Journal of Cell Science Accepted manuscript · macrophages, suggesting a role for PrP in innate...

Click here to load reader

  • date post

    22-May-2020
  • Category

    Documents

  • view

    3
  • download

    0

Embed Size (px)

Transcript of Journal of Cell Science Accepted manuscript · macrophages, suggesting a role for PrP in innate...

  • © 2015. Published by The Company of Biologists Ltd.

    The prion protein inhibits monocytic cell migration by stimulating β1 integrin

    adhesion and uropod formation

    Dion D Richardson*1, Simon Tol*1, Eider Valle-Encinas1, Cayetano Pleguezuelos1,

    Ruben Bierings2, Dirk Geerts3 and Mar Fernandez-Borja1

    (1) Department of Molecular Cell Biology and (2) Department of Plasma Proteins,

    Sanquin Research and Landsteiner Laboratory, Academic Medical Center, University

    of Amsterdam, Amsterdam, The Netherlands; (3) Department of Pediatric

    Oncology/Hematology, Erasmus University Medical Center, Rotterdam, The

    Netherlands

    * Equal contribution

    Correspondence: Mar Fernandez-Borja, Department of Molecular Cell Biology,

    Sanquin Research, Plesmanlaan 125, 1066CX Amsterdam, The Netherlands; phone:

    +3120-5121220; e-mail: [email protected]

    Keywords: Prion protein, monocyte, migration, adhesion, RhoA, ERM

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

    JCS Advance Online Article. Posted on 9 July 2015

    mailto:[email protected]

  • Abstract

    The broad tissue distribution and evolutionary conservation of the GPI-anchored

    protein PrP suggests that it plays a role in cellular homeostasis. Since integrin

    adhesion determines cell behavior, the proposed role of PrP in cell adhesion may

    underlie the various in vitro and in vivo effects associated to PrP loss-of-function,

    including the immune phenotypes described in PrP-/- mice. We have investigated the

    role of PrP in the adhesion and (transendothelial) migration of human (pro)monocytes.

    We found that PrP regulates 1 integrin-mediated adhesion of monocytes.

    Additionally, PrP controls cell morphology and migratory behavior of monocytes:

    PrP-silenced cells show deficient uropod formation on immobilized VCAM and

    display bleb-like protrusions on the endothelium. Our data further show that PrP

    regulates ligand-induced integrin activation. Finally, we found that PrP controls the

    activation of several proteins involved in cell adhesion and migration, including RhoA

    and its effector cofilin as well as proteins of the ERM family. We propose that PrP

    modulates 1 integrin adhesion and migration of monocytes through RhoA-induced

    actin remodeling by cofilin and through the regulation of ERM-mediated membrane-

    cytoskeleton linkage.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Introduction

    The cellular prion protein (PrP) is a glycosyl-phosphatidyl-inositol-anchored

    glycoprotein that resides in detergent-resistant membrane domains. The conversion of

    PrP to a misfolded insoluble isoform (PrP Scrapie) is at the onset of

    neurodegenerative disorders known as transmissible spongiform encephalopathies

    (Colby and Prusiner, 2011). However, its physiological function is largely unclear

    (Biasini et al., 2012), having been involved in multiple cellular processes such as

    survival, apoptosis, differentiation and growth (Linden et al., 2008). This variety of

    functions together with the high evolutionary conservation and wide tissue expression

    of PrP suggest that this protein has a role in cellular homeostasis.

    PrP is highly expressed in the hematopoietic system, particularly in hematopoietic

    stem cells and in mature mononuclear leukocytes (Isaacs et al., 2006). Accordingly,

    PrP has been reported to have a role in several hematopoietic and immune cell

    functions in vivo, such as the self-renewal of long-term repopulating hematopoietic-

    stem cells (Kent et al., 2009; Zhang et al., 2006), macrophage phagocytosis (de

    Almeida et al., 2005) and T-cell activation (Ballerini et al., 2006). However, the role

    of PrP in the innate immune response has hardly been explored with the exception of

    one study in which peritonitis was induced in PrP-/- mice with zymosan (de Almeida

    et al., 2005). PrP-/- mice showed decreased numbers of neutrophils and larger numbers

    of monocytes in peritoneal infiltrates. Although the basis for this phenotype was not

    investigated, one possibility is that PrP has an intrinsic role in leukocyte migration out

    of the circulation and/or into the peritoneum. In addition, several in vivo and in vitro

    studies have shown that PrP participates in the regulation of cell-cell (Malaga-Trillo et

    al., 2009; Mange et al., 2002; Morel et al., 2008) and cell-matrix adhesion (Loubet et

    al., 2012; Schrock et al., 2009).

    Leukocyte extravasation takes place through the binding of cytokine-activated

    leukocytes to the endothelium, followed by their migration across the endothelium

    and subsequently the vascular basement membrane (Nourshargh et al., 2010).

