Protective effect of peroxiredoxin 2 on oxidative stress induced β-cell toxicity in the

pancreatic β-cell line MIN6

by

Fang Zhao

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Graduate Department of Physiology

University of Toronto

© Copyright by Fang Zhao 2011

Protective effect of peroxiredoxin 2 on oxidative stress induced β-cell toxicity in the

pancreatic β-cell line MIN6

Fang Zhao

Degree of Master of Science

Graduate Department of Physiology

University of Toronto

2011

Abstract

Type 1 and type 2 diabetes are characterized by an excessive loss of insulin

producing β-cells. β-cells are particularly susceptible to increased oxidative stress

induced apoptosis due to low expression of major antioxidants. Peroxiredoxin-2

(PRDX2) belongs to a group of antioxidants with antiapoptotic roles. Preliminary data

indicate PRDX2 is expressed in the β-cells. Endogenous PRDX2 in the β-cell line MIN6

is found to decrease under oxidative stress conditions. I hypothesize that PRDX2 has a

role in protecting β-cells against oxidative stress induced apoptosis. Overexpression or

knockdown strategies were used to examine the role of PRDX2 in insulin-secreting

MIN6 cells treated with various stimuli (cytokines, palmitate, streptozotocin) to induce

apoptosis. Results showed that PRDX2 overexpression decreased oxidative stress

induced apoptosis markers and cell death indicators, whereas knockdown of PRDX2

exaggerated oxidative stress induced toxicity. These findings suggest that PRDX2 plays

a protective role in pancreatic β-cells under oxidative stress conditions.

ii

Acknowledgements

I would like to express my most sincere thanks towards my supervisor and

committee members, colleagues and friends for helping me on my journey to complete

my master degree.

I would like to thank Dr. Qinghua Wang for giving me the opportunity to pursue a

master degree in his lab, for his understanding, support and guidance and giving me

valuable instructions on learning new techniques and facilitating my growth as a cellular

molecular biologist, scientist and critical thinker. I would like to thank my committee

members Dr. Allen Volchuk and Dr. Maria Rozakis Adcock for their valuable input in

the direction of my project as well as generous gifts of cells used in this project. Without

the benefits from your experience, insight and expertise, this project could not have been

completed. I would also like to thank my defense committee members Dr. Tianru Jin, Dr.

Heyu Ni and Dr. Philip Connelly for critical reading my thesis and for sitting on my

examination committee and providing the valuable advice and insight regarding how to

present my data.

Special thanks goes to the members of the Wang lab, specifically Nina, Amin,

Paul, Rui, Kui, Lingyun, Akansha and Tracy. You all have helped me so much along my

journey, as colleagues, as teachers and as friends. I would like to thank the Department of

Physiology at the University of Toronto, Canadian Institution of Health Research (CIHR)

and St. Michael’s hospital for funding and giving me this opportunity to pursue this

degree.

iii

Table of Contents

Abstract ............................................................................................................................... ii

Acknowledgements ............................................................................................................ iii

List of figures .................................................................................................................... vii

List of Abbreviations ......................................................................................................... ix

Chapter 1: Introduction ....................................................................................................... 1

1.1 Diabetes mellitus overview....................................................................................... 1

1.2 Islets of Langerhans .................................................................................................. 2

1.3 Regulation β-cell mass .............................................................................................. 3

1.4 β-cell proliferation .................................................................................................... 4

1.4.1 Effect of Insulin on β-cell proliferation ............................................................. 41.4.2 Effects of glucose on β-cell proliferation........................................................... 51.4.3 Effect of GLP-1 on β-cell proliferation ............................................................. 61.4.4 Other inducers of β-cell proliferation ................................................................ 6

1.5 β-cell apoptosis ......................................................................................................... 7

1.5.1 Effect of proinflammatory cytokines on β-cell apoptosis.................................. 81.5.2 Effect of glucotoxicity on β-cell apoptosis ........................................................ 91.5.3 Effect of lipotoxicity on β-cell apoptosis........................................................... 91.5.4 Effect of glucolipotoxicity on β-cell apoptosis................................................ 111.5.5 Effect of oxidative stress on β-cell apoptosis .................................................. 121.5.6 Other Apoptosis inducers................................................................................. 14

1.6 Peroxiredoxins ........................................................................................................ 15

1.6.1 Peroxiredoxin 2................................................................................................ 19

1.7 Rationale ................................................................................................................. 20

1.8 Hypothesis............................................................................................................... 21

1.9 Objective ................................................................................................................. 22 

iv

Chapter 2: Materials and Methods.................................................................................... 23

2.1 Chemical and reagents ............................................................................................ 23

2.2 Equipment ............................................................................................................... 23

2.3 Animals ................................................................................................................... 24

2.4 Isolation of Pancreatic Islets ................................................................................... 24

2.5 Cell culture.............................................................................................................. 25

2.6 Treatment of oxidative stress agents....................................................................... 25

2.7 Overexpression and knockdown of peroxiredoxin 2 .............................................. 26

2.8 RT-PCR................................................................................................................... 27

2.9 Western blot analysis .............................................................................................. 27

2.10 Immunocytochemistry .......................................................................................... 28

2.11 Nuclear staining for the detection of apoptosis..................................................... 29

2.12 Flow cytometry analysis ....................................................................................... 29

2.13 Statistical analysis ................................................................................................. 30

Chapter 3: Results ............................................................................................................. 31

3.1 Peroxiredoxin 2 is expressed in α- and β-cell lines, pancreatic islets and the rat

pancreatic tissues .......................................................................................................... 31

3.2 Apoptosis induced by palmitic acid, cytokines and streptozotocin reduces

endogenous peroxiredoxin 2 levels............................................................................... 32

3.3 Overexpression of peroxiredoxin 2 can protect against palmitic acid, cytokines and

streptozotocin induced β-cell toxicity........................................................................... 37

3.4 Knockdown of peroxiredoxin 2 exaggerated palmitic acid; cytokines, and

streptozotocin induced β-cell death. ............................................................................. 47 

v

Chapter 4: Discussion ....................................................................................................... 50

4.1 Conclusions ............................................................................................................. 54

4.2 Future directions ..................................................................................................... 55

Chapter 5: Reference List ................................................................................................. 57 

vi

List of figures

Figure 1: Oxidative stress induced β-cell apoptosis ......................................................... 14

Figure 2: Model for peroxiredoxin function..................................................................... 19

Figure 3: PRDX2 is expressed in α- and β cell lines and pancreatic islets....................... 32

Figure 4: Palmitic acid treatment is associated with decreased PRDX2 expression levels

in β-cells.................................................................................................................... 33

Figure 5: Cytokine cocktail treatment is associated with decreased PRDX2 expression

levels in β-cells ......................................................................................................... 35

Figure 6: Streptozotocin treatment is associated with decreased PRDX2 expression levels

in β-cells.................................................................................................................... 36

Figure 7: Overexpression of PRDX2 attenuates palmitic acid induced cleaved caspase-3

expression ................................................................................................................. 39

Figure 8: Overexpression of PRDX2 attenuates palmitic acid induced nuclear

fragmentation and condensation ............................................................................... 40

Figure 9: Overexpression of PRDX2 attenuates palmitic acid induced β-cell death........ 41

Figure 10: Overexpression of PRDX2 attenuates cytokine cocktail induced cleaved

caspase 3 expression ................................................................................................. 42

Figure 11: Overexpression of PRDX2 attenuates cytokine cocktail induced nuclear

fragmentation and condensation ............................................................................... 43

Figure 12: Overexpression of PRDX2 attenuates streptozotocin induced cleaved caspase

3 expression .............................................................................................................. 44

Figure 13: Overexpression of PRDX2 attenuates cytokine cocktail induced nuclear

fragmentation and condensation ............................................................................... 45 

vii

Figure 14: Overexpression of PRDX2 attenuates cytokine and STZ induced

β-cell death……………………………………………………………………….46

Figure 15: Knockdown of PRDX2 exaggerates palmitic acid induced cleaved

caspase 3 expression……………………………………………………………..48

Figure 16: Knockdown of PRDX2 exaggerates cytokine cocktail and streptozotocin

induced cleaved caspase 3 expression…………………………………………...49

viii

List of Abbreviations

T1DM Type 1 diabetes mellitus

IDDM Insulin dependent diabetes mellitus (type 1 diabetes)

T2DM Type 2 diabetes mellitus

NIDDM Non-insulin dependent diabetes mellitus (type 2 diabetes)

GSIS Glucose stimulated insulin secretion

PP Pancreatic polypeptide

Vm Membrane potential

GLP-1 Glucagon-like peptide 1

IR Insulin receptor

IRS1 Insulin receptor substrate 1

WT Wild type

Cyclin Ds D-type cyclins

Cdk4 Cyclin dependant kinase 4

Cdk6 Cyclin dependant kinase 6

GIP Gastric inhibitory peptide

PI3K Phosphoinositide 3-kinase

ER Endoplasmic reticulum

IL Interleukin

IFN Interferon

TNF Tumour necrosis factor

ROS Reactive oxygen species

RNS Reactive nitrogen species

ix

JNK c-Jun N-terminal kinase

SAPK Stress-activated protein kinase

MCP Monocyte chemoattractant protein

iNOS Inducible nitric oxide synthase

NO Nitric oxide

NF κB Nuclear factor-κB

NADPH Nicotinamide adenine dinucleotide phosphate

MnSOD Mitochondrial superoxide dismutase

NEFA Non-esterfied fatty acid

GPCR G-protein coupled receptors

PLC Phospholipase C

IP3 Inositol trisphosphate

Acyl-CoA Acyl coenzyme A

ATP Adenosine triphosphate

NADH Nicotinamide adenine dinucleotide

FADH2 Flavin adenine dinucleotide

TCA cycle Tricarboxylic acid cycle

NOD mice Non-obese diabetic mice

ETC Electron transport chain

UCP-1 Uncoupling protein-1

STZ Streptozotocin

DNA Deoxyribonucleic acid

PRDX Peroxiredoxin

x

NK cells Natural killer cells

ICAM-1 Intracellular adhesion molecule-1

RPMI Roswell Park Memorial Institute

EDTA Ethylenediaminetetraacetic acid

FBS Fetal Bovine Serum

BSA Bovine serum albumin

RT-PCR Reverse transcription polymerase chain reaction

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis

PVDF Polyvinylidene fluoride

MIN6 Mouse Pancreatic β-cell line

HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

SFM Serum free medium

PA Palmitic acid

RPM Rotations per minute

GFP Green fluorescent protein

RNA Ribonucleic acid

UV Ultraviolet

RIPA Radioimmunoprecipitation assay

TEMED Tetramethylethylenediamine

AP Ammonium persulphate

TBST Tris-Buffered Saline with Tween 20

HRP Horseradish peroxidase

xi

xii

ECL Enhanced chemiluminescence

PBS Phosphate buffered saline

DAPI 4',6-diamidino-2-phenylindole

SEM Standard error of the mean

PI Propidium Iodide

ASK-1 Apoptosis signal-regulating kinase 1

Chapter 1: Introduction

1.1 Diabetes mellitus overview

Diabetes mellitus is classified as a pandemic chronic disease by the World Health

Organization. It affects more than 220 million people worldwide [130]. Each year,

diabetes mellitus claims the lives of more than 1 million people and the number of deaths

is expected to double by 2030 [130].

Insulin is a hormone secreted from pancreatic β-cells which is central to the

maintenance of glucose homeostasis. It facilitates the glucose uptake in the liver cells,

muscle cells and adipose. Diabetic hyperglycemia is a result of either the insufficient

insulin secretion from pancreatic β-cells and/or defective insulin actions [114]. The two

main types of diabetes mellitus are type 1 and type 2. Type 1 diabetes (T1DM), also

known as insulin dependent diabetes mellitus (IDDM), juvenile, or early onset diabetes,

is an autoimmune disorder which affects 10-15% of all diabetic cases [130]. T1DM is

characterized by the autoimmune destruction of the islet β-cells and insulitis. It is caused

by the infiltration of the body’s own immune cells, mainly T-lymphocytes, to the

pancreatic islets leading to the release of pro-inflammatory cytokines and ensuing

insulitis [33]. This subsequently induces the programmed destruction of the pancreatic

insulin secreting β-cells and drastically decreased endogenous insulin secretion. Type 2

diabetes mellitus (T2DM), also known as non-insulin dependent diabetes mellitus

(NIDDM) is characterized by reduced response to insulin action (referred to as insulin

resistance) in tissues such as muscle and fat cells, as well as the pancreatic islets

themselves, resulting in glucose intolerance and impaired glucose stimulated insulin

1

secretion (GSIS). T2DM affects 90% of the total number of diabetic cases [130]. The

occurrence of insulin resistance in glucose impaired individuals is initially compensated

by an increase in β-cell mass via proliferation and hyperinsulinemia. However, during the

onset of T2DM this compensatory mechanism is eventually replaced predominantly by a

loss of β-cell mass through apoptosis, leading to insufficient insulin secretion and

hyperglycemia. Obesity, usually associated with insulin resistance, is the leading risk

factor for T2DM. Over 85% of all patients with T2DM are overweight. [1]

1.2 Islets of Langerhans

Pancreatic islets are sub-organs in the pancreas which contain clusters of

heterogeneous endocrine cell types. Typical islets contain glucagon producing α-cells,

insulin secreting β-cells, somatostatin producing δ-cells, pancreatic polypeptide

producing PP-cells and ε-cells which secrete ghrelin. δ-cells, ε-cells and PP-cells occupy

only a small percentage of total islet cell mass from 3-5% (δ-cells) to <1% (ε-cells). In

rodent islet, β-cells are the most abundant cell type (65 to 80%), α-cells make up for 15 to

20% [45]. In healthy human adults, the islets of Langerhans only account for 1-2 % of the

total weight of the pancreas, however these islet cells are able to produce sufficient

endocrine hormones to regulate and maintain systemic glucose homeostasis. In rodents,

the islets are usually spherical in shape with α- and δ-cells in the periphery, located in the

mantle surrounding the β-cells located at the core of the islet. In contrast, human islets

display more irregular morphology, which is exemplified by that all cell types are

randomly distributed within the islet. The ratio of islet cell types also differs in humans

with α-cells at 33-46% and β-cells at 48-59% of the total islet mass. δ-cells and PP-cells

2

remain at the same percentage as in rodents [20]. Due to the arrangement of rodent islets,

the β-cells are highly coupled to each other electrically via gap junctions, this allows the

β-cells to function as one unit in response to elevated levels of glucose and subsequently

release insulin through synchronized membrane potential (Vm) and Ca2+ oscillations

[11]. This phenomenon is reduced in human islets, where only clusters of β-cells within

an islet are able to be coupled to each other. α-cells as well as δ-cells and other cells types

within the islet are not coupled and function independently. The cells in the islets of

Langerhans are also innervated by the sympathetic and parasympathetic nervous systems

which indicate that the islet cells are modulated by many different levels not only nutrient

and paracrine/autocrine signals.

