Transcriptional Regulation of the Genes Encoding Chitinand b-1,3-Glucan Synthases from Ustilago maydis

Mariana Robledo-Briones • Jose Ruiz-Herrera

Received: 24 November 2011 / Accepted: 5 April 2012 / Published online: 27 April 2012

� Springer Science+Business Media, LLC 2012

Abstract Transcriptional regulation of genes encoding

chitin synthases (CHS) and b-1,3-glucan synthase (GLS)

from Ustilago maydis was studied. Transcript levels were

measured during the growth curve of yeast and mycelial

forms, in response to ionic and osmotic stress, and during

infection of maize plants. Expression of the single GLS gene

was constitutive. In contrast, CHS genes expression showed

differences depending on environmental conditions. Tran-

script levels were slightly higher in the mycelial forms, the

highest levels occurring at the log phase. Ionic and osmotic

stress induced alterations in the expression of CHS genes, but

not following a defined pattern, some genes were induced

and others repressed by the tested compounds. Changes in

transcripts were more apparent during the pathogenic pro-

cess. At early infection stages, only CHS6 gene showed

significant transcript levels, whereas at the period of tumor

formation CHS7 and CHS8 genes were also were induced.

Introduction

The cell wall is the rigid outer layer that completely covers

the cells of a large number of organisms, both prokaryotes

and eukaryotes. The cell wall has many functions: to pro-

tect the cell against the difference in osmotic pressure

between the cytoplasm and the environment, to protect the

cell against the chemical and biological aggression of the

medium, such as the action of lytic enzymes, toxic com-

pounds, predators, etc., and to provide the shape to the cell.

In fungi the wall is made of microfibrillar polysaccha-

rides and cementing compounds of glycoprotein nature.

The fungal microfibrillar polysaccharides are chitin and

b-glucans. Chitin is made of N-acetylglucosamine units

joined by b-1,4-linkages, and b-1,3-glucans, the major

polysaccharides of fungal walls, are made of glucose units

[for reviews see [19], [24]].

Fungi contain more than one chitin synthase (Chs), a

property that may correspond to a compensatory mechanism

[16, 20], and the number of b-1,3-glucan synthases (Gls)

rarely exceed two. For example, U. maydis possesses eight

genes encoding chitin synthases and only one encoding

b-1,3-glucan synthases [6, 7, 27–29]. Chitin synthases have

been classified in two division and five Classes. Division 1

includes Classes I–III, and division 2 Classes IV and V. Each

division has different conserved motifs, the enzymes

belonging to division 1 have a lower molecular size than

division 2 enzymes, and in these the characteristic QXRRW

pentapeptide (‘‘signature sequence)’’ is closer to the C ter-

minus [20].

Taking into consideration the importance of chitin and

b-glucans in the construction of the cell wall, and the scant

information on the level of regulation of the genes encoding

their synthases [4, 12, 13, 18, 25] we have proceeded to

analyze the transcriptional regulation of the genes encoding

chitin and b-1,3-glucan synthases in U. maydis at different

developmental stages, under some stress conditions, and

during the invasion of its host. This Basidiomycota fungus is

a specific pathogen of maize that requires its host to complete

the sexual life cycle [for reviews see [5], [11], [22], [26]].

The fungus alternates two morphologies, a yeast-like sap-

rophytic haploid stage and a dikaryotic mycelial pathogenic

form. This dimorphic switch can be reproduced in the lab-

oratory by control of the external pH [21], by growth in the

presence of fatty acids [10] or by nitrogen deprivation [2].