    Leukocyte integrin binding to endothelial ICAM-1 and VCAM-1 receptors is crucial

    for leukocyte arrest and firm adhesion to the endothelium, allowing leukocytes to

    resist flow-induced detachment. This requires integrin clustering upon ligand binding

    to increase avidity and strengthen adhesiveness through integrin association with the

    actin cytoskeleton via adapter proteins (Alon et al., 2005). Migrating leukocytes

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • polarize into a leading edge and a uropod. The uropod is an adhesive structure

    containing cholesterol-rich membrane domains, 1 integrins and other adhesion

    receptors (i.e. ICAM-1 and -3) as well as actin-membrane linker proteins of the ERM

    (ezrin-radixin-moesin) family (Friedl and Weigelin, 2008). To migrate, leukocytes

    need to detach and retract their uropod, a process regulated by the small GTPase

    RhoA (Liu et al., 2002; Worthylake et al., 2001).

    Here we have addressed the role of PrP in monocyte adhesion and migration and

    show that PrP silencing impairs monocyte adhesion to 1 integrin ligands and to

    endothelial cells while increasing their motility. We show that PrP regulates ligand-

    induced integrin activation and provide evidence that ERM proteins and the RhoA-

    cofilin pathway are involved.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Results

    PrP colocalizes with integrins at cholesterol-rich domains in monocytic cells

    In vivo experiments in mice have shown that PrP regulates the recruitment of

    monocytes to inflamed peritoneum and the phagocytosis of dead cells by

    macrophages, suggesting a role for PrP in innate immunity (de Almeida et al., 2005).

    However, the mechanism underlying these effects has not been explored. Here, we

    first investigated the role of PrP in the adhesion and migration of the human pro-

    monocytic cell line U937. This model has been used extensively to study monocyte

    adhesion and CXCL12-induced migration (Chan et al., 2001; Hyduk and Cybulsky,

    2009) and allows for gene expression manipulation by transfection and transduction

    techniques.

    U937 cells express PrP on their cell surface as assayed by flow cytometry (Figure 1A).

    To determine whether PrP accumulates in cholesterol-rich membrane domains (‘lipid

    rafts’), we performed a membrane flotation assay. PrP was primarily found in the

    low-density fractions together with the lipid raft marker flotillin-1 (Figure 1B),

    indicating that PrP resides in lipid rafts in U937 cells. Further analysis of PrP

    distribution by confocal microscopy showed that a fraction of U937 cells displays

    polarized PrP localization on the membrane (Figure 1C). This fraction increased from

    ~20% to ~50% upon CXCL12 stimulation. In polarized cells, both PrP and 1

    integrins clustered together in membrane caps where they colocalized (Pearson’s

    coefficient larger than 0.5) (Figure 1C). In contrast, PrP and 1 integrins failed to

    colocalize when non-clustered and in non-polarized cells (Pearson’s coefficient

    smaller than 0.5) (Figure 1C). PrP also colocalized with the lipid raft-resident protein

    flotillin-1 in polarized cells (Figure S1). These data indicate that integrins are

    clustered in a fraction of U937 cells in steady-state conditions and that, upon cell

    polarization, PrP and 1 integrins are recruited to flotillin-1 lipid raft domains.

    Both the localization of PrP in lipid rafts and its colocalization with integrins suggest

    a role for PrP in the regulation of monocyte adhesion and migration. To investigate

    this, we generated stable U937 cell lines with reduced PrP expression by transduction

    with lentiviruses expressing three different shRNAs to human PrP. In parallel, stable

    cell lines were generated by transduction with lentivirus expressing a non-targeting

    shRNA (shCtrl-U937) as a negative control. Flow cytometry detection of surface PrP

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • showed that shPrP-1 (complementary to the 3’UTR of PrP mRNA) was able to reduce

    PrP expression to ~35%, while shPrP-2 and -3 (complementary to the PrP coding

    sequence) reduced PrP expression to ~70% (Figure 1D). Considering the moderate

    efficiency of shPrP-2 and -3 in silencing PrP expression, we continued our work using

    stable shPrP-1-transduced cell lines (shPrP-U937 cells).

    PrP silencing did not affect the proliferation rate of U937 cells as evidenced by

    routine cell counting of shCtrl- and shPrP-U937 cell cultures (not shown).

    Accordingly, staining of apoptotic cells with annexinV-FITC showed no significant

    differences between shCtrl- and shPrP-U937 (0.3% and 0.2% positive cells,

    respectively). In addition, there was no difference in CXCL12-induced activation of

    the survival kinase Akt between control and PrP-silenced cells (not shown).

    PrP regulates 1 integrin adhesion of monocytes

    We used stable shCtrl- and shPrP-U937 cell lines to explore the effect of PrP

    depletion on CXCL12-induced cell chemotaxis in a Transwell assay using FN-coated

    filters. ShPrP-U937 cells showed a significant increase in chemotaxis when compared

    with shCtrl-U937 cells (Figure 2A), suggesting that PrP is a negative regulator of

    chemotaxis. To confirm this, we induced PrP-dependent signaling by cross-linking of

    surface PrP with the SAF61 antibody, previously shown to trigger signal transduction

    in T lymphocytes and in a neuronal cell line (Stuermer et al., 2004; Mouillet-Richard

    et al., 2000). U937 cells incubated with SAF61 displayed impaired migration (Figure

    2B), confirming the negative regulatory effect of PrP on monocytic cell migration and

    supporting the specificity of the shRNA-mediated PrP silencing. These effects of PrP

    on cell chemotaxis were not due to changes in CXCR4 surface expression or

    CXCL12-induced receptor internalization as tested by flow cytometry (not shown).