1.3 Regulation β-cell mass

Abnormal regulation of β-cell mass is one of the most critical aspects in the

pathogenesis of diabetes. In the late stage of T1DM, β-cells are nearly absent. The β-cells

are also severely diminished in T2DM, particularly when the disease is advanced. The

size of β-cell mass is affected by a combination of β-cell proliferation, apoptosis and

neogenesis [73]. The regulation of β-cell mass is a dynamic process, it increases under

conditions in which the body’s demand for insulin is increased due to metabolic changes,

such as during the neonatal period, or in obese individuals and during pregnancy

[55;96;97]. The peak of β-cell replication is during the neonatal and infant stage with the

post-natal β-cell mass expansion. The ability for β-cells to regenerate declines drastically

after the infant stage [87].

3

In obese individuals, β-cell mass increases in response to the increased insulin

demand due to peripheral insulin resistance. If the increase of β-cell mass cannot

compensate for the increased demand, glucose intolerance develops which may

eventually lead to T2DM [102]. The reduction of β-cell growth in T2DM could be due to

impaired development of the fetal endocrine pancreas, postnatal obesity or the destruction

and loss of β-cells by glucolipotoxicity [45]. Similar to obesity, during pregnancy, β-cell

mass is increased to compensate for the increased demand for insulin. However, if the

increase is unable to meet the demand, the pregnant woman may suffer from gestational

diabetes which affects 4-14% of all pregnant women in the US [72]. In T1DM, β-cells are

lost through autoimmune induced apoptosis and destruction. There is still debate on how

pancreatic β-cells regenerate themselves [38;92;115]. But it is clear that β-cells are able

to replicate and regenerate in some manner. The balance between β-cell regeneration and

apoptosis determines β-cell mass and therefore the loss of balance between the

regeneration and apoptosis contributes to the development of diabetes [80].

1.4 β-cell proliferation

In the adult pancreas, growth factors play an important role in the growth and

regeneration of β-cell mass. A few examples of growth factors which can affect β-cell

growth are insulin, glucose, and GLP-1 [31].

1.4.1 Effect of Insulin on β-cell proliferation

4

It has been widely reported that peripheral insulin resistance leads to

hyperinsulinemia and an amplification of β-cell mass. In a study by Otani K. et al., they

found that β-cell specific insulin receptor knockout mice exhibited decreased β-cell mass

in adults and the development of diabetes [98]. However, mice double heterozygous for

the insulin receptor and insulin receptor substrate 1 alleles (IR/IRS-1 mice), express only

half of the amount of the IR/IRS-1 proteins compared with wild type (WT), exhibit

severe insulin resistance and hyperinsulinemia, as well as β-cell hyperplasia and

increased β-cell mass [19]. β-cell mass was also increased in acute euglycemic-

hyperinsulinemic infused rats [99]. Alternatively, hyperinsulinemia as a result of ectopic

transplantation of insulinoma cells in rats led to a significant decrease in pancreatic β-cell

mass. This loss of β-cell mass was not due to autoimmune induced apoptosis [13]. These

studies indicate that insulin action can modulate β-cell proliferation and apoptosis.

1.4.2 Effects of glucose on β-cell proliferation

Circulating glucose has been known influence β-cell proliferation and survival.

Bernard C. et al. have reported that rats with glucose infusion to simulate hyperglycemia

(22mM) for only 24 hours showed a 50% increase in the number of β-cells. The number

of β-cells returned to normal 7 days after discontinuation of the glucose infusion which

was associated with increased β-cell apoptosis [12]. Furthermore, a longer infusion of

glucose leads to sustained β-cell mass hypertrophy even when infusion is stopped

[16;126]. It is possible that glucose acts through autocrine activation of insulin signaling

proteins to induce β-cell proliferation [5]. In addition, glucose has been found to

stimulate β-cell survival and proliferation through inhibition of a constitutive apoptotic

5

pathway [63]. However, chronic hyperglycemia can be detrimental to β-cell function and

survival as mentioned in section 1.5.2.

1.4.3 Effect of GLP-1 on β-cell proliferation

Glucagon like peptide-1 (GLP-1) is an incretin hormone secreted from intestinal

ileal L-cells in response to nutrient ingestion. GLP-1 promotes β-cell replication,

neogenesis, and function [18]. GLP-1R activation has been found to increase β-cell

proliferation and mass [39], 7 day GLP-1 treatment of db/db mice delays the onset of

diabetes [128]. Even in mice that have already developed diabetes, GLP-1 treatment

reduces circulating blood glucose levels and increases β-cell mass through neogenesis of

insulin producing cells from PDX-1 expressing ductal precursor cells [119]. The ability

of GLP-1 to induce β-cell neogenesis was also confirmed with in vitro studies with rat

and human duct cell lines. Rat pancreatic ductal (ARIP) cells treated with GLP-1 were

able to differentiate into insulin secreting cells in a time and dose dependant manner and

acinar (AR42J) cells were able to differentiate into pancreatic hormone producing cells

with treatment of GLP-1 and its analog exendin-4 [65;138].

1.4.4 Other inducers of β-cell proliferation

Like other cell types, replication of β-cell is accomplished through the successful

passage through the different phases of the cell cycle. D-type cyclins (cyclin Ds) initiate

entry into the cell cycle for the β-cells through forming complexes with cyclin dependant

kinases (Cdk4 and Cdk6). The involvement of cyclin Ds and Cdk4 was first established

6

in 1999 separately by Rane and Tsutsui [106;127]. It was found that Cdk4 knock-out

mice exhibited an insulin deficient diabetic phenotype, however, when endogenous Cdk4

expression was returned, β-cell proliferation increased and the mice returned to

normoglycemia [84]. Knock-in mice (Cdk4R24C mice) with a mutant form of Cdk4 that

is resistant to inhibition, showed islet hyperplasia as a result of increased β-cell mass

[92]. Cdk4R24C cDNA transfected human islets show increased β-cell proliferation [32]

and cyclin D1 and Cdk4 overexpression in both rat and human islets enhanced

proliferation. This demonstrates that Cdk4 and cyclin Ds play a major role in β-cell cell

cycle regulation and proliferation.

It has also been found that GLP-1 and its receptor agonist exendin-4 as well as

gastric inhibitory polypeptide (GIP), all of which have been well established in their roles

in inducing β-cell proliferation, can all induce cyclin D1 expression in β-cells [49;69].

Inhibition of the phosphatidylinositol 3-kinases (PI3K) pathway reduced the effect of

GLP-1 on β-cell proliferation as well as cyclin D1 expression.

1.5 β-cell apoptosis

Apoptosis, as well as proliferation of β-cells, is important for the maintaining β-

cell mass and glucose homeostasis. In fact, diminished β-cell function and increased β-

cell apoptosis not compensated by adequate regeneration or neogenesis is fundamental

for the pathogenesis of both T1DM and T2DM [40]. β-cell apoptosis is caused by a

variety of factors including autoimmune proinflammatory cytokines in T1DM [68],

chronic hyperglycemia and hyperlipidemia in T2DM [68;124] and secondary factors such

7

as oxidative stress [40], endoplasmic reticulum (ER) stress [4] and mitochondrial

dysfunction [118],

1.5.1 Effect of proinflammatory cytokines on β-cell apoptosis

In the progression of T1DM, proinflammatory cytokines including interleukin

(IL)-1β, interferon (IFN) γ and tumour necrosis factor (TNF) α are released in the islet by

infiltrating T-lymphocytes. These cytokines are directly responsible for mediating β-cell

apoptosis through a combination of production of reactive oxygen species (ROS) in the

mitochondria by altering the action of the electron transport chain (ETC) [121], creation

of nitric oxide (NO) via activation of inducible nitric oxide synthase (iNOS) through

upregulation of nuclear factor-κB (NF-κB) [83] and the activation of c-Jun N-terminal

kinase (JNK/SAPK) pathway and/or the FAS pathway [43]. Free oxygen radical

scavengers such as dimethylthiourea and citiolone have been reported to prevent

inflammatory cytokine induced toxicity of β-cells [120]. The cytokines themselves could

also activate stress related kinases which will up regulate the expression of other

proinflammatory cytokines such as TNF-α, IL-6 and monocyte chemoattractant protein-1

(MCP-1) forming a positive feedback loop and further damage the cells via production of

ROS [2]. Proinflammatory cytokines has been known to induce the upregulation of iNOS

to produce NO and the subsequent translocation of NF-κB to the nucleus [22]. NF-κB is

a transcription factor for NADPH oxidase, which in turn generates even more

superoxides and increases oxidative stress for the β-cells. IL-1β has been found to be able

to induce iNOS alone but its effect is greatly amplified in the presence of IFN-γ and/or

TNF-α [56]. However, it has been found that when iNOS gene expression or activity is

8

absent, the cytokines’ harmful effect upon the β-cells is prevented [76]. Overexpression

of mitochondrial isoform of superoxide dismutase (MnSOD) is also able to prevent the

cytokine induced upregulation of iNOS and NF-κB activation [6], however

overexpression of MnSOD seem to increase β-cell apoptosis.

1.5.2 Effect of glucotoxicity on β-cell apoptosis

Glucotoxicity is a term used to refer to the deleterious effect in tissues of chronic

exposure to elevated levels of circulating glucose. Even though glucose infusion has been

found to be associated with β-cell proliferation and an increase in β-cell mass (section

1.4.2), chronic high glucose concentrations have also been associated with β-cell

apoptosis in both in vitro and in vivo models of T2DM [37]. Glucotoxicity has been

found to be related to the cytotoxic cytokine IL-1β from β-cells [15]. In vitro exposure of

human islets to high concentrations of glucose led to an increase in the production of IL-

1β and subsequent activation of NF-κB and FAS pathways as well as DNA fragmentation

resulting in β-cell toxicity [81]. Chronic hyperglycemia has been theorized as one of the

major causes of the loss of β-cell mass through β-cell apoptosis during the pathogenesis

of T2DM. Glucose induced toxicity in T2DM is exacerbated in the presence of

hyperlipidemia, specifically elevated levels of long chain non-esterfied fatty acids

(NEFA) [53].

1.5.3 Effect of lipotoxicity on β-cell apoptosis

9

Lipotoxicity is the pathologic changes in organs and tissues resultant from

elevated fat levels in circulation or in tissues. T2DM is often preceded by metabolic

syndrome, a combination of risk factors such as dyslipidemia, hypertension and obesity.

Elevated levels of long chain saturated NEFA have been shown to decrease insulin

secretion, induce β-cell dysfunction and destruction [101;139]. NEFA such as palmitic

acid are highly toxic to islet β-cells, however, monounsaturated and short chain saturated

NEFA are well tolerated and could even ameliorate the toxic effects of long chain

saturated NEFA [34].

NEFA acts on the β-cell through lipid binding G-protein coupled receptors

(GPCR) that are expressed in the β-cells, GPCR40 has been found to be involved in GSIS

through the activation of the phospholipase C (PLC) pathway and inositol trisphosphate

(IP3) mediated release of Ca2+ ions from the ER [111] which contributes to the exocytosis

and release of insulin.

Under normal conditions, fatty acids could also be used as an energy source by

the β-cells. They are broken down mainly through β-oxidation into acyl-CoAs in the

mitochondria and peroxisomes [50]. In the mitochondria, β-oxidation of NEFA is

coupled with the production of ATP. The NADH and FADH2 produced as a result of β-

oxidation as well as the subsequent processing of acyl-CoAs in the TCA cycle can

produce 106 mol of ATP per mol of palmitic acid. Short chain NEFA are usually directly

processed in the mitochondria while long chains are almost exclusively processed in the

peroxisome first [50]. The goal of β-oxidation in the peroxisome is to reduce the length of

the long chain NEFA which are poor substrates for mitochondrial β-oxidation [51]. The

10

shorter acyl-CoAs released by peroxisomes are then transported into the mitochondria for

further β-oxidation and the generation of ATP.

Production of ROS in the mitochondria can be attributed mostly to the electron

transport system [44;121]. Other than inducing activation of the electron transport chain

by fatty acid metabolism, it has been found that long chain saturated NEFA may directly

interact with respiratory chain proteins and increase the production of oxygen radicals

[112].

1.5.4 Effect of glucolipotoxicity on β-cell apoptosis

Glucolipotoxicity refers to the combined, deleterious effects of elevated

circulating glucose and fatty acid levels on pancreatic β-cell function and survival [100].

This combined damage from elevated glucose levels and fatty acid stems from the ability

of glucose to affect fatty acid metabolism, promoting increased synthesis of cellular

lipids. The combination of excessive intracellular fatty acids and glucose leads to

decreased insulin secretion, impaired insulin gene expression, and β-cell death by

apoptosis. In adult rodent models, it has been shown that infusion of glucose and lipids

could result in β-cell dysfunction and insulin resistance in as little as 72 hours [47].

However, the relevance of glucolipotoxicity in humans is still unclear. Several studies

have shown the inhibitory effect of chronically elevated fatty acid levels [14;23;24;75].

This suggests that high glucose and high lipid levels may contribute to β-cell failure in

T2DM in addition to decreased β-cell function observed after the onset of diabetes.

11

1.5.5 Effect of oxidative stress on β-cell apoptosis

Oxidative stress is the process of release of free radicals which cause cellular

damage. Oxidative stress plays a major role in the destruction of insulin producing β-cells

during the onset of T1DM and T2DM [8;108]. Increasing evidence suggest that the

formation of ROS such as peroxides, hydroxyl radicals, superoxide anion and reactive

nitrogen species (RNS) contribute to β-cell dysfunction and apoptosis [41;48]. Studies

have shown that elevated markers of oxidation, such as hydroperoxides [52;94] and

oxidative DNA damage [104;105;110] have been found in the pancreatic islets of patients

with T2DM. Oxidative damage to the pancreatic islets has also been found to be higher in

non-obese diabetic (NOD) mice, a T1DM mouse model, compared to their diabetic

resistant controls [60].

Under normoglycemic conditions, glucose is metabolized by the β-cells through

the TCA cycle. Electron donors such as NADH are created by passing electrons through

four complexes (complex I, II, III and IV) of the electron transport chain (ETC) in the

mitochondria creating a voltage gradient across the mitochondrial membrane which

produces ATP via ATP synthase.