M. Robledo-Briones � J. Ruiz-Herrera (&)

Departamento de Ingenierıa Genetica, Unidad Irapuato,

Centro de Investigacion y de Estudios Avanzados del Instituto

Politecnico Nacional, Irapuato, GTO, Mexico

e-mail: jruiz@ira.cinvestav.mx

123

Curr Microbiol (2012) 65:85–90

DOI 10.1007/s00284-012-0129-0

Materials and Methods

Strains, Media, and Growth Conditions

The wild type strains FB1 and FB2 of U. maydis [1] were

used. The strains were maintained in 50 % glycerol at

-70 �C, and recovered in complex medium (CM; [8])

before each experiment. Cells (1 9 10 6 cells/mL) were

inoculated in MM liquid medium [8] and incubated in a

shaking water bath at 28 �C. Yeast or mycelial morphol-

ogies were obtained following the protocol described in

[21]. Stress by salts or sorbitol was induced by concen-

trations that produced a growth inhibition of about 30 %

with respect to a control without stress (see ‘‘Results’’). At

intervals samples were withdrawn and cells recovered by

centrifugation. Cell morphology of each sample was

observed by light microscopy, and cell growth was mea-

sured by their optical density (OD) at 600 nm, and data

were converted to cell protein by use of a standard curve.

Nucleic Acids Techniques

DNA of U. maydis was isolated as described in [3]. Isolation

of RNA was made with Trizol (Invitrogene) according to the

manufacturer instructions. U. maydis gene sequences were

obtained from the mips genome page (http://mips.helmholtz-

muenchen.de/genre/proj/ustilago/). RNA concentration was

measured with a NanoDrop, and its integrity and concen-

tration were determined by electrophoresis in agarose gels.

Reverse transcription was performed using 1 lg samples of

DNAase-treated RNA. These were incubated with oligo dT

and SuperScript II reverse transcriptase (Invitrogene)

according to manufacturer’s instructions [9]. PCR reactions

proceeded by incubation of an aliquot of cDNA with specific

oligonucleotides and DNA polymerase (Invitrogene) using

the following program: an initial cycle of denaturalization at

94 �C for 2 min followed by about 30 cycles (see below) at

94 �C for 15 s, alignment for 30 s, extension at 68 �C for

1 min; and final extension at 68 �C for 5 min. Considering

the conservation of CHS genes, design of oligonucleotides

for PCR involved the search of specific regions for each gene

(see Table 1). Optimal temperature of hybridization and the

number of hybridization cycles to obtain results in the linear

range of amplification were determined for each gene. PCR

products were separated by gel electrophoresis on 1 %

agarose gels and photographed. Transcript levels were

determined with the Image J program. The reported results

correspond to the average of data from three different growth

cultures with duplicate samples ± standard deviation. Data

corresponding to CHS genes expression were related to the

values of GLS gene expression that remained constant under

all assay conditions.