    We then investigated whether changes in U937 cell migration were paralleled by

    changes in cell adhesion by recording electrical resistance at 32 kHz over time of cells

    adhering to ECIS electrodes coated with integrin ligands (FN, Fc-ICAM-1 or Fc-

    VCAM-1) or with bovine serum albumin (BSA) (Figure 2C-E). This assay is based on

    the increase in electrical resistance when cells spread on the electrodes following cell

    adhesion (Wegener et al., 2000). Addition of cells to the electrode arrays resulted in a

    slight increase in electrical resistance, which was consistently higher for shCtrl-U937

    cells compared to shPrP-U937 cells (Figure 2C), although differences were not

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • significant (not shown). Comparatively, a large increase in resistance was observed

    upon the stimulation of cell adhesion with PMA (Figure 2C). ShCtrl-U937 cells

    seeded on FN-coated electrodes showed a larger increase in PMA-stimulated adhesion

    than shPrP-U937 cells (Figure 2C). U937 cells express 1 (VLA 4 and 5) and 2

    integrins (LFA-1 and Mac-1) (Prieto et al., 1994), and under our experimental

    conditions, preferentially adhered to 1 integrin ligands (FN and VCAM-1) (Figure 2

    D, E). Consistent with a role for PrP in the regulation of 1 integrin-mediated

    adhesion, shPrP-U937 cells showed reduced adhesion to FN (Figure 2D) and Fc-

    VCAM-1 (Figure 2E). Thus, PrP silencing impairs, 1 integrin-mediated adhesion of

    monocytic cells. This reduced integrin-mediated adhesion may facilitate leukocyte

    motility and migration, which could explain our findings.

    To confirm that our findings also apply to primary monocytes, we transduced freshly

    isolated human monocytes with shPrP-1. ECIS adhesion assays showed similar

    differences in adhesion to Fc-VCAM between shCtrl- and shPrP-monocytes as for

    U937 cells (Figures 2F and 2G). Similar results were obtained using the human T

    lymphocyte cell line Jurkat lymphocytic cells (not shown).

    To establish that the differences using the ECIS adhesion assay were due to

    differences in adhesion strength and not in cell shape (i.e. spreading), we performed

    conventional adhesion assays by seeding cells on Fc-VCAM-coated plates and

    counting adherent cells after thorough washing (Figure S2).

    Together, these data indicate that PrP regulates 1integrin-mediated adhesion of

    monocytes and suggest that it may have a similar role in other leukocyte types.

    PrP regulates monocyte adhesion to the endothelium under flow

    To assess the effects of PrP silencing in monocyte-endothelium interactions under

    near-physiological flow conditions we used parallel flow chamber assays. Mixed

    suspensions of shCtrl- and shPrP-U937 cells (1:1), differently labeled with either

    calcein Red-Orange AM or calcein Green were stimulated with either CXCL12 or

    PMA. After stimulation, labeled cells were perfused over TNF-stimulated HUVEC,

    while recording fluorescent and bright-field time-lapse movies (movie snapshot in

    Figure 3A). Adherent cells were quantified in each video frame as described in

    Materials and Methods. ShPrP-U937 cells adhered in lower numbers when compared

    with shCtrl-U937 cells, both after cell stimulation with CXCL12 (Figure 3B) and with

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • PMA (Figure 3C). Our data show a significant reduction in firm adhesion of shPrP-

    U937 cells to the endothelium under flow in both conditions (Figure 3D: CXCL12;

    Figure 3E: PMA). Next, we transduced freshly isolated human monocytes with shPrP-

    1 or with shCtrl and quantified adherent monocytes to CXCL12-coated endothelium

    in the same assay as described for U937 cells. Our data show that PrP silencing also

    impairs firm adhesion of primary monocytes to the endothelium (Figure 3F). We

    performed similar experiments with PMA-activated monocytes, however we obtained

    no significant differences between the adhesion of shCtrl- and shPrP-monocytes. We

    think this can be explained by the low numbers of adherent cells due to monocyte

    activation and adhesion to the tubing of the flow system.

    Finally, similar results were obtained using PrP-silenced Jurkat cells (Figure S3A).

    These findings suggest that PrP positively regulates the firm adhesion of monocytes,

    and possibly other leukocyte types, to inflamed endothelium under physiological

    conditions of flow-induced shear stress.