Under chronic hyperglycemic conditions such as during diabetes mellitus,

excessive amounts of glucose are oxidized by the TCA cycle which in turn produces

excessive amount of electron donors (NADH and FADH2). These electron donors are

forced into the ETC, blocking the transfer of electrons to complex III. These surplus

electrons are picked up by oxygen molecules which create superoxides [17].

Superoxides are usually converted by MnSOD into H2O2. H2O2 produced in this

fashion is then usually reduced to H2O and O2 by catalases or glutathione peroxidases.

12

However, production of excessive superoxides during diabetes can have severe

detrimental effects. These reactive radicals contribute to the development of

complications in diabetes such as retinopathy, neuropathy and nephropathy. It has been

shown that a reduction of these free radicals by inhibition of the ETC through complex II

as well as upregulation of the MnSOD and uncoupling protein-1 (UCP-1) can protect

against the development of secondary complications in bovine aortic endothelial cells

[93]. These superoxides, in addition to the instigation of diabetic complications, lead to

β-cell dysfunction and cell death due to the limited ability for β-cells to process ROS

from lack of major antioxidants like SOD and catalase. [50]

This oxidative destruction of β-cell mass disrupts the fine balance of β-cell

growth and death that is required to maintain glucose homeostasis and is a major

contributor to the onset of both T1DM and T2DM [107].

Figure 1 illustrates the production of ROS in the β-cell by various sources.

13

Figure 1: Oxidative stress induced β-cell apoptosis

Cytokines are secreted by T-lymphocytes and by β-cells under glucolipotoxicity. These cytokines cause altered electron transport chain action in the mitochondria and induces the activation of iNOS and NF-κB, both of which increase ROS levels in the β-cell. Elevated levels of ROS will lead to β-cell toxicity and apoptosis unless prevented by antioxidant molecules such as peroxiredoxins.

1.5.6 Other Apoptosis inducers

Streptozotocin (STZ) is a member of a group of drugs known as alkylnitrosourea.

This chemical is commonly used to induce β-cell injury in both in vitro and in vivo

models of diabetes. Although it has been generally accepted that STZ directly alkylate

DNA causing strand breaks and induction of apoptosis [125], it has been theorized that

creation of free radicals plays a major role in STZ induced DNA damage and

14

cytotoxicity. It has been found that STZ enhances the induction of oxygen radicals in

pancreatic β-cells [95] and stimulates the creation of H2O2 and DNA fragmentation in

isolated rat islets [122]. DNA damage done by STZ has been shown to be preventable by

N-monomethyl-arginine, an inhibitor iNOS, as well as nicotinamide, a free radical

scavenger [9]. Furthermore, a recent study has reported that the diabetogenic effect of

STZ can be prevented through the overexpression of metallothionein, an antioxidant [26].

1.6 Peroxiredoxins

Peroxiredoxins (PRDX) are a family of thioredoxin dependant peroxide

reductases which are found to be ubiquitously expressed in most animal and plant cells.

This family of peroxidases is highly conserved throughout the evolutionary process [90].

They have been found in archea, prokaryotes as well as eukaryotes which indicate their

ancient origins [109]. The first member of this family was identified in yeast in 1988.

There has been extensive research on this family and currently there are six members

found to be expressed in mammalian cells.

PRDX are small proteins which may form homo and hetero dimers or oligomers.

The conserved cysteine residue in the N-terminus allows for the peroxidase activity

resulting in disulfide bond formation intramolecularly or with other PRDX. The oxidized

PRDX is regenerated via thioredoxin. Mammalian PRDX have been known to be linked

to cytokine induced H2O2 production which has been shown to mediate signaling

cascades involved with proliferation, differentiation and apoptosis [131].

Due to the highly conserved nature of their structure, PRDX could be split into

three categories based on their reactive cysteine residues (Cys): typical 2-Cys, atypical 2-

15

Cys, and 1-Cys [132]. All PRDX have a reactive cys residue at the N-terminus, however,

2-Cys have an additional reactive cys residue in the C-terminus as well. Furthermore, the

2-Cys can be subdivided into typical and atypical groups. This categorization depends on

the position of the cys residue in the C-terminus. Catalytic cys residues in N-terminus

have been highly conserved in all species in which PRDX are found, suggesting that the

1-Cys developed first and is the more ancestral form. PRDX1, PRDX2, PRDX3 and

PRDX4 are typical 2-Cys and PRDX5 atypical 2-Cys. PRDX6 is the 1-Cys with only one

active cysteine residue [109]. There is a structural region called the “thioredoxin fold”

which is highly conserved through all PRDX. The increase in function of PRDX from a

purely antioxidant role to signaling through modulation of hydrogen peroxide could be

explained through the emergence of the different evolutionary isoforms.

PRDXs are also described as soluble factors with immune regulatory roles.

PRDX1 and PRDX2 in mammals were originally identified in the cytosolic fraction of

red blood cells. These proteins were initially found to enhance the cytotoxic effect of the

natural killer cells. Thus they were named natural killer cell enhancing factor A and B

[117]. It was thought that since PRDX1 and PRDX2 are not found in the membrane of

the red blood cells, so they were only released after the red blood cell has undergone lysis

to bind with an unknown receptor on the NK cells.

PRDX4, unlike PRDX1 and PRDX2, has a hydrophobic N-terminal signal

sequence which targets it to the endoplasmic reticulum (ER). This attribute separates

PRDX4 from all other mammalian PRDXs as it allows PRDX4 to be actively secreted

and functional in the extracellular space [85]. Other than being an antioxidant in the

extracellular space, it also acts as a cytokine and enhances the function of NF-κB as well

16

as up regulating NF-κB expression dependant genes such as intracellular adhesion

molecule-1 (ICAM-1) and inducible nitric oxide synthase (iNOS) in astrocyte cell

cultures [58]. Recently, transgenic mice expressing high levels of PRDX4 in the pancreas

has been found to be more resistant to high dose STZ induced diabetes and β-cell death

[36].

Different members of PRDXs have been found to be distributed in various

organelles throughout the cell. PRDX1, 2 and 6 are cytosolic proteins, PRDX3 is only

expressed in mitochondria, PRDX4 is localized in the ER and extracellular space, and

PRDX5 exist in different forms throughout the mammalian cell in the cytosol,

mitochondria and the nucleus.

Mammalian PRDXs are highly expressed in the cytosol. An individual red blood

cell could contain up to 15 million molecules of PRDX2 [79], PRDX are one of the most

abundantly expressed proteins in E. Coli and they are 0.1%-0.8% of all soluble proteins

in mammalian cells [78]. In most cells, PRDX have multiple antioxidant functions. If the

plasma membrane’s integrity is compromised due to infections or physical damage, the

PRDXs are released into the extracellular space. For example, PRDX1 is released from

apoptotic cells during systemic sclerosis, and is secreted by lung cancer cells in vitro and

in vivo [25]. The clinical significance of PRDXs in the extracellular space is currently not

well known. Recent studies have found that tumour associated macrophage changes

phenotype to regulatory or wound healing macrophages as the tumour grows and

progresses. These macrophages have been found to inhibit immune response to the

tumour as well as contribute to angiogenesis which promotes tumour growth. PRDX2 in

mouse is capable of setting off this change in phenotype of macrophages. It is possible

17

the tumour cells secrets PRDXs to change the surrounding environment to be more

acclimatable for the growth and migration of the tumour cells [62].

Induction of oxidative, ferric, and β-mercaptoethanol stress have been found to

induce PRDX expression. Recently, it has been found that also H2O2, okadaic acid, tissue

plasminogen activator, butylated hydroxyanisole, and even ionizing radiation could

induce upregulation of PRDXs [42]. Currently, PRDXs have been investigated in regards

to a broad physiological and pathological field. It has been found that its expression is

related closely to certain types of diseases such as various forms of cancer and

neurological diseases such as Alzheimer’s and Parkinson’s disease.

It has been found that PRDXs have atypical expression in various types of cancers

including thyroid tumours, oral, lung, bladder, esophageal, and breast. In breast cancer,

all six PRDXs have abnormal expression but in oral cancers only PRDX1 expression is

altered [136]. Since ROS have long been considered to have potential carcinogenic

properties as well as to promote metastasis of tumour cells and that oxidative stress is

able to induce PRDX expression, so it is possible that upregulation of PRDX expression

is correlated with tumourigenesis, therefore PRDX have considered to be biomarkers for

cancers [27;67] and demonstrated anti-tumour properties [21;28;89].

PRDX expression also have a strong correlation with certain neurological

disorders such as Alzheimer’s [82], Parkinson’s [64], Amyotrophic lateral sclerosis and

stroke [61] as well as lung diseases such as sarcoidosis [71;113]. In addition, they can be

a possible central regulator of circadian rhythms [7]. This suggests that PRDXs have a

multiple roles in the survival of the organism other than just the reduction and clearance

of ROS.

18

Recent studies have suggested that PRDX3 and PRDX4 have the ability to

prevent pancreatic β-cell apoptosis and diabetes [36;131]. However, little is known about

whether PRDX2 has a role in β-cell apoptosis and survival.

Figure 2: Model for peroxiredoxin function

ROS such as H2O2 are reduced to H2O by the cysteine residues on peroxiredoxins to form disulfide bonds. The peroxidatic cysteine residue of the reduced peroxiredoxin reduces the peroxide, and is in turn converted to cysteine sulfenic acid (SOH). The resolving cysteine residue (SH) of another peroxiredoxin then forms a disulfide bond with the cysteine sulfenic acid, releasing H2O. This intermolecular disulfide bond is in turn reduced by Thioredoxin [10]. Thioredoxin reductase uses NADPH to reduce the oxidized form of thioredoxin.

1.6.1 Peroxiredoxin 2

PRDX2 is a typical 2-Cys. It has many aliases due to its structure as well as its

many functions. PRDX2 has a hollow cylinder shape that provided the name Torin prior

19

to being named PRDX2 [59]. Many other names were given to PRDX2 such as

Calpromotin [88], thio-specific antioxidant, thioredoxin specific peroxidase , protector

protein [77] and natural killer enhancing factor B [116]. PRDX2 is an obligate

homodimer in a head to tail orientation. PRDX2’s catalytic activity depends on two

highly conserved cysteine residues. Cys 51, the peroxidatic cysteine, reacts with H2O2 to

form a sulfenic acid which then reacts with cys 172 to form a disulfide bond. Arg 127

lowers the pKa by providing a positive charge to cysteine 51 which enhances its

reactivity with H2O2 and is therefore instrumental to facilitate catalysis. Thioredoxin

reduces the disulfide bond which is in turn reduced by thioredoxin reductase with

NADPH [59;79]. Figure 2 illustrates a model of oxidation and reduction in typical 2-Cys

PRDX function.

It has been found that in hamsters fed a high fructose diet to induce fatty livers,

hyperinsulinemia and hyperlipidemia develop elevated levels of PRDX2 in the liver,

suggesting that PRDX2 may be linked to the onset of metabolic syndrome [137].

1.7 Rationale

Loss of β-cell mass brought on partially due to excessive β-cell toxicity and

apoptosis is a cause of both T1DM and T2DM. Reactive oxygen and nitrogen species

have been found to be elevated in mice and patients with both T1DM and T2DM

[60;110]. Reactive oxidative and nitrosative damage is a major contributor of β-cell

dysfunction and cell death due to low levels of major antioxidant enzymes such as

superoxide dismutase, glutathione peroxidase and catalases in the β-cells [74].

20

Peroxiredoxins are a family of highly conserved thioredoxin dependant peroxide

reductases. They have been found to be ubiquitously expressed in almost all organisms

and cell types including β-cells. PRDX1 and PRDX2 have been found to be highly

expressed in the islet cells but not in the exocrine pancreas [8]. PRDX1 and PRDX2

expressions in the β-cell are correlated with oxidative stress inducers [8].PRDX3 and 4

has already found to have protective effects on the β-cell against cytokine and STZ

induced β-cell death [36;131].

Cytokine induced β-cell apoptosis is partially through activation of the NF-

κB/iNOS pathway. Recently PRDX2 has also been found to be related to NF-κB

expression in granulosa cells [134] as well as being able to inhibit neuronal apoptosis

through ASK-1 pathway [64]. This may suggest that PRDX2 is related to oxidative stress

induced dysfunction and death in the β-cell.

Previous unpublished results by the Wang lab revealed that the GLP-1 analog

exendin-4 treatment upregulates PRDX2 levels in β-cells. This raises the possibility that

PRDX2 may be related to the modulation of β-cell death and survival pathways. My

preliminary studies showed that PRDX2 expression decreases during induced β-cell death

by proinflammatory cytokines (IL-1 β, TNF α, IFN γ), palmitic acid and streptozotocin,

further suggesting that PRDX2 may regulate β-cell apoptosis and/or survival.

1.8 Hypothesis

It is my hypothesis that PRDX2 is important for the survival of pancreatic β-cells

during periods of oxidative stress. I postulate, elevation of PRDX2 expression can protect

β-cells from oxidative stress induced apoptosis induced by oxidative stress stimulating

21

agents and reduction of PRDX2 may induce β-cell apoptosis conditions which cause

oxidative stress. To test this hypothesis, the insulin producing β-cell line MIN6 will be

used as a model. Elevation of PRDX2 in the clonal β-cells will be achieved by transient

transfection of the expression vector encoding PRDX2. Ablation of PRDX2 in the β-cells

will be conducted by knocked down strategy using siRNA. These cells transfected with

or without the plasmids or siRNA constructs will then be challenged with various stimuli

to induce oxidative stress associated toxicity and apoptosis in these β-cells, partially

through the induction of oxidative stress including proinflammatory cytokines, palmitic

acid and STZ. The cell death and apoptosis will be measured to determine the role of

PRDX2 in modulating β-cell toxicity and apoptosis using various methods, including

nuclear staining based on criterion of nuclei condensation and fragmentation, Western

blot analysis using anti-caspase-3 antibody, and flow cytometry assisted cell sorting

(FACS) analysis in the β-cells stained with propidium iodide. .

1.9 Objective

1. To examine PRDX2 expression in pancreatic islets and β-cells.

2. To quantify apoptosis of the β-cell line MIN6 induced by pro-inflammatory

cytokine cocktail, palmitic acid and STZ.

3. To determine if overexpression of PRDX2 in β-cells can prevent oxidative stress

induced β-cell apoptosis.

4. To determine if knockdown of PRDX2 in β-cells increases β-cell apoptosis under

normal and oxidative stress conditions.