Plant Inoculation

Six batches of 10-days-old maize plantlets (10/batch) were

inoculated as described in [14] with 10 lL of a mixture of

FB1 and FB2 cells (108 cells/mL). Plants were incubated in a

greenhouse until the disease symptoms developed (chloro-

sis, increased anthocyanin, and tumors). The zones with the

most significant symptoms from three 10-plant batches

were excised after 5 days post-inoculation (showing only

Table 1 Sequence of

oligonucleotides used for PCR

of CHS and GLS genes

Gene SEQ_ID Primer Primer sequence

CHS1 um10718 F-50 CTTTCAGACGTTGGCGCCAGC

R-50 CGAGTGAGCTGGATCTTTTTG

CHS2 um04290 F-50 CGAAGCACAGCAACCAACCAC

R-50 GATTTGCTGATACTGCTGGCC

CHS3 um10120 F-50 GCCTATTATTCGAGACCGGCTT

R-50 GCGATACCAGCTGCTCTTCCAA

CHS4 um10117 F-50 GCCACCTCGCTACCCATTT

R-50 CCCTCTTGAGCGTCTTGTAT

CHS5 um10277 F-50 CACGTTGATTCCTGTCTCGAC

R-50 CTGTCCAACGTTCCGGTCCTTC

CHS6 um10367 F-50 CGCAGGCGGCATCGATGA

R-50 CGGATTCGTTGCGTTGAGC

CHS7 um05480 F-50 GCGACCAGGAAGTGATTATCGATA

R-50 CGATGGCTGTGGTGGATGCTGAT

CHS8 um03204 F-50 GGACCGACTATGAAAACGAGC

R-50 GAAGGCTGAGGCATGAACCC

GLS um01639 F-50 GCCGAGGTCATCTTCCCCATCTGC

R-50 AAGCGCGGTTTGTCTCGTCGTG

86 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation

123

chlorosis) or 10 days post-inoculation (white tumors) were

recovered, ground with liquid nitrogen, and used for RNA

isolation. Gene expression was measured by RT-PCR as

described above. Results of the experiment are reported as

the average of the three 10 plant batches analyzed in dupli-

cates ± standard deviation, and expressed as above.

Results

Transcriptional Regulation of CHS and GLS Genes

During Yeast-like or Mycelial Growth

To determine the regulation at the transcriptional level of

U. maydis CHS and GLS genes from cells grown in the yeast or

mycelial forms, the fungus was grown in MM of pH 3.0

(mycelium) or pH 7.0 (yeasts) at 28 �C under shaking con-

ditions. At different times (14, 18, 27, 42 and 50 h) cell growth

and morphology were determined as described above, cells

were recovered by centrifugation, RNA was isolated, and

subjected to analysis by RT-PCR. It was observed that

transcript levels of the single GLS gene remained constant in

both conditions throughout the growth curve, same as occur-

red in all further experiments (not shown). Therefore we

further used this gene as an internal control to determine the

levels of CHS genes expression. In contrast, transcript levels

of the eight CHS genes showed differences among them-

selves, according to the growth conditions used and

throughout the growth curve. In the yeast form, in general

transcript levels of CHS genes were slightly lower than those

from mycelium, with the exception of CHS4 (Fig. 1a, b vs.

Fig. 1c, d), and genes belonging to Division 1 (for CHS gene

classification see [20]) were lower than those belonging to

Division 2 (Fig. 1a, c vs. Fig. 1b, d). In addition, expression of

Division 1 genes suffered only small variations along the

growth curve, in contrast to Division 2 genes that displayed

noticeable alterations under the same conditions. All genes

showed a maximal expression in the log phase at about

14–18 h of incubation, with a further decline in expression,

more noticeable for Division 2 genes. Genes CHS2, CHS7,

and CHS8 showed a late increase in transcription at the sta-

tionary phase in both yeast and mycelial cells.

0

0.2

0.4

0.6

0.8

1

1.2d

0

0.2

0.4

0.6

0.8

1

1.2

Rel

ativ

e E

xpre

ssio

nR

elat

ive

Exp

ress

ion

b

0

0.2

0.4

0.6

0.8

1

1.2c

0

0.2

0.4

0.6

0.8

1

1.2

0 10 20 30 40 50

a

Rel

ativ

e E

xpre

ssio

nR

elat

ive

Exp

ress

ion

Time (h)

0 10 20 30 40 50

Time (h)0 10 20 30 40 50

Time (h)

0 10 20 30 40 50

Time (h)

100

200

300

400

500

µg/mL

100

200

300

400

500

µg/mL

Fig. 1 Transcripts levels of CHS genes of U. maydis during the

growth curve in the yeast or mycelial forms. The fungus was grown in

MM pH 7 (a, b yeast-like form), or MM pH 3 (c, d, mycelial form),

and at different incubation times samples were withdrawn, growth

was measured by OD at 600 nm, and data transformed into cell

protein by a standard curve. Cell morphology was checked by

microscopic observations. Cells were recovered by centrifugations,

RNA was isolated and used to measure gene expression by RT-PCR.