    PrP regulates cell shape and migratory behavior of U937 cells on immobilized

    VCAM

    Our data above show that PrP regulates monocyte chemotaxis (Figure 2). To further

    analyze the effects of PrP silencing on cell migration, we examined the migratory

    behavior of shCtrl- and shPrP-U937 cells on immobilized Fc-VCAM and CXCL12 by

    time-lapse video recording. Migrating shCtrl-transduced U937 cells formed long and

    persistent uropods and moved in a polarized fashion extending lamellipodia and

    filopodia at the cell front (Figure 4A and supplementary Movie 1). In contrast, shPrP-

    U937 cells failed to form long uropods (Figure 4A and supplementary Movie 1).

    Manual tracking of migrating cells and subsequent calculation of cell velocity and

    accumulated distance of cell trajectories showed that shPrP-U937 cells were faster

    and covered longer distances than shCtrl-U937 cells (Figure 4A). Lack of significant

    differences in directness suggests that PrP silencing does not affect cell polarization

    (Figure 4A). These data corroborate our findings using Transwell chemotaxis assays

    and suggest that PrP silencing enhances leukocyte motility through the

    downregulation of integrin-mediated adhesion.

    Both 1 integrins and phosphorylated ERM proteins localize to the uropod of

    migrating leukocytes (Lee et al., 2004; Martinelli et al., 2013). Similarly, phospho-

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • ERM proteins accumulated in the uropod partially colocalized with 1 integrins in

    shCtrl-U937 cells migrating on immobilized VCAM-1 (Figure 4B). In contrast,

    shPrP-U937 cells mostly lacked uropods and contained reduced levels of phospho-

    ERM proteins, which localized in discrete spots and in thin membrane protrusions

    (Figure 4B). Measurement of uropod length in cells migrating on Fc-VCAM-1

    showed that the average length of the uropod was reduced from 26.5 µm to 14.5 µm

    upon PrP silencing (Figure 4B). To test whether uropod loss could be rescued by

    overexpression of PrP in shPrP-U937 cells, we took advantage of the fact that shPrP-1

    targets the 3’-UTR of PrP mRNA allowing for rescue with human PrP cDNA. We

    transfected cells with GFP-PrP or GFP cDNAs by electroporation and subsequently

    selected GFP-positive cells by flow cytometry. Since GFP-PrP mainly localizes to the

    cell middle plane (in the Golgi, not shown), and the signal was therefore low at the

    bottom plane, we co-detected PrP with SAF32 in non-permeabilized cells to clearly

    show distribution of PrP on the membrane. Uropod formation in PrP-silenced cells

    was rescued by overexpression of GFP-PrP, but not GFP (Figure 4C). In addition, PrP

    on the cell surface (detected with anti-PrP antibodies in non-permeabilized cells)

    partially co-localized with endogenous 1 integrin (Pearson’s correlation coefficient =

    0.65±0.01 (mean±SEM)), which corroborates our findings in suspension cells.

    ERM proteins link membrane proteins to the actin cytoskeletal cortex (Fehon et al.,

    2010) and active phosphorylated ERM proteins localize to and regulate formation of

    the uropod in migrating lymphoblasts (Lee et al., 2004; Martinelli et al., 2013). We

    observed that the intensity of phospho-ERM labeling appeared to be reduced in

    shPrP-U937 cells (Figure 4B). To substantiate this observation, we assessed ERM

    protein phosphorylation by immunoblotting in cells stimulated with CXCL12 or PMA

    in a time-course experiment. As moesin is the predominant ERM isoform expressed

    in leukocytes (Ivetic and Ridley, 2004), we detected this protein as control for equal

    protein loading. CXCL12 induced ERM phosphorylation whereas PMA reduced

    phospho-ERM levels in a time-dependent manner (Figure 5A). Consistent with the

    role of ERM proteins in uropod formation, levels of phospho-ERM proteins were

    significantly reduced in shPrP-U937 cells stimulated with CXCL12 and slightly

    decreased after stimulation with PMA (Figure 5A). In addition, basal phospho-ERM

    levels were 1.5-fold lower in PrP-silenced cells when compared to control. These data

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • suggest that PrP regulates uropod formation in monocytic cells through the regulation

    of ERM protein phosphorylation.

    ERM proteins are known to link the uropod marker CD44 to the actin cytoskeleton

    (Friedl and Weigelin, 2008; Fehon et al., 2010). To determine whether the reduction

    in ERM protein activation observed in shPrP-U937 cells had any effects in CD44

    distribution, we immunodetected CD44 and flotillin-1 in cells migrating on

    immobilized Fc-VCAM. In shCtrl-U937 cells, CD44 was enriched in uropods

    together with flotillin-1 (Figure 5B). In contrast, CD44 was more uniformly

    distributed on the membrane of shPrP-U937 cells, albeit flotillin-1 still showed a

    polarized distribution (Figure 5B). These data indicate that PrP silencing alters CD44

    membrane distribution.