22

Chapter 2: Materials and Methods

2.1 Chemical and reagents

Roswell Park Memorial Institute (RPMI) 1640 medium, TRIzol reagent,

Lipofectamine 2000, trypsin-EDTA and OPTI-MEM were purchased from Invitrogen

(Burlington, ON, Canada). Fetal Bovine Serum (FBS), β-mercaptoethanol, Palmitic acid,

Bovine serum albumin (BSA), fatty acid-free BSA, Streptozotocin, poly-L-lysine and

Triton X 100 were purchased from Sigma Aldrich (Oakville, ON, Canada). pCMVsport6-

PRDX2 vector was purchased from Open Biosystems (Huntsville, AL, USA).

siGENOME smartpool siRNA was purchased from Dharmacon RNAi technologies

(Chicago, IL, USA). Scrambled siRNA was purchased from Ambion (Austin, TX, USA)

AffinityScript one-step RTPCR kit was purchased from Stratagene (Mississauga, ON,

Canada). IL-1β, TNF-α and IFN-γ were purchased from R&D Systems (Minneapolis,

MN, USA). PRDX2 antibody (mouse monoclonal) and GAPDH antibody (mouse

monoclonal) were purchased from ABCAM (Cambridge, MA, USA). Caspase-3 antibody

(rabbit, polyclonal) was purchased from Cell Signaling Technology Inc. (Danvers, MA,

USA). Bradford Assay reagent was purchased from Bio-Rad Laboratories Ltd.

(Mississauga, ON, Canada). Enhanced chemiluminescence Plus reagent was purchased

from GE Global Research (Niskayuna, NY, USA). Paraformaldehyde was purchased

from BioShop Canada Inc. (Burlington, ON, Canada). All other additional chemicals and

reagents were purchased from either BioShop Canada Inc. (Burlington, ON, Canada) or

Sigma Aldrich (Oakville, ON, Canada).

2.2 Equipment

23

Thermocycler used for RTPCR was purchased from Eppendorf Canada (Mississauga,

ON, Canada). Mini-PROTEAN Tetra Cell used for SDS-PAGE, Trans-Blot SD Semi-

Dry Transfer Cell and PVDF membrane was purchased from Bio-Rad Laboratories Ltd.

(Mississauga, ON, Canada). Fluorescent microscope used to visualize immunostaining

was purchased from Nikon Instruments (Melville, NY, USA). FACS-Calibur flow

cytometer was purchased from Becton-Dickinson Biosciences (Mississauga, ON,

Canada)

2.3 Animals

Rats were housed in a pathogen free animal facility (Vivarium SMH). Rats were

maintained on a 12 light / 12 dark cycle. Mice had free access to water and pellets. All

animal protocols were approved by the animal care committee at SMH and in accordance

with national guidelines from the Canadian council of animal care.

2.4 Isolation of Pancreatic Islets

Islets were isolated from the pancreas of 7-8 week old male Sprague–Dawley rats

(weight 150–200 g), obtained from Charles River Canada (Montreal, QC, Canada), by

perfusion of the pancreas through the common bile duct with 10 mL of a collagenase

solution (10 mg/100 g body weight) and incubation of the excised pancreas with shaking

at 37ºC. The pancreatic cells were washed, filtered through 355 µm mesh, and separated

on a density gradient created by resuspending the pellet in histopaque-1077 (Sigma, St.

Louis, MO) and layering on serum-free media (low-glucose (LG)-RPMI 1640 described

below without serum). Islets were collected from the interphase and further purified from

contaminating single cell types by sedimentation. Isolated islets were cultured in LG-

24

RPMI 1640 (7.5% FBS, 1% penicillin/streptomycin, 0.25% HEPES, and 2.5 mM

glucose) at 37ºC and 5% CO2.

2.5 Cell culture

The mouse insulinoma cell line MIN6 was a generous gift from Dr. Rozakis

Adcock’s lab. MIN6 cells exhibit normal glucose metabolism and glucose stimulated

insulin secretion [66]. MIN6 cells (passage 50–70) were maintained in RPMI 1640

medium containing FBS (10% v/v), 100 units/mL penicillin G sodium, 100 µg/mL

streptomycin sulphate, 55 mg/500 mL sodium pyruvate, 1.14 g/500 mL HEPES, and 1.7

µL/500 mL β-mercaptoethanol at 37°C in an atmosphere of humidified air (95%) and

CO2 (5%). In studies involving serum-starvation, serum was replaced by 0.1% BSA in

serum free RPMI 1640 (SFM).

2.6 Treatment of oxidative stress agents

Palmitic acid (PA) was dissolved in serum free RPMI1640 medium (0.4mM

containing 1% fatty acid-free BSA (FA-free BSA)). This mixture was shaken (225RPM

at 37ºC for 3 hours) to allow binding of PA with BSA. MIN6 cells were seeded at 80%

confluency in 12 well plates (BD, Mississauga, ON, Canada) the day previous to

treatment. 1% FA free BSA was also shaken at 225RPM at 37ºC for 3 hours to act as

control. The MIN6 cells were then serum starved for 1 hour and treated with indicated

concentrations of PA in SFM with 1% FA-free BSA for 24 hours. For 0mM PA, the

MIN6 cells were treated with 1% FA-free BSA in SFM.

25

A cytokine cocktail (10 ng/mL IL-1β, 50 ng/mL TNF-α and 50 ng/mL IFN-γ) was

prepared in serum free RPMI 1640 medium. MIN6 cells seeded at 80% confluency in 12

well plates the night before were serum starved for 1 hour then treated with the cytokine

cocktail for 0, 16 or 24 hours.

STZ was dissolved in serum free RPMI 1640 medium. MIN6 cells seeded at 80%

confluency in 12 well plates the night before were serum starved for 1 hour then treated

with indicated amounts of STZ for 4 hours.

2.7 Overexpression and knockdown of peroxiredoxin 2

Expression vector encoding PRDX2 (pCMVsport6-PRDX2, Open biosystems) or

pEGFP (Clontech laboratories Inc., Mountain View, CA, USA) were transiently

transfected with lipofectamine 2000 (Invitrogen) in MIN6 cells seeded at 80%

confluency to elevate PRDX2 expression or GFP respectively. The cells were allowed to

grow in complete RPMI 1640 medium for 24 hours post transfection before the treatment

with stress agents.

siGENOME smartpool (Dharmacon) targeting mouse PRDX2 or scrambled

siRNA (Ambion) were transiently transfected in 80% confluent MIN6 cells with

lipofectamine 2000. The cells were allowed to grow in complete medium for 24 hours

post transfection before treatment with stress agents.

For overexpression experiments, MIN6 cells were seeded in 12 well plates at 70%

confluence and allowed to attach to the plates the night before transfection. On the day of

transfection 1.6µg per well of either pCMVSport6-PRDX2 or pEGFP were diluted in

100µL per well of Opti-MEM, 4µL per well of lipofectamine 2000 were diluted in 100µL

per well of Opti-MEM.. The cells seeded the day before were washed with SFM twice.

26

800µL of Opti-MEM was finally placed in the wells. After the 20 minute incubation, 200

µL per well of the DNA-lipofectamine 2000 mixture was added to each of the wells. The

DNA-lipofectamine mixture was allowed to incubate with the cells for 6 hours under

normal tissue culture conditions, i.e. humidified at 37ºC with 5% CO2. Then the mixture

media was discarded and replaced with complete media containing 10% FBS.

For siRNA experiments, 40 pmol per mL of siRNA and 2µL per mL of

lipofectamine 2000 were used instead.

2.8 RT-PCR

Total RNA was extracted using the TRIzol reagent according to the

manufacturer's instructions. RTPCR was performed using AffinityScript one-step

RTPCR kit according to the manufacturer’s protocol.

The primers used were

PRDX2 fwd: 5’ ATCCCTCTGCTTGCTGATGT 3’

PRDX2 rev: 5’ TTGACTGTGATCTGGCGAAG 3’

GAPDH fwd: 5’ TGCCACTCAGAAGACTGTGG 3’

GAPDH rev: 5’ TTCAGCTCTGGGATGACCTT 3’

The DNA was first denatured at 95°C then annealed at 60°C and extended at 72°C. This

was repeated for 30 cycles before a final extension at 72°C..

2.9 Western blot analysis

Cells and tissues were lysed using RIPA lysis buffer. Protein concentration of

samples was measured using the Bradford assay with varying concentrations of BSA as a

27

standard. Sodium dodecyl sulphate poly-acrylamide gel electrophoresis (SDS-PAGE)

gels were made (5% stacking and 15% separating). 20µg of protein per sample was

denatured with 1X SDS buffer with bromophenol blue at 99°C for 5 minutes then loaded

in a SDS-PAGE gel Prestained Protein Molecular Weight Marker (Fermentas Canada,

Burlington, ON, Canada) was used to estimate the molecular weight of the protein bands.

The proteins were then transferred from the gel onto the PVDF membrane using

the Trans-Blot SD Semi-Dry Transfer Cell.

The membrane was washed with Tris-Buffered Saline with Tween 20 (TBST),

blocked with 5% milk in TBST. The membrane was washed again in TBST before being

incubated with primary antibodies in TBST with 3% BSA targeting PRDX2 (1:1000,

22kD), GAPDH (1:20,000, 37 kD) or cleaved caspase-3 (1:1000, 17-19 kD) at 4°C

overnight. The membranes were washed with TBST then incubated with their respective

HRP conjugated secondary antibodies in TBST with 5% milk (anti-mouse 1:5000; anti-

rabbit 1:3000) for 1 hour at room temperature. They were then washed with TBST before

being subjected to enhanced chemiluminescence with ECL plus then visualized with

Clonex BioFlex MSI Film (Clonex Corporation, Markham, ON, Canada).

The films were then scanned and the images were quantified using ImageJ based

on intensity and width of the bands.

2.10 Immunocytochemistry

Glass cover slips were placed in 12 well plates and coated with poly-L-lysine

(1:20 in PBS) for 1 hour. MIN6 cells were seeded at 60% confluency on the cover slips

overnight. The cells were then transfected with pCMVsport6-PRDX2 or pEGFP using

lipofectamine 2000 according to manufacturer’s protocol. 24 hours post transfection, the

28

cells were serum starved for 1 hour and treated with 0.4mM PA, cytokine cocktail, or

1mg/mL STZ for the indicated amounts of time. The coverslips were washed with PBS

and fixed with 4% paraformaldehyde for 1 hour at room temperature. The cells were

permeabilized and blocked with 5% BSA and 0.1% Triton X 100 in PBS respectively for

1 hour. Primary antibody targeting PRDX2 (1:250 in PBS with 5% BSA) was incubated

overnight at 4°C. Primary antibody was removed and the coverslips were washed with

PBS. Secondary antibody conjugated with Alexa 555 (1:500 in PBS with 5% BSA) was

incubated for 1 hour at room temperature followed by incubation with DAPI (1:5000).

The coverslips were then mounted on a glass microscope slide with DAKO fluorescence

mounting medium and allowed to dry overnight in a cool, dark space before visualization

with Nikon Fluorescence microscope (Eclipse TE 200).

2.11 Nuclear staining for the detection of apoptosis

Apoptosis of stained MIN6 cells was identified by DAPI-nuclear staining using

typical morphologic criteria of chromatin condensation and fragmentation. After

visualization of immunocytochemistry stained cells, the number of apoptotic cells was

counted and was divided by the total number of transfected cells to determine the

percentage of apoptotic transfected cells. 350-450 transfected cells were counted for each

condition.

2.12 Flow cytometry analysis

Flow cytometry analysis of MIN6 cells overexpressing PRDX2 and treated with

palmitic acid, cytokines or STZ was performed using propidium iodide (PI). MIN6 cells

were seeded in 24 well plates at 70% confluency and allowed to attach overnight. The

29

cells were than transfected with vectors for PRDX2 or GFP whose expression is driven

by CMV promoters. The cells were than treated with 0.4mM palmitic acid or

proinflammatory cytokine cocktail for 24 hours or STZ for 4 hours. The supernatants

were discarded. The cells were then washed with PBS, trypsinized, collected, centrifuged

and resuspended in a solution containing 1µg/mL PI in PBS. The cells were incubated in

the PI solution for 30 minutes before they were subjected to FACS. Cell-associated

fluorescence was measured using a FACS-Calibur flow cytometer (Becton-Dickinson

Biosciences), using a blue argon laser of 488 nm at 15 mW, and the results were analysed

using FCS Express version 3 (De Novo Software). Fluorescence in the FL2 channel (log

red fluorescence, long pass 650 nm filter) for PI were acquired and recorded, using

logarithmic scales, for a minimum of 10000 cells per sample. The FACS machine was

standardized using unstained and PI positive MIN6 cells.

2.13 Statistical analysis

Histograms are expressed as the mean +/- SEM. Statistical significance was

determined with unpaired 2-tailed student's t-test. A p-value of less than 0.05 was

considered statistically significant.

30

Chapter 3: Results

3.1 Peroxiredoxin 2 is expressed in α- and β-cell lines, pancreatic islets and the rat

pancreatic tissues

PRDX2 has been reported in previous studies to be ubiquitously expressed in all

tissues. [86] To examine whether or not PRDX2 is expressed in the used islet cell lines

and in the pancreas, RT-PCR and Western blot were performed on α- and β-cell lines as

well as rat pancreatic islets and whole pancreas. Both RT-PCR (Fig. 3A) and Western

blot (Fig. 3B) analysis showed that PRDX2 mRNA as well as protein are expressed in

isolated islets and - and β-cell lines.

31

Figure 3: PRDX2 is expressed in α- and β cell lines and pancreatic islets

(A) RT-PCR performed on mRNA extracted from INS-1, MIN6, α-TC6, In-R1-G9 and mouse Islet. (B) Western blot probing for PRDX2 (1:1000) and GAPDH (1:20,000) was performed on protein extracted from α-TC6, MIN6, pancreatic islet and whole pancreas.

3.2 Apoptosis induced by palmitic acid, cytokines and streptozotocin reduces

endogenous peroxiredoxin 2 levels

Palmitic acid (PA) has been known to be detrimental to pancreatic β-cells causing

suppressed insulin secretion and β-cell dysfunction and eventual cell death [54]. PA

induces lipotoxicity and subsequent β-cell apoptosis through ER stress and calcium

depletion, which has recently been found to be related to the production of reactive

32

oxygen species (ROS) in the mitochondria [46;91]. As PRDX2 is an antioxidant, In order

to determine whether the expression level of PRDX2 is altered upon treatment with PA..

Western blot analysis was performed in the MIN6 cells treated with increasing

concentrations of PA. The results show that as β-cell apoptosis increases, PRDX2

expression in these β-cells decrease in PA treated cells (Fig. 4).