Data represent average values from three different cultures analyzed

in duplicate ± standard deviation and are expressed relative to values

of GLS gene transcription that remained constant through all the

experiment. a, c CHS genes belonging to Division 1, diamonds CHS1;

squares CHS2; triangles CHS3; circles CHS4. b, d CHS genes

belonging to Division 2, diamonds CHS5; squares CHS6; emptytriangles CHS7; circles CHS8. In a and c growth of the cultures in lg

protein/mL are shown (black triangles)

M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation 87

123

Changes in the Transcription Levels of CHS and GLS

Genes in Response to Salt or Osmotic Stress

U. maydis is particularly sensitive to osmotic and salt stress

[3]. Accordingly, we measured the effect of monovalent

cations and sorbitol on the expression of CHS and GLS genes

using concentrations that reduced growth by about 30 % as

compared to a control without inhibitors measuring the effect

of different concentrations of the compounds on cell growth.

Cells were incubated as described above in pH 3 or pH 7 MM

in the presence of 1 M NaCl, 1 M KCl, 1 M sorbitol, or

10 mM LiCl. A culture without additions was used as a

control. After 20 h cells were harvested, RNA was extracted,

and gene transcription was measured by RT-PCR. As indi-

cated above, GLS transcription was constitutive (not shown).

In contrast, transcription of CHS genes, showed noticeable

differences, although the response was not homogeneous,

the same substance producing inhibitory or stimulatory

effects on the transcription of the two different genes.

Additionally, a different response was observed for the yeast

and mycelial forms, a higher inhibitory effect being observed

in yeasts (see Fig. 2a, b).

Based on the concentrations required to inhibit growth,

Li? was the most toxic of the tested compounds since

10 mM LiCl originated ca. 30 % growth inhibition,

whereas NaCl, KCl or sorbitol required a 1 M concentra-

tion to cause a similar inhibitory effect (not shown).

Nevertheless Li? effect on CHS transcription was different:

it inhibited only 3 genes in the yeast form and 2 in the

mycelium, and stimulated transcription of two genes in

yeast and four in mycelium form, whereas Na? inhibited 5

genes in yeast and 4 in mycelium, stimulating 3 and

2 genes in yeast or mycelium respectively. K? inhibited

5 yeast and 3 mycelium genes and stimulated 3 genes in

yeast and 4 in mycelium. Finally, sorbitol inhibited 4 genes

and stimulated 2 genes in either form.

Transcription of CHS and GLS Genes During Infection

of Maize Seedlings

Maize seedlings were inoculated with mixture of FB1 and

FB2 U. maydis strains as described in methods. The first

symptoms observed in infected maize are development of

chlorosis and increased anthocyanin formation. After-

wards, formation of tumors containing pleomorphic

mycelium that later on gives raise to teliospores occurs.

When chlorosis developed, leaf zones with the symptoms

were cut and processed to obtain RNA. Later on, when

CHS1 CHS2 CHS3 CHS4 CHS5 CHS6 CHS7 CHS8

CHS1 CHS2 CHS3 CHS4 CHS5 CHS6 CHS7 CHS8

a

b

Fig. 2 Effect of stress by salts

or sorbitol on transcription of

CHS genes of U. maydis in the

yeast (a) or mycelium (b) forms.

Cells were grown in MM

medium added of 1 M NaCl.

1 M KCl, 1 M sorbitol or

10 mM Li?. A control without

addition was included. After

20 h, growth and cell

morphology were determined as

described in Fig. 1. RNA was

isolated and used to measure

gene expression by RT-PCR.

Data represent average values

from three different cultures

analyzed in duplicate ±

standard deviation and are

expressed relative to values of

GLS gene transcription that

remained constant through all

the experiment. Gray barscontrol; white bars NaCl; barswith inclined lines KCl; blackbars LiCl; bars with horizontallines sorbitol

88 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation

123

white (initial) tumors were formed, these were excised and

RNA was also obtained. Afterwards, transcript levels of

CHS and GLS genes were measured by RT-PCR as above.