    Next, we examined in detail the migratory behavior of shCtrl- and shPrP-U937 cells

    arrested on the endothelium under near-physiological flow conditions as described

    above. Leukocyte firm adhesion to the endothelium is enhanced by PMA treatment,

    which stimulates integrin adhesion and consequently inhibits leukocyte motility

    (Cinamon et al., 2001). As expected, PMA-stimulated shCtrl-U937 cells remained

    mostly round and immotile after arrest and adhesion to the endothelium. In contrast,

    PMA-stimulated shPrP-U937 cells crawled over the endothelium while forming

    dynamic bleb-like membrane protrusions (Figure 6A, see Movies 2, 3 and 4 in

    supplementary material). On average 30% of shPrP-U937 cells arrested on the

    endothelium displayed dynamic protrusions in contrast to only 10% of shCtrl-U937

    cells (Figure 6B). PMA-activated shPrP-monocytes also showed increased membrane

    activity compared to shCtrl-monocytes (see movie 5 in supplementary material),

    although differences were smaller (the percentages of adherent cells with membrane

    protrusions were 38.5% for shCtrl-monocytes and 53.3% for shPrP-monocytes).

    However, these data should be taken with caution due to the low number of PMA-

    activated monocytes that were flown over the endothelium. Finally, this phenotype

    appears not to be unique for monocytic cells since PrP-silenced Jurkat cells displayed

    similar bleb-like motility on activated endothelium as U937 cells (Figure S3B).

    Finally, we assessed the role of PrP in leukocyte transendothelial migration by

    quantification of the number of shCtrl-and shPrP-U937 cells undergoing diapedesis

    across TNF-activated CXCL12-coated endothelium under flow conditions

    (Grabovsky et al., 2000). Predictably, a significantly higher percentage of shPrP-U937

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • cells transmigrated across the endothelium when compared to control cells (Figure

    6C). Thus, following arrest on the endothelium, PrP-silenced cells appear to have a

    diminished capacity to establish firm adhesion, displaying increased motility together

    with high membrane protrusive activity as well as increased diapedesis.

    PrP regulates integrin activity

    Integrin-mediated adhesion is regulated by conformational changes (affinity) as well

    as by the number of integrin molecules engaged in ligand binding (avidity) (Carman

    and Springer, 2003). Our data show that PrP silencing leads to reduced monocyte

    adhesion to 1 integrin ligands. To gain insight into the molecular mechanism

    underlying these effects, we first investigated whether PrP silencing impaired integrin

    affinity upregulation in in cells stimulated or not with CXCL12, PMA or Mn2+ for 10

    min. PMA and CXCL12 induce intracellular signaling that leads to integrin activation,

    while Mn2+ binds to surface integrins triggering a signaling-independent

    conformational change (Carman and Springer, 2003). Total and activated 1 on the

    surface of shCtrl- and shPrP-U937 cells were assessed by flow cytometry. No

    differences in surface expression of total or activated integrins were detected between

    shCtrl- and shPrP-U937 cells (Figure 7A).To further examine the effect of PrP

    silencing on stimulus-induced upregulation of high-affinity 1 integrins, we

    stimulated cells with CXCL12, PMA or Mn2+ in the presence of soluble Fc-VCAM.

    Cell-bound Fc-VCAM was subsequently detected using APC-labeled F(ab’)2 goat

    anti-human IgG and flow cytometry analysis (Chan et al., 2003). shPrP-U937 cells

    consistently bound less Fc-VCAM (Figure 7B). Direct integrin activation with Mn2+

    induced higher Fc-VCAM binding and reduced the differences between shCtrl- and

    shPrP-U937 cells (Figure 7B). These data suggest that PrP-silencing does not affect

    the number of integrins on the cell surface but decreases ligand-induced integrin

    activation. We assessed this further by using multimeric Fc-VCAM complexes. For

    this, preformed soluble multimeric ligand complexes were generated by incubation of

    Fc-VCAM with IgG F(ab’)2 goat anti-human IgG (Konstandin et al., 2006). This

    assay was previously shown to detect both integrin affinity and avidity in leukocytes

    based on the fact that polyclonal F(ab’)2 fragments recognize different epitopes of the

    human Fc moiety of Fc-VCAM (Konstandin et al., 2006). The differences in ligand

    binding between control and PrP-deficient cells were more pronounced when

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • multimeric Fc-VCAM complexes were used (Figure 7C). The exacerbation of the

    differences between control and PrP-silenced cells when using a multivalent ligand

    suggests that PrP silencing primarily impairs ligand-induced integrin avidity.

    PrP regulates RhoA activation and actin polymerization

    Integrin avidity is enhanced upon increased lateral mobility of integrins on the plasma

    membrane, which allows them to form microclusters (Bakker et al., 2012; Buensuceso

    et al., 2003). Integrin binding to the actin cytoskeleton may impose constraints to the

    lateral mobility of integrins and reduce avidity. In addition, PrP-silencing was

    previously shown to stabilize actin filaments in neuronal cells through a RhoA-

    dependent pathway (Loubet et al., 2012). Therefore, we explored RhoA activation in

    shCtrl- and shPrP-U937 cells stimulated with CXCL12 or PMA. ShPrP-U937 cells

    displayed significantly elevated GTP-RhoA levels at 2 and 5 min of CXCL12

    stimulation (Figure 8A). In contrast to CXCL12, PMA stimulation decreased RhoA

    activation. However, the levels of GTP-RhoA were also slightly elevated in PMA-

    stimulated PrP-silenced cells when compared to control cells (Figure 8A).