Figure 4: Palmitic acid treatment is associated with decreased PRDX2 expression levels in β-cells

(A) Western blot performed on proteins extracted from MIN6 cells treated with 0, 0.2, 0.4 mM of palmitic acid with 1% BSA in serum free medium for 24 hours probing for PRDX2 (1:1000), GAPDH (1:20,000), and cleaved caspase 3 (1:1000). (B) Histogram represents quantitative analysis of relative PRDX2 expression over GAPDH in MIN6 cells with treatment of increasing concentrations of palmitic acid. (C) Relative cleaved caspase 3 expression in MIN6 cells increases with increasing concentrations of palmitic acid. n=3, *p<0.05

33

In T1DM, β-cell apoptosis involves a signaling cascade initiated by cytokines

such as IL-1β, TNF-α and IFN-γ. Specifically, IL-1β and IFN-γ and/or TNF-α induces

oxidative and nitrosative stress through the upregulation of iNOS and the production of

nitric oxide (NO) [29]. Also recent studies have revealed that IL-1β is a major contributor

in the loss of β-cell mass in type 2 diabetes [35]. Our results showed that treatment of

MIN6 cells with the cytokine cocktail is similar to treatment with PA. PRDX2 expression

was found to be inversely correlated with cytokine cocktail induced β-cells apoptosis.

Endogenous PRDX2 expression is reduced with increased exposure time to cytokines

(Fig. 5).

34

Figure 5: Cytokine cocktail treatment is associated with decreased PRDX2 expression levels in β-cells

(A) Western blot performed on proteins extracted from MIN6 cells treated with 10ng/mL IL-1 β, 50ng/mL TNFα and 50ng/mL IFNγ in serum free medium for 0, 16 and 24 hours. (B) Histogram represents quantitative analysis of relative PRDX2 expression over GAPDH in MIN6 cells with treatment of cytokine cocktail for an increasing period of time. (C) Relative cleaved caspase 3 expression in MIN6 cells increases with increasing temporal treatment of cytokine cocktail. n=3, *p<0.05

Streptozotocin (STZ) is a member of a group of drugs called alkylnitrosoureas

which enters the β-cells through the glucose transporter 2 [133]. STZ induces β-cell

apoptosis via the generation of NO and directly damages DNA. It has been reported that

in β-cells treated with STZ, endogenous PRDX2 expression is altered [8]. Therefore we

35

investigated PRDX2 expression in MIN6 cells in response to increasing concentrations of

STZ. The Western blot analysis using PRDX2 antibody showed that similar to PA and

cytokine treatment, STZ treatment dose dependently reduced endogenous PRDX2

expression, which was associated with increased pro-casepase-3 levels, suggesting that

PRDX2 expression is reduced in the process of STZ-induced beta-cell apoptosis (Fig. 6).

Figure 6: Streptozotocin treatment is associated with decreased PRDX2 expression levels in β-cells

(A) Western blot performed on proteins extracted from MIN6 cells treated with 0, 0.5, 1 mg/mL of STZ in serum free medium for 4 hours. (B) Histogram represents quantitative analysis of relative PRDX2 expression over GAPDH in MIN6 cells with treatment of increasing concentrations of STZ. (C) Relative cleaved caspase 3 expression in MIN6 cells increases with increasing concentrations of STZ. n=3, *p<0.05

36

3.3 Overexpression of peroxiredoxin 2 can protect against palmitic acid, cytokines

and streptozotocin induced β-cell toxicity.

There is a possible inverse correlation between endogenous PRDX2 expression

and β-cell apoptosis brought on by oxidative stress (fig 4-6). It is possible that PRDX2

may play a role in the process of β-cell apoptosis. To elucidate this relationship, vectors

coding for PRDX2 or GFP driven by Cytomegalovirus (CMV) promoters were

transiently transfected in MIN6 cells. These cells were then subjected to either treatment

of PA (0.4mM) for 24 hours, a proinflammatory cytokine cocktail for 24 hours or STZ

(1mg/mL) for 4 hours.

Western blot shows that cleaved caspase 3 expression in cells overexpressing

PRDX2 treated with PA (Fig. 7) was significantly reduced compared to its GFP control.

Also immunocytochemistry of MIN6 cells with PRDX2 overexpression showed fewer

numbers of cells with nuclear condensation/fragmentation, and indicator of apoptosis,

following PA treatment (Fig. 8). Furthermore, Fluorescence assisted cell sorting (FACS)

of PA treated cells overexpressing PRDX2 also revealed that PRDX2 overexpression

decreased the number of propidium iodide (PI) positive, an indicator of cell death, cells

(Fig. 9). These results show that PRDX2 overexpression is able to attenuate PA induced

toxicity in the β-cells.

Western blot results showed that cleaved caspase 3 expression in MIN6 cells

overexpressing PRDX2 is significantly reduced following cytokine cocktail treatment

compared with GFP controls (Fig. 10). In addition, immunocytochemistry of cytokine

treated MIN6 cells revealed that PRDX2 overexpression significantly reduced the

37

number of transfected cells with nuclear fragmentation and condensation (Fig. 11). FACS

performed on cytokine treated MIN6 cells demonstrated that PRDX2 overexpression can

significantly reduce the number of PI positive cells (Fig. 14). These results suggest that

PRDX2 overexpression can attenuate cytokine induced β-cell toxicity.

Western blot showed that PRDX2 overexpression in MIN6 cells could

significantly reduce STZ induced cleaved caspase-3 expression (Fig. 12). STZ treated

MIN6 cells overexpressing PRDX2 subjected to immunocytochemistry showed

decreased nuclear fragmentation and condensation compared to its controls (Fig. 13).

FACS performed on MIN6 cells overexpressing PRDX2 following STZ treatment

showed significant decrease in PI positive cells (Fig. 14). These results show that PRDX2

overexpression can protect β-cells from STZ induced toxicity.

38

Figure 7: Overexpression of PRDX2 attenuates palmitic acid induced cleaved caspase-3 expression

(A) MIN6 cells were transiently transfected with pCMV-sport6-PRDX2 or pEGFP. 24 hours post transfection, the cells were treated with 0.4mM palmitic acid with 1% Fatty acid free BSA in serum free medium for 24 hours. Protein harvested from these cells was subjected to western blot probing for PRDX2 (1:1000), cleaved caspase 3 (1:1000), and GAPDH (1:20,000). (B) Quantitative analysis of average cleaved caspase 3 expression with SEM, n=4, *p<0.05

39

Figure 8: Overexpression of PRDX2 attenuates palmitic acid induced nuclear fragmentation and condensation

(A) MIN6 cells were grown on glass cover slips, then transfected and treated with PA similar to Fig. 7. The cells were then subjected to immunocytochemistry, probing for PRDX2 (1:250). The nuclei were stained with DAPI (1:5000). Nuclei of stained red (PRDX2 overexpression) and green (GFP transfected) cells were assessed. Abnormal nuclear morphology was used as an indicator of apoptosis. White arrows are pointing to representative transfected apoptotic cells. (B) Histogram quantifying transfected cells with abnormal nuclei. n=3, *p<0.05

40

Figure 9: Overexpression of PRDX2 attenuates palmitic acid induced β-cell death

(A) MIN6 cells were transfected and treated similarly to Fig. 7, 8. The cells were collected and treated with 1µg/mL PI for 30 minutes at room temperature and subjected to FACS. Fluorescence in the FL-2 channel was acquired and recorded for 10000 events. (B) Relative number of PI positive cells compared with BSA control with SEM, n=4, * p<0.05, ** p<0.01

41

Figure 10: Overexpression of PRDX2 attenuates cytokine cocktail induced cleaved caspase 3 expression (A) MIN6 cells were transfected with pCMV-sport6-PRDX2 or pEGFP were treated with 10ng/mL IL-1β, 50ng/mL TNFα and 50ng/mL IFNγ (Cyto) in serum free medium for 24 hours. Protein harvested from these cells was subjected to western blot analysis. (B) Histogram representing quantitative analysis of average cleaved caspase 3 expression with SEM, n=3, *p<0.05

42

Figure 11: Overexpression of PRDX2 attenuates cytokine cocktail induced nuclear fragmentation and condensation

(A) MIN6 cells were grown on glass cover slips, then transfected and treated similar to Fig. 10. The cells were then subjected to immunocytochemistry similarly to Fig. 8. White arrows are pointing to representative transfected apoptotic cells. (B) Histogram quantifying transfected cells with abnormal nuclei. n=3, *p<0.05

43

Figure 12: Overexpression of PRDX2 attenuates streptozotocin induced cleaved caspase 3 expression

(A) MIN6 cells were transfected with pCMV-sport6-PRDX2 or pEGFP were treated with 1mg/mL STZ in serum free medium for 4 hours. Protein harvested from these cells was subjected to western blot analysis. (B) Quantitative analysis of average cleaved caspase 3 expression with SEM, n=3, *p<0.05

44

Figure 13: Overexpression of PRDX2 attenuates cytokine cocktail induced nuclear fragmentation and condensation

(A) MIN6 cells were grown on glass cover slips, then transfected and treated similarly to Fig. 12. The cells were then subjected to immunocytochemistry similar to Fig. 8. White arrows are pointing to representative transfected apoptotic cells. (B) Histogram quantifying transfected cells with abnormal nuclei. n=3, *p<0.05

45

Figure 14: Overexpression of PRDX2 attenuates cytokine and STZ induced β-cell death

(A) MIN6 cells were transiently transfected with pCMV-sport6-PRDX2 or pEGFP. 24 hours post transfection, the cells were treated with a cytokine cocktail for 24 hours or STZ for 4 hours. The cells were then collected and treated with 1µg/mL PI for 30 minutes at room temperature and subjected to FACS. Fluorescence in the FL-2 channel was acquired and recorded. (B) Relative number of PI positive cells compared with BSA control with SEM, n=4, ** p<0.01

46

3.4 Knockdown of peroxiredoxin 2 exaggerated palmitic acid; cytokines, and

streptozotocin induced β-cell death.

PRDX2 overexpression appears to be able to inhibit oxidative and nitrosative

stress induced β-cell toxicity and apoptosis/death as seen in figures 8-14. To verify that

PRDX2 is responsible for this reduction in apoptosis/death induced by PA, cytokines and

STZ, siRNA targeting mouse PRDX2 or scrambled sequence were transiently transfected

into MIN6 cells. The transfected cells were then serum starved for 1 hour and treated

with PA for 16 hours, a cytokine cocktail for 16 hours or STZ for 3 hours. Western blot

analysis shows that cells transfected with siRNA targeting PRDX2 had increased cleaved

caspase 3 expression under all conditions indicating increased β-cell toxicity and

apoptosis. (Fig. 15, 16)

47

Figure 15: Knockdown of PRDX2 exaggerates palmitic acid induced cleaved caspase 3 expression

(A) MIN6 cells were transiently transfected with siGENOME smart-pool siRNA targeting PRDX2 or scrambled sequence as control for 24 hours. The cells were then subjected to 0.4mM Palmitic acid in 1% Fatty acid free BSA or 1% Fatty acid free BSA only as control. Western blot were performed on the cell probing for PRDX2 (1:1000), cleaved caspase 3 (1:1000) and GAPDH (1:20,000). (B) Histogram representing relative average cleaved caspase 3 for palmitic acid treated MIN6 cells n=3 *p<0.05 **p<0.01

48

Figure 16: Knockdown of PRDX2 exaggerates cytokine cocktail and streptozotocin induced cleaved caspase 3 expression

(A) MIN6 cells were transfected similar to Fig. 15. The cells were then subjected to cytokine cocktail (10ng/mL IL-1β, 50ng/mL TNFα and 50ng/mL IFNγ) or 1mg/mL STZ with serum free medium as control. The protein from these cells were then collected and subjected to western blot probing for PRDX2 (1:1000), cleaved caspase 3 (1:1000) and GAPDH (1:20,000). (B) Histogram representing relative average cleaved caspase 3 for Cytokine cocktail and STZ treated MIN6 cells n=3, *p<0.05, **p<0.01

49

Chapter 4: Discussion

Pancreatic β-cell dysfunction and excessive loss of pancreatic β-cells are the

primary causes T1DM and T2DM [129]. Studies have shown that ROS are a major

contributor to increased β-cell apoptosis. Multiple different inducers of β-cell apoptosis,

such as cytotoxic cytokines in T1DM, glucolipotoxicity in T2DM and diabetes inducing

chemicals like streptozotocin, all partake in the production of various ROS or RNS. They

act partially through oxidative stress to induce β-cell dysfunction and apoptosis and

contributes to the loss of β-cell mass.

Diabetic mice as well as patients with diabetes have been found to have elevated

production of ROS and decreased antioxidant function in the β-cells and islets [60;110].

β-cells exhibit low levels of glutathione peroxidase, catalase and superoxide dismutase

even under normal glucose conditions. Due to lower expression of major antioxidants

within the β-cells [79], pancreatic β-cells are particularly vulnerable to the detrimental

effects of ROS mediated cellular damage and death compared with other cell types.

PRDX are a family of antioxidants which are expressed ubiquitously. PRDX

expression in β-cells has been found to correlate with oxidative stress [8]. In this study I

sought to investigate whether PRDX2 is able to prevent β-cell damage and apoptosis

caused by oxidative stress inducing agents that are relevant to T1DM and T2DM.

Previously, the group of Bast et al. have detected the expression of PRDX1 and

PRDX2 in mouse pancreatic β-cells. Consistent with their results, we found that PRDX2

is expressed in α- and β-cell lines, pancreatic islets and whole pancreas using RT-PCR

and western blot (Fig. 3).

50

The objective of this study was to examine, if any, the protective effect of PRDX2

on β-cell toxicity induced by oxidative stress agents. To establish a relationship between

PRDX2 and ROS induced β-cell toxicity, several β-cell oxidative stress inducers were

used including proinflammatory cytokines, palmitic acid and STZ to treat the β-cell line

MIN6. As shown, treatment with all three inducers led to an increase in β-cell apoptosis

and death as determined by increased cleaved caspase 3 expression levels in a dose or

time dependant fashion. It is also found that this increase in toxicity is correlated with a

decrease in endogenous PRDX2 expression (Fig. 4, 5, 6). This correlation suggests that

there is potentially a cause and effect relationship between PRDX2 expression and β-cell

toxicity and apoptosis which implies that PRDX2 could be an important factor for the

survival of pancreatic β-cells during periods of oxidative stress. This data actually

contradicts previous findings by Bast et al., who found that endogenous PRDX2

expression increased following STZ treatment both on the RNA transcript as well as the

protein level in their study [8]. This conflict could be due to the differences between our

experimental protocols. Bast el al. allowed the β-cells to recover for 24 hours after STZ

treatment before they were harvested whereas the experiments performed in this study

was designed to examine the effect of STZ treatment on endogenous PRDX2 levels,

therefore the cells were harvested immediately after treatment with STZ. Our results,

when taken together, illustrate a potential temporal element in the expression and

regulation of PRDX2 during oxidative stress. They reflect the possibility that PRDX2

levels are decreased by the onset of oxidative stress, however if the β-cell survives,

PRDX2 expression is up regulated to increase the chance of survival of the β-cell through

increased ROS clearance and possibly prepares the β-cell for future oxidative stress.