Again, no variation in transcript levels of GLS was

observed during the pathogenic process (not shown). In

contrast, expression of CHS genes showed noticeable

changes (Fig. 3). During the chlorosis stage, no transcripts

of genes CHS1, CHS2, and CHS8 were detected, whereas

CHS3, CHS4, and CHS7 showed low levels of transcrip-

tion; but interestingly, high transcript levels of CHS6 were

detected. At the stage of white tumors, transcription of

genes CHS1, CHS2, and CHS3 remained repressed, same

as occurred with CHS5, while CHS6, CHS7, and CHS8

were expressed to high levels.

Discussion

The observation that transcription of the single GLS gene of

U. maydis was constitutive, and its expression did not change

under any of the conditions here tested, became a surprise

since it constituted the first observation of this behavior of the

b-1,3-glucan-encoding genes in fungi. In Saccharomyces

cerevisiae, probably the best studied system, the two genes

encoding b-1,3-glucan synthases: FKS1 and FKS2 are highly

regulated. FKS1 is expressed predominantly during the cell

cycle. On the contrary, FKS2 is expressed at low levels in the

optimal growth conditions, and its expression is increased

under restricted growth conditions or in fks1 mutants [15]. In

Beauveria bassiana, transcriptional regulation of GLS genes

is determinant for remodeling of the cell wall [25], and dif-

ferential regulation of the homologous gene was observed

during dimorphism in Paracoccidioides brasiliensis [23].

Also up-regulation of the homologue FKS1 gene was

observed in Lentinus edodes in response to addition of olive

mill waste waters [18].

Regulation of CHS genes has been shown to occur at the

transcriptional and post-transcriptional levels. Transcrip-

tional regulation was reported to take place during the

dimorphic transition of Candida albicans [4], Mucor cir-

cinelloides [13] and Paracoccidioides brasiliensis [17],

where in general mycelial genes were up-regulated. In the

present study, we observed slightly higher transcript levels

in mycelium, the exception being CHS4. These results

agree with Weber et al. [29], who observed that U. maydis

CHS genes in the dikaryotic mycelium obtained in vitro

were up-regulated with the exception of CHS7. Regulation

of CHS genes under salt or osmotic stress indicated a lack

of relationship between inhibition of cell growth and wall

synthesis. Accordingly, LiCl was the most toxic agent for

growth, but using concentrations that caused the same level

of growth inhibition, its effect on CHS gene expression was

minor than that brought about by NaCl, KCl, or sorbitol.

Also interesting was the absence of a regular pattern of

behavior of the several salts and sorbitol on gene expres-

sion. Accordingly, the compounds inhibited some genes

and stimulated others that did not coincide in the yeast and

mycelial forms. This diverse response may be due to subtle

differences in the regulatory regions of the several CHS

genes. The possibility that an effect of pH besides dimor-

phic transition is involved in gene regulation cannot be

dismissed at this time.

Important data were obtained when measuring regula-

tion of CHS genes during U. maydis infection of maize

seedling. The observation that at the chlorosis stage only

CHS6 showed significant expression can be related with the

report that U. maydis chs6 mutants were avirulent, the

fungus being eliminated from the plants at early periods of

the infection [6]. In the stage of white tumor, high tran-

script levels of CHS6, CHS7, and CHS8 genes were

observed agreeing with the observation that chs6 and chs8

mutants are not able to induce tumors [6, 29], and that chs7

mutants form only small tumors [29]. These results suggest

that CHS6 is responsible for chitin formation at the early

stages of infection, and that together with CHS8 it is

indispensable for continuing invasion of the plant and

tumor formation, whereas CHS7 has a role, though not

decisive, in the formation of tumors. The rest of CHS genes

apparently have no role during maize infection, and pos-

sibly at other stages of fungal development their functions

may be interchangeable [27, 28].

In conclusion, our data suggest that in U. maydis,

alterations in CHS, but not in GLS genes regulation, are

important for remodeling of the cell wall in response to

different changes in the environmental conditions.

