at 37 °C.

Nuclear extracts corresponding to 5 µg of protein were incubated with a [32P]-labeled

oligonucleotide NF-κB probe. Arrow indicates migrational location of each-DNA

complex. Supershift analyses were performed by the addition of 2 µl of IgG against NF-

κB p65 or p50. (b) The above nuclear extracts from human T lymphocytes were

separated by SDS-PAGE and immunoblotted by anti-NF-κB p65 (upper) or p50 (lower).

(c) Jurkat cells were co-transfected with an NF-kB luciferase reporter construct and a

PPARγ expression plasmid. Cells were treated with above ligands, stimulated by

PHA/PMA, as shown, and collected for analysis of reporter gene activity 24 h later.

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

29

Table 1. The 13-HODE Concentration in Macrophage Conditional Medium Control IL-4 IL-4+PD146176 13-HODE (µM) 4.31 ± 0.12 38.62 ± 1.18 13.55 ± 0.93

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

0

10

20

30

40

50

60

70

PHA/PMA

-

-

+

-

+

+- +

+

+

IL-4 medium

IL-4medium+αα 13HODE

IL-4+PD medium

αα -CD3

-

- --

Fig.1a

IL-2

pro

du

ctio

n (I

nh

ibit

ion

%)

YANG-fig.1a.pzm:Graph-2 - Mon May 21 12:04:55 2001 by guest on M

arch 25, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

0 30 60 90 1200

20

40

60

80

100 PHA/PMA+13HODE

αα CD3+15HETE

PHA/PMA+15HETE

αα CD3+13HODE

Ligand(µµM)

Inhi

bitio

n (%

)

Fig.2

YANG-fig.2.pzm:Graph-1 - Mon May 21 12:05:32 2001 by guest on M

arch 25, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

0

100

200

300

400

500

600

- - +

Troglitazone - --

13HODE15HETE - - -

-+

-

-

-+PHA/PMA - + + + +

Fig.3b

IL-2

Pro

du

ctio

n (p

g/m

l)

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

0

4

8

12

16

- - +

Troglitazone - --

13HODE15HETE - - -

-+

-

-

-+

- PHA/PMA

+PHA/PMA

Rel

ativ

e L

uci

fera

se A

ctiv

ity

Fig. 4

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

0

6

12

18

24

30

36 - PHA/PMA+ PHA/PMA

- - - -+

Troglitazone - - -+ -13HODE

15HETE - - - - +

PPAR γγ + + + + +

Rel

ativ

e L

uci

fera

se A

ctiv

ity

Fig.5c

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

0

3

6

9

12

15

18 - PHA/PMA+ PHA/PMA

- - - -+

Troglitazone - - -+ -13HODE

15HETE - - - - +

PPAR γγ + + + + +

Rel

ativ

e L

uci

fera

se A

ctiv

ity

Fig.6c

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from

M. Wahl and William L. FarrarXiao Yi Yang, Li Hua Wang, Kelly Mihalic, Weihua Xiao, Taosheng Chen, Peng Li, Larry

12/15-lipoxygenase ligandsproliferator-activated receptor gamma activated by macrophage derived

IL-4 indirectly suppresses IL-2 production by human T lymphocytes via peroxisome

published online November 28, 2001J. Biol. Chem. 

  10.1074/jbc.M105619200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on March 25, 2018

http://ww

w.jbc.org/

Dow

nloaded from