51

I rationalized if PRDX2 can indeed protect β-cells from oxidative stress,

overexpression of PRDX2 in β-cells should be able to prevent or ameliorate the damage

induced by oxidative stress and reduce the number of β-cell apoptosis or death under

oxidative stress conditions. To test this, PRDX2 or GFP was transiently overexpressed in

MIN6 cells by transfection of a vector encoding PRDX2. Following transfection, the cells

were then treated with proinflammatory cytokines, palmitic acid or STZ. Using western

blot analysis, immunocytochemistry, as well as FACS, it was found that the cells which

were transfected to elevate PRDX2 expression had significantly decreased apoptosis

and/or cell death when compared with cells which were transfected with GFP only (Fig.

7-14.)

Although the immunocytochemistry of apoptotic cells overexpressing GFP or

PRDX2 are not significant when treated with PA (Fig 8), it is showed that there is a trend

towards decreased number of apoptotic cells for the PRDX2 transfected group. Further

repetition of this experiment may yield significant results as in figures 11 and 14.

The western blot in figure 12 shows that when treated with STZ, PRDX2

expression actually increased in the GFP transfected group. This could be due to the fact

that the transfection itself is damaging to the β-cells, thus as proposed before, PRDX2

expression is up regulated as a coping mechanism. This inconsistency does not appear in

figures 7 and 10 because the β-cells were treated for 24 hours with cytokines or PA as

compared to 4 hours only with STZ in figure 12. Due to this difference in treatment time,

the STZ treated cells were allowed to incubate in medium containing 10% FBS for 19

hours longer than the other 2 groups after transfection. This protocol reflects the

52

experiments performed by Bast et al. and the results were similarly different from those

in figure 6.

There has been no previous literature directly linking PRDX2 to the prevention of

β-cell death through physiologically relevant methods, and as such, the mechanisms

involved in its beneficial effects are unclear. However, it has been shown in a recent

study that PRDX3 is able to prevent cytokine (IL-1β, TNF-α and IFN-γ) induced

apoptosis in β-cells through the inhibition of iNOS [131]. iNOS activation has been well

documented to be related to the activation of NF-κB [3]. In a recent study, Yang S. et al.

reported that PRDX2 is able to prevent apoptosis in granulosa cells through regulation of

the IκB and NF-κB pathway, [134], and it has been shown that PRDX2 has an inhibitory

effect on the Ras-ERK-NF-κB pathway since deletion of PRDX2 leads to Ras-ERK-NF-

κB activation [57]. It would be of interest to further investigate whether or not PRDX2

has a direct role in the regulation of the NF-κB pathway in β-cells.

Palmitic acid does not use the NF-κB/iNOS pathway to induce apoptosis in β-

cells but through the induction of oxidative ER stress [30]. It is unclear how PRDX2 is

able to inhibit palmitic acid induced apoptosis. It could be due to the clearance of ROS

produced in the ETC by PRDX2 to reduce the amount of stress placed on the ER which is

the driving force behind glucolipotoxicity of β-cells. PRDX4, which is only expressed in

the ER, has been found to protect cells from ER stress induced apoptosis through the

removal of H2O2 [123]. It is possible that PRDX2 is able to protect β-cells through a

similar mechanism.

It is conceivable that if PRDX2 indeed plays a role in the prevention of

proinflammatory cytokines and palmitic acid induced β-cell apoptosis or death, ablation

53

of PRDX2 should be able to abolish this protective effect. I thus performed experiments

to knockdown PRDX2 expression using transient transfection of siRNA in MIN6 cells.

These cells were then treated with the oxidative stress agents including proinflammatory

cytokines, palmitic acid and STZ. Immunoblot of protein harvested from the treated cells

showed that cleaved caspase 3 expression is increased in cells with PRDX2 knockdown

compared to scrambled siRNA controls, (Fig 15, 16) suggesting that a loss of PRDX2 in

β-cells increases and the numbers of β-cell apoptosis induced by cytokines, palmitic acid

and STZ. The β-cells with PRDX2 knockdown displayed increased β-cell apoptosis even

at basal levels. These results support the data in the overexpression experiments, and

suggest that PRDX2 is responsible for the protection of β-cells against oxidative stress

induced toxicity and apoptosis.

4.1 Conclusions

This study has shown that PRDX2 is expressed in the pancreatic β-cells and that

overexpression of PRDX2 in the pancreatic β-cell line MIN6 is able to decrease β-cell

apoptosis induced by oxidative stress stimulating agents such as proinflammatory

cytokines, palmitic acid, and streptozotocin. These results suggest that PRDX2 plays a

protective role in the pancreatic β-cells and it is able to enhance β-cell survival when

threatened with increased oxidative stress. To verify this assumption, PRDX2 was

knocked down in MIN6 cells. As shown, the protective effect seen in the overexpression

experiments was abolished under oxidative stress conditions. The ablation of PRDX2

also increased the β-cell apoptosis even under basal conditions. These results suggest that

54

PRDX2 is important for the survival of pancreatic β-cells during periods of oxidative

stress.

4.2 Future directions

With the current findings, PRDX2 is shown to attenuate toxicity in the β-cells.

The toxicity has been assumed to be from ROS induced stress. However, the amount of

oxidative stress brought on by these oxidative stress inducers has not been measured.

Therefore, one of the key experiments which should be performed is the measurement of

the production of ROS in the β-cells following treatment with oxidative stress inducers.

This could be accomplished through kits which use flourogenic probes to detect oxidative

stress within target cells using fluorescence microscopy [103]. This could better elucidate

the relationship between PRDX2 expression and regulation with the oxidative stress

experienced by the β-cells.

To further verify the overexpression and knockdown data, it would be of interest

to see if a rescue experiment involving overexpression of PRDX2 following knockdown

would be able to reduce the toxicity seen in the siRNA experiments.

PRDX3 and PRDX4 have been shown to be able to prevent β-cell apoptosis

through inhibiting the induction of iNOS and NF-kB in T1DM models. [36;131] A recent

study also showed that PRDX2 is able to inhibit granulosa cell apoptosis through

modulation of the NF-kB pathway [134]. This raises the possibility that PRDX2 could act

through the same pathway to protect β-cells from dysfunction and apoptosis. It would be

interesting to establish a signaling pathway, if any, in which PRDX2 can influence β-cell

survival and death.

55

Several studies in the past have linked the ability for PRDX1 to prevent apoptosis

with the apoptosis signal-regulating kinase (ASK-1) pathway. [42;70] A study by Hu X.

et al., published in 2011, found that PRDX2 is able to prevent apoptosis in dopaminergic

neurons in a Parkinson’s disease model through the ASK-1 pathway. [64] This opens up

the possibility that PRDX2 could potentially be acting through the ASK-1 pathway to

protect β-cells against apoptosis which are not caused by oxidative stress which would

explain figure 7, 10 and 12, where basal cleaved caspase-3 activity is reduced in PRDX2

overexpressed cells compared with control and figure 15-16 where basal cleaved caspase-

3 expression is increased in PRDX2 knockdown cells. ASK-1 activity is highly related to

thioredoxins [135] which raises the possibility that PRDX2 could affect ASK-1 activity

through thioredoxin. It would be of interest to elucidate if there are any relationships

between PRDX2 and the ASK-1 pathway in β-cells.

An in vivo model of PRDX2 overexpression localized to the β-cells with a tet-on

and Cre/loxP recombinant system could clarify the potential role of PRDX2 have during

the onset of T1DM and T2DM, and whether overexpression of PRDX2 could prevent or

reverse the loss of β-cell mass through amelioration of oxidative damage induced β-cell

apoptosis.

56

Chapter 5: Reference List

[1] , Prevalence of overweight and obesity among adults with diagnosed diabetes--United States, 1988-1994 and 1999-2002. MMWR Morb.Mortal.Wkly.Rep. %19;53 (2004) 1066-1068.

[2] J.D. Acharya, S.S. Ghaskadbi, Islets and their antioxidant defense. Islets. 2 (2010) 225-235.

[3] F. Aktan, iNOS-mediated nitric oxide production and its regulation. Life Sci. 75 (2004) 639-653.

[4] E. Araki, S. Oyadomari, M. Mori, Impact of endoplasmic reticulum stress pathway on pancreatic beta-cells and diabetes mellitus. Exp.Biol.Med.(Maywood.). 228 (2003) 1213-1217.

[5] A. Assmann, K. Ueki, J.N. Winnay, T. Kadowaki, R.N. Kulkarni, Glucose effects on beta-cell growth and survival require activation of insulin receptors and insulin receptor substrate 2. Mol.Cell Biol. 29 (2009) 3219-3228.

[6] A.K. Azevedo-Martins, S. Lortz, S. Lenzen, R. Curi, D.L. Eizirik, M. Tiedge, Improvement of the mitochondrial antioxidant defense status prevents cytokine-induced nuclear factor-kappaB activation in insulin-producing cells. Diabetes. 52 (2003) 93-101.

[7] J. Bass, J.S. Takahashi, Circadian rhythms: Redox redux. Nature. 469 (2011) 476-478.

[8] A. Bast, G. Wolf, I. Oberbaumer, R. Walther, Oxidative and nitrosative stress induces peroxiredoxins in pancreatic beta cells. Diabetologia. 45 (2002) 867-876.

[9] F.J. Bedoya, F. Solano, M. Lucas, N-monomethyl-arginine and nicotinamide prevent streptozotocin-induced double strand DNA break formation in pancreatic rat islets. Experientia. 52 (1996) 344-347.

[10] K.F. Bell, G.E. Hardingham, CNS peroxiredoxins and their regulation in health and disease. Antioxid.Redox.Signal. 14 (2011) 1467-1477.

[11] R.K. Benninger, M. Zhang, W.S. Head, L.S. Satin, D.W. Piston, Gap junction coupling and calcium waves in the pancreatic islet. Biophys.J. 95 (2008) 5048-5061.

[12] C. Bernard, M.F. Berthault, C. Saulnier, A. Ktorza, Neogenesis vs. apoptosis As main components of pancreatic beta cell ass changes in glucose-infused normal and mildly diabetic adult rats. FASEB J. 13 (1999) 1195-1205.

57

[13] N. Blume, J. Skouv, L.I. Larsson, J.J. Holst, O.D. Madsen, Potent inhibitory effects of transplantable rat glucagonomas and insulinomas on the respective endogenous islet cells are associated with pancreatic apoptosis. J.Clin.Invest. 96 (1995) 2227-2235.

[14] G. Boden, X. Chen, Effects of fatty acids and ketone bodies on basal insulin secretion in type 2 diabetes. Diabetes. 48 (1999) 577-583.

[15] M. Boni-Schnetzler, J.A. Ehses, M. Faulenbach, M.Y. Donath, Insulitis in type 2 diabetes. Diabetes Obes.Metab. 10 Suppl 4:201-4. (2008) 201-204.

[16] S. Bonner-Weir, D. Deery, J.L. Leahy, G.C. Weir, Compensatory growth of pancreatic beta-cells in adult rats after short-term glucose infusion. Diabetes. 38 (1989) 49-53.

[17] M. Brownlee, Biochemistry and molecular cell biology of diabetic complications. Nature. 414 (2001) 813-820.

[18] P.L. Brubaker, D.J. Drucker, Minireview: Glucagon-like peptides regulate cell proliferation and apoptosis in the pancreas, gut, and central nervous system. Endocrinology. 145 (2004) 2653-2659.

[19] J.C. Bruning, J. Winnay, S. Bonner-Weir, S.I. Taylor, D. Accili, C.R. Kahn, Development of a novel polygenic model of NIDDM in mice heterozygous for IR and IRS-1 null alleles. Cell. 88 (1997) 561-572.

[20] O. Cabrera, D.M. Berman, N.S. Kenyon, C. Ricordi, P.O. Berggren, A. Caicedo, The unique cytoarchitecture of human pancreatic islets has implications for islet cell function. Proc.Natl.Acad.Sci.U.S.A. 103 (2006) 2334-2339.

[21] J. Cao, J. Schulte, A. Knight, N.R. Leslie, A. Zagozdzon, R. Bronson, Y. Manevich, C. Beeson, C.A. Neumann, Prdx1 inhibits tumorigenesis via regulating PTEN/AKT activity. EMBO J. %20;28 (2009) 1505-1517.

[22] A.K. Cardozo, H. Heimberg, Y. Heremans, R. Leeman, B. Kutlu, M. Kruhoffer, T. Orntoft, D.L. Eizirik, A comprehensive analysis of cytokine-induced and nuclear factor-kappa B-dependent genes in primary rat pancreatic beta-cells. J.Biol.Chem. 276 (2001) 48879-48886.

[23] A. Carpentier, S.D. Mittelman, R.N. Bergman, A. Giacca, G.F. Lewis, Prolonged elevation of plasma free fatty acids impairs pancreatic beta-cell function in obese nondiabetic humans but not in individuals with type 2 diabetes. Diabetes. 49 (2000) 399-408.

[24] A. Carpentier, S.D. Mittelman, B. Lamarche, R.N. Bergman, A. Giacca, G.F. Lewis, Acute enhancement of insulin secretion by FFA in humans is lost with prolonged FFA elevation. Am.J.Physiol. 276 (1999) E1055-E1066.

58

[25] J.W. Chang, S.H. Lee, J.Y. Jeong, H.Z. Chae, Y.C. Kim, Z.Y. Park, Y.J. Yoo, Peroxiredoxin-I is an autoimmunogenic tumor antigen in non-small cell lung cancer. FEBS Lett. 579 (2005) 2873-2877.

[26] H. Chen, E.C. Carlson, L. Pellet, J.T. Moritz, P.N. Epstein, Overexpression of metallothionein in pancreatic beta-cells reduces streptozotocin-induced DNA damage and diabetes. Diabetes. 50 (2001) 2040-2046.

[27] M.F. Chen, K.D. Lee, C.H. Yeh, W.C. Chen, W.S. Huang, C.C. Chin, P.Y. Lin, J.Y. Wang, Role of peroxiredoxin I in rectal cancer and related to p53 status. Int.J.Radiat.Oncol.Biol.Phys. 78 (2010) 868-878.