0

0.2

0.4

0.6

0.8

1

1.2

CHS1 CHS2 CHS3 CHS4 CHS5 CHS6 CHS7 CHS8

Rel

ativ

e E

xpre

ssio

n

Fig. 3 Transcript levels of CHS genes of U. maydis during the

infection of maize seedlings. Six batches of 10 maize seedlings each

were inoculated with a mixture of FB1 and FB2 strains. At the stage

of the chlorosis, and initial tumors, zones with defined symptoms

were isolated from three batches, and RNA was obtained, and used to

measure RT-PCR. Data represent average values from three different

10-plant batches analyzed in duplicate ± standard deviation and are

expressed relative to values of GLS gene transcription that remained

constant through all the experiment. Black bars chlorosis stage; whitebars immature tumor stage

M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation 89

123

Acknowledgments This study was partially supported by Consejo

Nacional de Ciencia y Tecnologıa (CONACYT), Mexico. MRB is a

D. Sc. student supported by a fellowship from CONACYT. Thanks

are given to Claudia Leon-Ramırez for her help during this

investigation.

References

1. Banuett F, Herskowitz I (1989) Different a alleles of Ustilagomaydis are necessary for maintenance of filamentous growth but

not for meiosis. Proc Natl Acad Sci USA 86:5878–5882

2. Banuett F, Herskowitz I (1994) Morphological transitions in the

life cycle of Ustilago maydis and their genetic control by the a

and b loci. Exp Mycol 18:247–266

3. Cervantes-Chavez JA, Ortiz-Castellanos L, Tejeda-Sartorius M,

Gold S, Ruiz-Herrera J (2010) Functional analysis of the pH

responsive pathway Pal/Rim in the phytopathogenic basidiomy-

cete Ustilago maydis. Fungal Genet Biol 47:446–457

4. Chen-Wu JL, Zwicker J, Bowen AR, Robbins PW (1992)

Expression of chitin synthase genes during yeast and hyphal

growth phases of Candida albicans. Mol Microbiol 6:497–502

5. Feldbrugge M, Kamper J, Steinberg G, Kahmann R (2004)

Regulation of mating and pathogenic development in Ustilagomaydis. Curr Opin Microbiol 7:666–672

6. Garcera-Teruel A, Xoconostle-Cazares B, Rosas-Quijano R,

Ortiz L, Leon-Ramırez C, Specht CA, Sentandreu R, Ruiz-Her-

rera J (2004) Loss of virulence in Ustilago maydis by Umchs6

gene disruption. Res Microbiol 155:87–97

7. Gold SE, Kronstad JW (1994) Disruption of two genes for chitin

synthase in the phytopathogenic fungus Ustilago maydis. Mol

Microbiol 11:897–902

8. Holliday R (1961) The genetics of Ustilago maydis. Genet Res

2:204–230

9. Huang Z, Fasco MJ, Kaminsky LS (1996) Optimization of

DNAse I removal of contaminating DNA from RNA for use in

quantitative RNA-PCR. Biotechniques 20:1012–1020

10. Klose J, de Sa MM, Kronstad JW (2004) Lipid-induced fila-

mentous growth in Ustilago maydis. Mol Microbiol 52(823):835

11. Klosterman SJ, Perlin MH, Garcia-Pedrajas M, Covert SF, Gold

SE (2007) Genetics of morphogenesis and pathogenic develop-

ment of Ustilago maydis. Adv Genet 57:1–47

12. Liu H, Kauffman S, Becker JM, Szaniszlo PJ (2004) Wangiella(Exophiala) dermatitidis WdChs5p, a class V chitin synthase, is

essential for sustained cell growth at temperature of infection.