    RhoA regulates the actin cytoskeleton by inducing both actin polymerization and

    actin microfilament crosslinking and remodeling. Therefore, we investigated actin

    polymerization dynamics in CXCL12-stimulated suspension cells using a more

    sensitive flow cytometry-based assay (Voermans et al., 2001). In agreement with

    previous published data (Voermans et al., 2001), we observed a burst of F-actin after

    0.5 min stimulation, followed by a decrease to unstimulated levels at 10 min (Figure

    8B). PrP-silenced cells showed higher F-actin content at every time point (Figure 8B).

    Low concentrations of cytochalasin B are reported to enhance actin remodeling, while

    at high concentrations, cytochalasin B causes actin cytoskeleton depolymerization. To

    test whether altered actin dynamics underlies the adhesion defects of PrP-silenced

    cells, we performed an ECIS adhesion assay in the presence of tow concentrations of

    cytochalasin B. At 1 M, cytochalasin B increased adhesion of shPrP-U937 cells to

    control levels (Figure 8C). At 5 M, cytochalasin B, reduced PMA-induced adhesion

    of both shCtrl and shPrP-U937 cells (Figure 8C). These data suggest that reduced

    actin dynamics mediates the effects of PrP silencing in cell adhesion.

    Previously, the RhoA-regulated actin-severing protein cofilin was involved in the

    regulation of actin microfilament stability by PrP in neurons (Loubet et al., 2012). To

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • determine whether this pathway is operational in monocytes, we determined the levels

    of phosphorylated (inactive) cofilin in cells adherent to immobilized Fc-VCAM. We

    found that PrP-silencing increases phospho-cofilin levels (Figure 8D) and thus

    inactivates cofilin. Together, these findings provide evidence suggesting that PrP

    regulates monocyte adhesion and migration through the regulation of actin

    remodeling by the RhoA-cofilin pathway.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Discussion

    Leukocyte migration across the vascular wall is of crucial importance for the immune

    response. PrP has been previously involved in the influx of immune cells into the

    peritoneal cavity during zymosan-induced peritonitis, where monocytes were

    recruited in larger numbers in PrP-/- mice compared to wild type controls (de Almeida

    et al., 2005). Our study now provides evidence for the molecular mechanisms

    underlying the effects of PrP silencing on monocyte adhesion and migration, and

    corroborate the immunomodulatory role of PrP.

    Our findings show that PrP silencing increases chemotaxis and motility of monocytic

    U937 cells on 1 integrin ligands in static conditions as well as on endothelium in

    near-physiological flow conditions. In addition, we show that PrP-deficient U937

    cells are able to transmigrate more efficiently than control cells. In contrast, activation

    of endogenous PrP signaling by antibody-mediated crosslinking of surface PrP

    impairs U937 cell chemotaxis. Collectively, these data suggest that PrP is a negative

    regulator of monocyte (transendothelial) migration.

    Leukocyte migration is dictated by the strength of integrin-mediated cell adhesion.

    Although leukocyte attachment to the endothelial surface is required to resist flow-

    induced shear stress forces, excessive adhesion abrogates leukocyte motility on the

    endothelium as well as diapedesis across the endothelial monolayer (Cinamon et al.,

    2001). We show that PrP silencing impairs pro-monocyte adhesion to 1 integrin

    ligands (FN and VCAM-1) in static conditions, as well as to TNF-activated

    endothelial cells under flow. In addition, we show that primary monocytes and Jurkat

    cells also display defective adhesion and enhanced motility upon PrP silencing,

    suggesting that PrP regulates 1 integrin-mediated interactions of monocytes (and

    probably T cells) with the endothelium in vivo.

    The regulation of integrin-mediated adhesion takes place through changes in affinity,

    avidity and/or trafficking (Margadant et al., 2011). We observed no changes in

    integrin affinity in PrP-silenced cells by using either an antibody specific for the high

    affinity conformation of 1 integrins or a soluble 1 integrin ligand (Fc-VCAM1).

    Likewise, we detected no differences between control and PrP-silenced cells in 1

    integrin internalization by using an antibody-feeding assay (results not shown).