[28] J.H. Choi, T.N. Kim, S. Kim, S.H. Baek, J.H. Kim, S.R. Lee, J.R. Kim, Overexpression of mitochondrial thioredoxin reductase and peroxiredoxin III in hepatocellular carcinomas. Anticancer Res. 22 (2002) 3331-3335.

[29] D.H. Chou, N.E. Bodycombe, H.A. Carrinski, T.A. Lewis, P.A. Clemons, S.L. Schreiber, B.K. Wagner, Small-Molecule Suppressors of Cytokine-Induced beta-Cell Apoptosis. ACS Chem.Biol. %20;5 (2010) 729-734.

[30] M. Cnop, Fatty acids and glucolipotoxicity in the pathogenesis of Type 2 diabetes. Biochem.Soc.Trans. 36 (2008) 348-352.

[31] P. Collombat, X. Xu, H. Heimberg, A. Mansouri, Pancreatic beta-cells: from generation to regeneration. Semin.Cell Dev.Biol. 21 (2010) 838-844.

[32] I. Cozar-Castellano, K.K. Takane, R. Bottino, A.N. Balamurugan, A.F. Stewart, Induction of beta-cell proliferation and retinoblastoma protein phosphorylation in rat and human islets using adenovirus-mediated transfer of cyclin-dependent kinase-4 and cyclin D1. Diabetes. 53 (2004) 149-159.

[33] T.R. Csorba, A.W. Lyon, M.D. Hollenberg, Autoimmunity and the pathogenesis of type 1 diabetes. Crit Rev.Clin.Lab Sci. 47 (2010) 51-71.

[34] S. Dhayal, H.J. Welters, N.G. Morgan, Structural requirements for the cytoprotective actions of mono-unsaturated fatty acids in the pancreatic beta-cell line, BRIN-BD11. Br.J.Pharmacol. 153 (2008) 1718-1727.

[35] C.A. Dinarello, M.Y. Donath, T. Mandrup-Poulsen, Role of IL-1beta in type 2 diabetes. Curr.Opin.Endocrinol.Diabetes Obes. 17 (2010) 314-321.

[36] Y. Ding, S. Yamada, K.Y. Wang, S. Shimajiri, X. Guo, A. Tanimoto, Y. Murata, S. Kitajima, T. Watanabe, H. Izumi, K. Kohno, Y. Sasaguri, Overexpression of peroxiredoxin 4 protects against high-dose streptozotocin-induced diabetes by suppressing oxidative stress and cytokines in transgenic mice. Antioxid.Redox.Signal. 13 (2010) 1477-1490.

59

[37] M.Y. Donath, D.J. Gross, E. Cerasi, N. Kaiser, Hyperglycemia-induced beta-cell apoptosis in pancreatic islets of Psammomys obesus during development of diabetes. Diabetes. 48 (1999) 738-744.

[38] Y. Dor, J. Brown, O.I. Martinez, D.A. Melton, Adult pancreatic beta-cells are formed by self-duplication rather than stem-cell differentiation. Nature. 429 (2004) 41-46.

[39] M.E. Doyle, J.M. Egan, Mechanisms of action of glucagon-like peptide 1 in the pancreas. Pharmacol.Ther. 113 (2007) 546-593.

[40] G. Drews, P. Krippeit-Drews, M. Dufer, Oxidative stress and beta-cell dysfunction. Pflugers Arch. 460 (2010) 703-718.

[41] W. Droge, Free radicals in the physiological control of cell function. Physiol Rev. 82 (2002) 47-95.

[42] Z.X. Du, Y. Yan, H.Y. Zhang, B.Q. Liu, Y.Y. Gao, X.F. Niu, Y. Guan, X. Meng, H.Q. Wang, Suppression of MG132-mediated cell death by peroxiredoxin 1 through influence on ASK1 activation in human thyroid cancer cells. Endocr.Relat Cancer. 17 (2010) 553-560.

[43] N.L. Dudek, H.E. Thomas, L. Mariana, R.M. Sutherland, J. Allison, E. Estella, E. Angstetra, J.A. Trapani, P. Santamaria, A.M. Lew, T.W. Kay, Cytotoxic T-cells from T-cell receptor transgenic NOD8.3 mice destroy beta-cells via the perforin and Fas pathways. Diabetes. 55 (2006) 2412-2418.

[44] D.L. Eizirik, T. Mandrup-Poulsen, A choice of death--the signal-transduction of immune-mediated beta-cell apoptosis. Diabetologia. 44 (2001) 2115-2133.

[45] A.A. Elayat, M.M. el-Naggar, M. Tahir, An immunocytochemical and morphometric study of the rat pancreatic islets. J.Anat. 186 (1995) 629-637.

[46] M. Elsner, W. Gehrmann, S. Lenzen, Peroxisome-generated hydrogen peroxide as important mediator of lipotoxicity in insulin-producing cells. Diabetes. 60 (2011) 200-208.

[47] G. Fontes, B. Zarrouki, D.K. Hagman, M.G. Latour, M. Semache, V. Roskens, P.C. Moore, M. Prentki, C.J. Rhodes, T.L. Jetton, V. Poitout, Glucolipotoxicity age-dependently impairs beta cell function in rats despite a marked increase in beta cell mass. Diabetologia. 53 (2010) 2369-2379.

[48] I. Fridovich, Superoxide anion radical (O2-.), superoxide dismutases, and related matters. J.Biol.Chem. 272 (1997) 18515-18517.

[49] B.N. Friedrichsen, N. Neubauer, Y.C. Lee, V.K. Gram, N. Blume, J.S. Petersen, J.H. Nielsen, A. Moldrup, Stimulation of pancreatic beta-cell replication by

60

incretins involves transcriptional induction of cyclin D1 via multiple signalling pathways. J.Endocrinol. 188 (2006) 481-492.

[50] W. Gehrmann, M. Elsner, S. Lenzen, Role of metabolically generated reactive oxygen species for lipotoxicity in pancreatic beta-cells. Diabetes Obes.Metab. 12 Suppl 2:149-58. doi: 10.1111/j.1463-1326.2010.01265.x. (2010) 149-158.

[51] W. Gehrmann, M. Elsner, S. Lenzen, Role of metabolically generated reactive oxygen species for lipotoxicity in pancreatic beta-cells. Diabetes Obes.Metab. 12 Suppl 2:149-58. doi: 10.1111/j.1463-1326.2010.01265.x. (2010) 149-158.

[52] A. Ghiselli, O. Laurenti, M.G. De, G. Maiani, A. Ferro-Luzzi, Salicylate hydroxylation as an early marker of in vivo oxidative stress in diabetic patients. Free Radic.Biol.Med. 13 (1992) 621-626.

[53] Gordon ES., Non-esterified fatty acids in the blood of obese and lean subjects. American Journal of Clinical Nutrtion 8 (1960) 740-747.

[54] V. Grill, E. Qvigstad, Fatty acids and insulin secretion. Br.J.Nutr. 83 Suppl 1:S79-84. (2000) S79-S84.

[55] R.K. Gupta, N. Gao, R.K. Gorski, P. White, O.T. Hardy, K. Rafiq, J.E. Brestelli, G. Chen, C.J. Stoeckert, Jr., K.H. Kaestner, Expansion of adult beta-cell mass in response to increased metabolic demand is dependent on HNF-4alpha. Genes Dev. 21 (2007) 756-769.

[56] E. Gurgul-Convey, I. Mehmeti, S. Lortz, S. Lenzen, Cytokine toxicity in insulin-producing cells is mediated by nitro-oxidative stress-induced hydroxyl radical formation in mitochondria. J.Mol.Med.2011).

[57] Y.H. Han, J.H. Kwon, D.Y. Yu, E.Y. Moon, Inhibitory effect of peroxiredoxin II (Prx II) on Ras-ERK-NFkappaB pathway in mouse embryonic fibroblast (MEF) senescence. Free Radic.Res. 40 (2006) 1182-1189.

[58] V. Haridas, J. Ni, A. Meager, J. Su, G.L. Yu, Y. Zhai, H. Kyaw, K.T. Akama, J. Hu, L.J. Van Eldik, B.B. Aggarwal, TRANK, a novel cytokine that activates NF-kappa B and c-Jun N-terminal kinase. J.Immunol. 161 (1998) 1-6.

[59] J.R. Harris, E. Schroder, M.N. Isupov, D. Scheffler, P. Kristensen, J.A. Littlechild, A.A. Vagin, U. Meissner, Comparison of the decameric structure of peroxiredoxin-II by transmission electron microscopy and X-ray crystallography. Biochim.Biophys.Acta. 1547 (2001) 221-234.

[60] K. Haskins, B. Bradley, K. Powers, V. Fadok, S. Flores, X. Ling, S. Pugazhenthi, J. Reusch, J. Kench, Oxidative stress in type 1 diabetes. Ann.N.Y.Acad.Sci. 1005:43-54. (2003) 43-54.

61

[61] F. Hattori, S. Oikawa, Peroxiredoxins in the central nervous system. Subcell.Biochem. 44:357-74. (2007) 357-374.

[62] M.P. Holt, L. Cheng, C. Ju, Identification and characterization of infiltrating macrophages in acetaminophen-induced liver injury. J.Leukoc.Biol. 84 (2008) 1410-1421.

[63] A. Hoorens, M. Van de Casteele, G. Kloppel, D. Pipeleers, Glucose promotes survival of rat pancreatic beta cells by activating synthesis of proteins which suppress a constitutive apoptotic program. J.Clin.Invest. 98 (1996) 1568-1574.

[64] X. Hu, Z. Weng, C.T. Chu, L. Zhang, G. Cao, Y. Gao, A. Signore, J. Zhu, T. Hastings, J.T. Greenamyre, J. Chen, Peroxiredoxin-2 protects against 6-hydroxydopamine-induced dopaminergic neurodegeneration via attenuation of the apoptosis signal-regulating kinase (ASK1) signaling cascade. J.Neurosci. 31 (2011) 247-261.

[65] H. Hui, C. Wright, R. Perfetti, Glucagon-like peptide 1 induces differentiation of islet duodenal homeobox-1-positive pancreatic ductal cells into insulin-secreting cells. Diabetes. 50 (2001) 785-796.

[66] H. Ishihara, T. Asano, K. Tsukuda, H. Katagiri, K. Inukai, M. Anai, M. Kikuchi, Y. Yazaki, J.I. Miyazaki, Y. Oka, Pancreatic beta cell line MIN6 exhibits characteristics of glucose metabolism and glucose-stimulated insulin secretion similar to those of normal islets. Diabetologia. 36 (1993) 1139-1145.

[67] K. Kikuta, N. Tochigi, S. Saito, T. Shimoda, H. Morioka, Y. Toyama, A. Hosono, Y. Suehara, Y. Beppu, A. Kawai, S. Hirohashi, T. Kondo, Peroxiredoxin 2 as a chemotherapy responsiveness biomarker candidate in osteosarcoma revealed by proteomics. Proteomics.Clin.Appl. 4 (2010) 560-567.

[68] H.S. Kim, M.S. Lee, Role of innate immunity in triggering and tuning of autoimmune diabetes. Curr.Mol.Med. 9 (2009) 30-44.

[69] M.J. Kim, J.H. Kang, Y.G. Park, G.R. Ryu, S.H. Ko, I.K. Jeong, K.H. Koh, D.J. Rhie, S.H. Yoon, S.J. Hahn, M.S. Kim, Y.H. Jo, Exendin-4 induction of cyclin D1 expression in INS-1 beta-cells: involvement of cAMP-responsive element. J.Endocrinol. 188 (2006) 623-633.

[70] S.Y. Kim, T.J. Kim, K.Y. Lee, A novel function of peroxiredoxin 1 (Prx-1) in apoptosis signal-regulating kinase 1 (ASK1)-mediated signaling pathway. FEBS Lett. 582 (2008) 1913-1918.

[71] V.L. Kinnula, S. Lehtonen, R. Kaarteenaho-Wiik, E. Lakari, P. Paakko, S.W. Kang, S.G. Rhee, Y. Soini, Cell specific expression of peroxiredoxins in human lung and pulmonary sarcoidosis. Thorax. 57 (2002) 157-164.

62

[72] J.M. Lawrence, R. Contreras, W. Chen, D.A. Sacks, Trends in the prevalence of preexisting diabetes and gestational diabetes mellitus among a racially/ethnically diverse population of pregnant women, 1999-2005. Diabetes Care. 31 (2008) 899-904.

[73] Y.C. Lee, J.H. Nielsen, Regulation of beta cell replication. Mol.Cell Endocrinol. 297 (2009) 18-27.

[74] S. Lenzen, J. Drinkgern, M. Tiedge, Low antioxidant enzyme gene expression in pancreatic islets compared with various other mouse tissues. Free Radic.Biol.Med. 20 (1996) 463-466.

[75] N. Leung, T. Sakaue, A. Carpentier, K. Uffelman, A. Giacca, G.F. Lewis, Prolonged increase of plasma non-esterified fatty acids fully abolishes the stimulatory effect of 24 hours of moderate hyperglycaemia on insulin sensitivity and pancreatic beta-cell function in obese men. Diabetologia. 47 (2004) 204-213.

[76] F. Li, R.I. Mahato, iNOS gene silencing prevents inflammatory cytokine-induced beta-cell apoptosis. Mol.Pharm. 5 (2008) 407-417.

[77] Y.S. Lim, M.K. Cha, C.H. Yun, H.K. Kim, K. Kim, I.H. Kim, Purification and characterization of thiol-specific antioxidant protein from human red blood cell: a new type of antioxidant protein. Biochem.Biophys.Res.Commun. 199 (1994) 199-206.

[78] A.J. Link, K. Robison, G.M. Church, Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis. 18 (1997) 1259-1313.

[79] F.M. Low, M.B. Hampton, C.C. Winterbourn, Peroxiredoxin 2 and peroxide metabolism in the erythrocyte. Antioxid.Redox.Signal. 10 (2008) 1621-1630.

[80] R. Lupi, P.S. Del, Beta-cell apoptosis in type 2 diabetes: quantitative and functional consequences. Diabetes Metab. 34 Suppl 2:S56-64. (2008) S56-S64.

[81] K. Maedler, P. Sergeev, F. Ris, J. Oberholzer, H.I. Joller-Jemelka, G.A. Spinas, N. Kaiser, P.A. Halban, M.Y. Donath, Glucose-induced beta cell production of IL-1beta contributes to glucotoxicity in human pancreatic islets. J.Clin.Invest. 110 (2002) 851-860.