Eukaryot Cell 3:40–51

13. Lopez-Matas MA, Eslava AP, Diaz-Minguez JM (2000) Mcchs1,

a member of a chitin synthase gene family in Mucor circinello-ides, is differentially expressed during dimorphism. Curr Micro-

biol 40:169–175

14. Martinez-Espinoza AD, Leon C, Elizarraraz G, Ruiz-Herrera J

(1997) Monomorphic non-pathogenic mutants of Ustilago may-dis. Phytopathology 87:259–265

15. Mazur P, Morin N, Baginsky W, el-Sherbeini M, Clemas JA,

Nielsen JB, Foor F (1995) Differential expression and function of

two homologous subunits of yeast 1,3-b-D-glucan synthase. Mol

Cell Biol 15:5671–5681

16. Merz RA, Horsch M, Nyhlen LE, Rast D (1999) Biochemistry of

chitin synthase. In: Jolles P, Muzzarelli RAA (eds) Chitin and

chitinases. Birkhauser Verlag, Basel, pp 9–37

17. Nino-Vega GA, Munro CA, San-Blas G, Gooday GW, Gow NA

(2000) Differential expression of chitin synthase genes during

temperature-induced dimorphic transitions in Paracoccidioidesbrasiliensis. Med Mycol 38:31–39

18. Reverberi M, Di Mario F, Tomati U (2004) b-Glucan synthase

induction in mushrooms grown on olive mill wastewaters. Appl

Microbiol Biotechnol 66:217–225

19. Ruiz-Herrera J, Elorza MV, Alvarez PE, Sentandreu R (2004)

Biosynthesis of the fungal cell wall. In: San-Blas G, Calderone

NA (eds) Pathogenic fungi, structural: biology and taxonomy.

Caister Academic Press, Wymondham, pp 41–99

20. Ruiz-Herrera J, Gonzalez-Prieto JM, Ruiz-Medrano R (2001)

Evolution and phylogenetic relationships of chitin synthases from

yeasts and fungi. FEMS Yeast Res 1:247–256

21. Ruiz-Herrera J, Leon CG, Guevara-Olvera L, Carabez-Trejo A

(1995) Yeast-mycelial dimorphism of haploid and diploid strains

of Ustilago maydis. Microbiology 141:695–770

22. Ruiz-Herrera J, Martınez-Espinoza AD (1998) The fungus Usti-lago maydis, from the aztec cuisine to the research laboratory. Int

Microbiol 1:149–158

23. San-Blas G, Nino-Vega G, Iturriaga T (2002) Paracoccidioidesbrasiliensis and paracoccidioidomycosis: molecular approaches to

morphogenesis, diagnosis, epidemiology, taxonomy, and genetics.

Med Mycol 40:225–242

24. Sentandreu R, Elorza MV, Valentın E, Ruiz-Herrera J (2004) The

structure and composition of fungal cell wall. In: San-Blas G,

Calderone NA (eds) Pathogenic fungi: structural, biology, and

taxonomy. Caister Academic Press, Wymondham, pp 3–27

25. Tartar A, Shapiro AM, Scharf DW, Boucias DG (2005) Differ-

ential expression of chitin synthase (CHS) and glucan synthase

(FKS) genes correlates with the formation of a modified, thinner

cell wall in in vivo produced Beauveria bassiana cells. Myco-

pathologia 160:303–314

26. Vollmeister E, Schipper K, Baumann S, Haag C, Pohlmann T,

Stock J, Feldbrugge M (2012). Fungal development of the plant

pathogen Ustilago maydis. FEMS Microbiol Rev 36:59–77

27. Xoconostle-Cazares B, Leon-Ramirez C, Ruiz-Herrera J (1996)

Two chitin synthase genes from Ustilago maydis. Microbiology

142:377–387

28. Xoconostle-Cazares B, Specht CA, Robbins PW, Liu Y, Leon C,

Ruiz-Herrera J (1997) Umchs5, a gene coding for a class IV chitin

synthase in Ustilago maydis. Fungal Genet Biol 22:199–208

29. Weber I, Assmann D, Thines E, Steinberg G (2006) Polar

localizing class V myosin chitin synthases are essential during

early plant infection in the plant pathogenic fungus Ustilagomaydis. Plant Cell 18:225–242

90 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation

123