    However, PrP silencing impaired the binding of multimeric Fc-VCAM complexes to

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • cells. These data suggest that PrP controls 1 integrin adhesiveness through the

    regulation of ligand-induced changes in integrin activation, likely through the

    regulation of integrin avidity, which is determined by the number of integrins engaged

    in ligand binding (Carman and Springer, 2003). VLA-4 (41) integrin

    microclustering can induce adhesiveness by increasing valency, independent of

    changes in integrin affinity (Grabovsky et al., 2000). The attachment of the integrin

    cytosolic tail to the actin cytoskeleton restraints the lateral mobility of integrins on the

    membrane and consequently impairs microclustering (Bakker et al., 2012;

    Buensuceso et al., 2003). Thus, local microfilament remodeling might be required to

    allow disengagement of integrins from cortical actin and allow them to cluster,

    therefore increasing the strength of ligand binding (Bakker et al., 2012; Worthylake

    and Burridge, 2003). We show here, that PrP silencing increases CXCL12-induced

    RhoA activation as well as F-actin content. Interestingly, while CXCL12-induced

    actin polymerization follows similar kinetics in shCtrl- and shPrP-U937 cells, actin

    depolymerization is slower in PrP-silenced cells (Figure 8). Notably, increasing actin

    depolymerization rates with low concentrations of cytochalasin B abrogate the effects

    of PrP silencing on cell adhesion. Consistent with this, we found that PrP silencing

    induces the inactivation of the actin-severing protein cofilin. Inactivation of cofilin by

    phosphorylation on Ser3 is mediated by LIM-kinase which in turn is activated by

    RhoA (Bravo-Cordero et al., 2013). In view of the above findings, we propose that the

    stabilization of actin filaments by RhoA-induced cofilin inactivation prevents the

    release of activated integrins from the cytoskeleton in PrP-deficient cells, therefore

    impairing integrin microclustering and adhesiveness. Our findings are in agreement

    with previously reported data showing increased cytoskeletal stability, RhoA

    activation and cofilin inactivation in PrP-deficient neuronal cells (Loubet et al., 2012).

    Interestingly, overexpression of PrP in primary rat hippocampal neurons induces

    cofilin activation and the formation of actin-cofilin rods (Walsh et al., 2014). These

    structures are found in Alzheimer disease brain and are shown to impair synaptic

    function (Minamide et al., 2000). It is tempting to speculate that cofilin regulation is

    critical both for the physiological function of PrP and for prion-induced

    neurodegeneration.

    We found that PrP colocalizes with integrins in pre-formed flotillin-1 domains

    (Langhorst et al., 2006). In contrast to T cells, where PrP recruitment to flotilin-1

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • membrane caps was induced by antibody-mediated PrP crosslinking (Stuermer et al.,

    2004), we observed that PrP co-clustered with integrins in a fraction of U937 cells in

    the absence of stimulation or antibody-mediated crosslinking. This suggests that a

    percentage of U937 cells are ‘primed’ in resting conditions, which could explain the

    differences observed in F-actin content and ligand binding in unstimulated cells.

    Despite the colocalization of PrP and 1 integrin in flotillin-1 domains, we were

    unable to show association of PrP and 1 in co-immunoprecipitation assays (data not

    shown), albeit 1 integrin was previously identified as a PrP-interacting partner in a

    proteomic study (Watts et al., 2009). We found that PrP silencing dramatically altered

    the morphology and migratory behavior of cells moving on 2D surfaces. ShCtrl-U937

    cells migrating on immobilized VCAM accumulated 1 integrins, phospho-ERM,

    flotillin-1 and CD44 in the uropod, all bona fide uropod markers (Shulman et al.,

    2009; Gomez-Mouton and Manes, 2007). In contrast, PrP-depleted cells generally

    failed to form uropods and displayed a round shape, although 1 integrin and flotillin-

    1 still showed a polarized distribution. Flotillins are essential for uropod formation by

    neutrophils (Ludwig et al., 2010). Although PrP colocalizes with flotillin in U937

    cells, flotillin distribution is not affected upon PrP silencing, which suggests that PrP

    does not regulate uropod formation through the disruption of flotillin domains.

    The uropod is an adhesive structure that need to be retracted during migration (Liu et

    al., 2002; Smith et al., 2003; Worthylake et al., 2001). In agreement with this, PrP-

    deficient cells migrated faster than control cells. We found that PrP silencing alters

    the activation of two proteins involved in uropod dynamics: ERM and RhoA. First,

    PrP silencing reduces ERM protein phosphorylation. ERM proteins are activated by

    phosphorylation of a conserved C-terminal threonine residue, which enables them to

    crosslink membrane receptors with the underlying actin cytoskeleton (Fehon et al.,

    2010). ERM activation is crucial for uropod formation (Ivetic and Ridley, 2004; Lee

    et al., 2004; Martinelli et al., 2013) and for 1 integrin-dependent T cell adhesion and

    polarization (Chen et al., 2013; Liu et al., 2002). Therefore, the inhibition of ERM

    phosphorylation in the absence of PrP likely contributes to both the lack of uropods

    and the reduced 1 integrin adhesion observed for PrP-deficient monocytes.

    RhoA is crucial for uropod de-adhesion and retraction during migration (Liu et al.,

    2002; Smith et al., 2003; Worthylake et al., 2001). In neutrophils, activation of

    myosin by RhoA has been implicated in actomyosin-driven uropod retraction (Eddy

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • et al., 2000). However, we found that phospho-myosin levels were equal in shCtrl-

    and shPrP-U937 and they did not increase by stimulating migration (data not shown).