[82] M. Manczak, P. Mao, M.J. Calkins, A. Cornea, A.P. Reddy, M.P. Murphy, H.H. Szeto, B. Park, P.H. Reddy, Mitochondria-targeted antioxidants protect against amyloid-beta toxicity in Alzheimer's disease neurons. J.Alzheimers.Dis. 20 Suppl 2:S609-31. (2010) S609-S631.

[83] T. Mandrup-Poulsen, Beta cell death and protection. Ann.N.Y.Acad.Sci. 1005:32-42. (2003) 32-42.

63

[84] J. Martin, S.L. Hunt, P. Dubus, R. Sotillo, F. Nehme-Pelluard, M.A. Magnuson, A.F. Parlow, M. Malumbres, S. Ortega, M. Barbacid, Genetic rescue of Cdk4 null mice restores pancreatic beta-cell proliferation but not homeostatic cell number. Oncogene. 22 (2003) 5261-5269.

[85] A. Matsumoto, A. Okado, T. Fujii, J. Fujii, M. Egashira, N. Niikawa, N. Taniguchi, Cloning of the peroxiredoxin gene family in rats and characterization of the fourth member. FEBS Lett. 443 (1999) 246-250.

[86] A. Matte, P.S. Low, F. Turrini, M. Bertoldi, M.E. Campanella, D. Spano, A. Pantaleo, A. Siciliano, F.L. De, Peroxiredoxin-2 expression is increased in beta-thalassemic mouse red cells but is displaced from the membrane as a marker of oxidative stress. Free Radic.Biol.Med. 49 (2010) 457-466.

[87] J.J. Meier, A.E. Butler, Y. Saisho, T. Monchamp, R. Galasso, A. Bhushan, R.A. Rizza, P.C. Butler, Beta-cell replication is the primary mechanism subserving the postnatal expansion of beta-cell mass in humans. Diabetes. 57 (2008) 1584-1594.

[88] R.B. Moore, G.A. Plishker, S.K. Shriver, Purification and measurement of calpromotin, the cytoplasmic protein which activates calcium-dependent potassium transport. Biochem.Biophys.Res.Commun. 166 (1990) 146-153.

[89] C.A. Neumann, Q. Fang, Are peroxiredoxins tumor suppressors? Curr.Opin.Pharmacol. 7 (2007) 375-380.

[90] T.J. Nevalainen, 1-Cysteine peroxiredoxin: A dual-function enzyme with peroxidase and acidic Ca2+-independent phospholipase A2 activities. Biochimie. 92 (2010) 638-644.

[91] P. Newsholme, D. Keane, H.J. Welters, N.G. Morgan, Life and death decisions of the pancreatic beta-cell: the role of fatty acids. Clin.Sci.(Lond). 112 (2007) 27-42.

[92] J.H. Nielsen, E.D. Galsgaard, A. Moldrup, B.N. Friedrichsen, N. Billestrup, J.A. Hansen, Y.C. Lee, C. Carlsson, Regulation of beta-cell mass by hormones and growth factors. Diabetes. 50 Suppl 1:S25-9. (2001) S25-S29.

[93] T. Nishikawa, D. Edelstein, X.L. Du, S. Yamagishi, T. Matsumura, Y. Kaneda, M.A. Yorek, D. Beebe, P.J. Oates, H.P. Hammes, I. Giardino, M. Brownlee, Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage. Nature. 404 (2000) 787-790.

[94] J. Nourooz-Zadeh, J. Tajaddini-Sarmadi, S. McCarthy, D.J. Betteridge, S.P. Wolff, Elevated levels of authentic plasma hydroperoxides in NIDDM. Diabetes. 44 (1995) 1054-1058.

[95] M. Nukatsuka, H. Sakurai, Y. Yoshimura, M. Nishida, J. Kawada, Enhancement by streptozotocin of O2- radical generation by the xanthine oxidase system of pancreatic beta-cells. FEBS Lett. 239 (1988) 295-298.

64

[96] J. Ogino, K. Sakurai, K. Yoshiwara, Y. Suzuki, N. Ishizuka, N. Seki, Y. Suzuki, H. Koseki, T. Shirasawa, N. Hashimoto, K. Yagui, Y. Saito, Insulin resistance and increased pancreatic beta-cell proliferation in mice expressing a mutant insulin receptor (P1195L). J.Endocrinol. 190 (2006) 739-747.

[97] T. Okada, C.W. Liew, J. Hu, C. Hinault, M.D. Michael, J. Krtzfeldt, C. Yin, M. Holzenberger, M. Stoffel, R.N. Kulkarni, Insulin receptors in beta-cells are critical for islet compensatory growth response to insulin resistance. Proc.Natl.Acad.Sci.U.S.A. 104 (2007) 8977-8982.

[98] K. Otani, R.N. Kulkarni, A.C. Baldwin, J. Krutzfeldt, K. Ueki, M. Stoffel, C.R. Kahn, K.S. Polonsky, Reduced beta-cell mass and altered glucose sensing impair insulin-secretory function in betaIRKO mice. Am.J.Physiol Endocrinol.Metab. 286 (2004) E41-E49.

[99] M. Paris, C. Bernard-Kargar, M.F. Berthault, L. Bouwens, A. Ktorza, Specific and combined effects of insulin and glucose on functional pancreatic beta-cell mass in vivo in adult rats. Endocrinology. 144 (2003) 2717-2727.

[100] V. Poitout, J. Amyot, M. Semache, B. Zarrouki, D. Hagman, G. Fontes, Glucolipotoxicity of the pancreatic beta cell. Biochim.Biophys.Acta. 1801 (2010) 289-298.

[101] V. Poitout, R.P. Robertson, Minireview: Secondary beta-cell failure in type 2 diabetes--a convergence of glucotoxicity and lipotoxicity. Endocrinology. 143 (2002) 339-342.

[102] M. Prentki, C.J. Nolan, Islet beta cell failure in type 2 diabetes. J.Clin.Invest. 116 (2006) 1802-1812.

[103] M. Price, J.J. Reiners, A.M. Santiago, D. Kessel, Monitoring singlet oxygen and hydroxyl radical formation with fluorescent probes during photodynamic therapy. Photochem.Photobiol. 85 (2009) 1177-1181.

[104] A. Rabinovitch, W.L. Suarez-Pinzon, O. Sorensen, R.C. Bleackley, Inducible nitric oxide synthase (iNOS) in pancreatic islets of nonobese diabetic mice: identification of iNOS- expressing cells and relationships to cytokines expressed in the islets. Endocrinology. 137 (1996) 2093-2099.

[105] A. Rabinovitch, W.L. Suarez-Pinzon, K. Strynadka, J.R. Lakey, R.V. Rajotte, Human pancreatic islet beta-cell destruction by cytokines involves oxygen free radicals and aldehyde production. J.Clin.Endocrinol.Metab. 81 (1996) 3197-3202.

[106] S.G. Rane, P. Dubus, R.V. Mettus, E.J. Galbreath, G. Boden, E.P. Reddy, M. Barbacid, Loss of Cdk4 expression causes insulin-deficient diabetes and Cdk4 activation results in beta-islet cell hyperplasia. Nat.Genet. 22 (1999) 44-52.

65

[107] C.J. Rhodes, Type 2 diabetes-a matter of beta-cell life and death? Science. 307 (2005) 380-384.

[108] R.P. Robertson, J.S. Harmon, Diabetes, glucose toxicity, and oxidative stress: A case of double jeopardy for the pancreatic islet beta cell. Free Radic.Biol.Med. 41 (2006) 177-184.

[109] M.W. Robinson, A.T. Hutchinson, J.P. Dalton, S. Donnelly, Peroxiredoxin: a central player in immune modulation. Parasite Immunol. 32 (2010) 305-313.

[110] H. Sakuraba, H. Mizukami, N. Yagihashi, R. Wada, C. Hanyu, S. Yagihashi, Reduced beta-cell mass and expression of oxidative stress-related DNA damage in the islet of Japanese Type II diabetic patients. Diabetologia. 45 (2002) 85-96.

[111] S. Schnell, M. Schaefer, C. Schofl, Free fatty acids increase cytosolic free calcium and stimulate insulin secretion from beta-cells through activation of GPR40. Mol.Cell Endocrinol. 263 (2007) 173-180.

[112] P. Schonfeld, L. Wojtczak, Fatty acids as modulators of the cellular production of reactive oxygen species. Free Radic.Biol.Med. 45 (2008) 231-241.

[113] B. Schremmer, Y. Manevich, S.I. Feinstein, A.B. Fisher, Peroxiredoxins in the lung with emphasis on peroxiredoxin VI. Subcell.Biochem. 44:317-44. (2007) 317-344.

[114] D.P. Schuster, V. Duvuuri, Diabetes mellitus. Clin.Podiatr.Med.Surg. 19 (2002) 79-107.

[115] P. Serup, J.H. Nielsen, Development and life cycle of a beta cell, in: DeFronzo RA, Ferrannini E, Keen H, and Zimmet P (Eds.), International Textbook of Diabetes Mellitus, John Wiley & Sons, Chichester, 2004, pp. 59-78.

[116] H. Shau, L.H. Butterfield, R. Chiu, A. Kim, Cloning and sequence analysis of candidate human natural killer-enhancing factor genes. Immunogenetics. 40 (1994) 129-134.

[117] H. Shau, R.K. Gupta, S.H. Golub, Identification of a natural killer enhancing factor (NKEF) from human erythroid cells. Cell Immunol. 147 (1993) 1-11.

[118] W.I. Sivitz, M.A. Yorek, Mitochondrial dysfunction in diabetes: from molecular mechanisms to functional significance and therapeutic opportunities. Antioxid.Redox.Signal. 12 (2010) 537-577.

[119] D.A. Stoffers, T.J. Kieffer, M.A. Hussain, D.J. Drucker, S. Bonner-Weir, J.F. Habener, J.M. Egan, Insulinotropic glucagon-like peptide 1 agonists stimulate expression of homeodomain protein IDX-1 and increase islet size in mouse pancreas. Diabetes. 49 (2000) 741-748.

66

[120] W. Sumoski, H. Baquerizo, A. Rabinovitch, Oxygen free radical scavengers protect rat islet cells from damage by cytokines. Diabetologia. 32 (1989) 792-796.

[121] G. Szabadkai, M.R. Duchen, Mitochondria mediated cell death in diabetes. Apoptosis. 14 (2009) 1405-1423.

[122] N. Takasu, I. Komiya, T. Asawa, Y. Nagasawa, T. Yamada, Streptozocin- and alloxan-induced H2O2 generation and DNA fragmentation in pancreatic islets. H2O2 as mediator for DNA fragmentation. Diabetes. 40 (1991) 1141-1145.

[123] T.J. Tavender, N.J. Bulleid, Peroxiredoxin IV protects cells from oxidative stress by removing H2O2 produced during disulphide formation. J.Cell Sci. 123 (2010) 2672-2679.

[124] H.E. Thomas, M.D. McKenzie, E. Angstetra, P.D. Campbell, T.W. Kay, Beta cell apoptosis in diabetes. Apoptosis. 14 (2009) 1389-1404.

[125] Tjälve H, Streptozotocin: distribution, metabolism and mechanisms of action. Uppsala J.Med.Sci.Suppl. 39 (1983) 145-157.

[126] B.G. Topp, M.D. McArthur, D.T. Finegood, Metabolic adaptations to chronic glucose infusion in rats. Diabetologia. 47 (2004) 1602-1610.

[127] T. Tsutsui, B. Hesabi, D.S. Moons, P.P. Pandolfi, K.S. Hansel, A. Koff, H. Kiyokawa, Targeted disruption of CDK4 delays cell cycle entry with enhanced p27(Kip1) activity. Mol.Cell Biol. 19 (1999) 7011-7019.

[128] Q. Wang, P.L. Brubaker, Glucagon-like peptide-1 treatment delays the onset of diabetes in 8 week-old db/db mice. Diabetologia. 45 (2002) 1263-1273.

[129] C. Weyer, C. Bogardus, D.M. Mott, R.E. Pratley, The natural history of insulin secretory dysfunction and insulin resistance in the pathogenesis of type 2 diabetes mellitus. J.Clin.Invest. 104 (1999) 787-794.

[130] S. Wild, G. Roglic, A. Green, R. Sicree, H. King, Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care. 27 (2004) 1047-1053.

[131] G. Wolf, N. Aumann, M. Michalska, A. Bast, J. Sonnemann, J.F. Beck, U. Lendeckel, P. Newsholme, R. Walther, Peroxiredoxin III protects pancreatic ss cells from apoptosis. J.Endocrinol. 207 (2010) 163-175.

[132] Z.A. Wood, E. Schroder, H.J. Robin, L.B. Poole, Structure, mechanism and regulation of peroxiredoxins. Trends Biochem.Sci. 28 (2003) 32-40.

[133] J. Xu, L. Zhang, A. Chou, T. Allaby, G. Belanger, J. Radziuk, B.J. Jasmin, T. Miki, S. Seino, J.M. Renaud, KATP channel-deficient pancreatic beta-cells are

67

68

streptozotocin resistant because of lower GLUT2 activity. Am.J.Physiol Endocrinol.Metab. 294 (2008) E326-E335.

[134] S. Yang, A. Luo, X. Hao, Z. Lai, T. Ding, X. Ma, M. Mayinuer, W. Shen, X. Wang, Y. Lu, D. Ma, S. Wang, Peroxiredoxin 2 Inhibits Granulosa Cell Apoptosis During Follicle Atresia Through the NFKB Pathway in Mice. Biol.Reprod. %19. (2011).

[135] J. Yoshioka, E.R. Schreiter, R.T. Lee, Role of thioredoxin in cell growth through interactions with signaling molecules. Antioxid.Redox.Signal. 8 (2006) 2143-2151.

[136] B. Zhang, Y. Wang, Y. Su, Peroxiredoxins, a novel target in cancer radiotherapy. Cancer Lett. 286 (2009) 154-160.

[137] L. Zhang, G. Perdomo, D.H. Kim, S. Qu, S. Ringquist, M. Trucco, H.H. Dong, Proteomic analysis of fructose-induced fatty liver in hamsters. Metabolism. 57 (2008) 1115-1124.

[138] J. Zhou, X. Wang, M.A. Pineyro, J.M. Egan, Glucagon-like peptide 1 and exendin-4 convert pancreatic AR42J cells into glucagon- and insulin-producing cells. Diabetes. 48 (1999) 2358-2366.

[139] Y.P. Zhou, V.E. Grill, Long-term exposure of rat pancreatic islets to fatty acids inhibits glucose-induced insulin secretion and biosynthesis through a glucose fatty acid cycle. J.Clin.Invest. 93 (1994) 870-876.