    This suggests that actomyosin contraction does not play a role in uropod retraction in

    monocytic cells. In line with this, myosin inhibition did not affect uropod retraction in

    migrating monocytes (Worthylake et al., 2001).

    PMA-dependent integrin activation induces leukocyte firm adhesion to the

    endothelium and blocks motility and migration (Cinamon et al., 2001). Thus

    ‘excessive’ integrin activation prevents migration. In line with this, PMA-stimulated

    control cells firmly adhered to the endothelium, while PMA-stimulated PrP-deficient

    cells crawled over the endothelium while protruding dynamic bbleb-like extensions.

    This motility could be prompted by the weaker adherence of PMA-simulated PrP-

    silenced cells. In addition, decreased membrane tension due to lower levels of active

    ERM proteins may also contribute to this phenotype. In support of this, constitutively

    active ezrin was shown to increase lymphocyte membrane tension, reduce chemokine-

    induced shape changes and block transendothelial migration (Liu et al., 2002).

    In summary, we propose that PrP has a role in integrin-mediated adhesion and

    motility through the regulation of ERM membrane-cortex adaptors and the RhoA-

    cofilin pathway that controls cytoskeleton remodeling. This may be a general

    mechanism for the reported regulation of cell-cell and cell-matrix adhesion by PrP in

    different cell types (Petit et al., 2013). Also, our data contributes to understand

    additional roles of PrP in neurodegeneration.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Methods

    Cell culture and lentiviral transduction

    Human pro-monocytic U937 cells were transduced with lentivirus containing the

    validated Sigma MISSION shRNA plasmids targeting human PrP (PrP-1,

    TRCN0000083488; PrP-2, TRCN0000083490; PrP-3, TRCN0000083491) or non-

    targeting shRNA (Ctrl, SHC002) as a negative control. Subsequently shRNA-

    expressing cells were selected by culturing in RPMI medium containing 10% fetal

    calf serum and 1.5 µg/mL puromycin. Before each experiment, cells were cultured in

    puromycin-free medium for at least 24 h. PrP expression in control and knock-down

    cell lines was tested before each experiment by flow cytometry with SAF32 anti-PrP

    antibody. HUVEC (Primary Human Umbilical Vein Endothelial Cells) were cultured

    in Endothelial Growth Medium-2, both from Lonza.

    Human monocytes were isolated from PBMCs by positive selection with magnetic

    CD14-beads (Milteny Biotech). For transduction, shRNA lentiviruses were incubated

    with 4 g/mL Polybrene for 10 min at RT prior to their addition to monocyte

    suspensions (2x106 cells/mL) in complete RPMI. M-CSF was added at a

    concentration of 10 ng/mL to keep monocytes steady without inducing differentiation

    (Troegeler et al., 2014). After 48 h, PrP expression was analyzed by flow cytometry.

    The maximum efficiency of PrP knock-down was of ~30-60%. Only those monocytes

    with at least 50% knock-down were used for experimental assays.

    Antibodies and reagents

    Mouse monoclonal antibodies (Abs) against PrP (SAF32 and SAF61) were from Spi-

    Bio. Anti-1 integrin Ab (clone P5D4) was from Abcam. Activated 1 integrins were

    detected with HUTS-4 (Millipore) and Mab24 (Abcam), respectively. Flotillin-1

    rabbit polyclonal Ab was from Abcam and transferrin receptor mouse monoclonal Ab

    from Life Technologies. RhoA monoclonal mouse Ab was from Santa Cruz

    Biotechnology. Rabbit antibodies against phospho-ERM proteins (ezrin (Thr567),

    radixin (Thr564), moesin (Thr558)), phospho-cofilin (Ser3), cofilin and myosin light

    chain (MLC) as well as mouse monoclonal anti phospho(Ser19)-myosin light chain

    were from Cell Signaling. Mouse monoclonal anti-moesin was from BD Biosciences.

    FITC-labeled anti-CXCR4 mouse monoclonal was from R&D Systems. Mouse

    monoclonal anti-actin was from Sigma. HRP- and Alexa dye-conjugated secondary

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Abs were from Dako and Life Technologies, respectively. Human fibronectin was

    from Biopur. Recombinant human Fc-ICAM and Fc-VCAM were from R&D

    Systems. (APC-labelled) polyclonal goat anti human IgG F(ab’)2 were from Jackson

    ImmunoResearch Laboratories. AnnexinV-FITC was from Pharmingen. Human

    recombinant TNF and CXCL12 were from Peprotech. Phorbol-12-myristate-13-

    acetate (PMA) and cytochalasin B were from Sigma. Calcein Green AM and calcein

    Red-Orange AM were from Life Technologies.

    Membrane flotation assay

    20x106 cells were lysed on ice for 15 min in TXNE buffer containing 50 mM Tris-

    HCl (pH 7,4); 150 mM NaCl; 5 mM EDTA; 1 mM DTT; 1% Triton X-100 and

    cOmplete Protease Inhibitor Cocktail Tablets (Roche). Lysates were mixed with 1.8

    mL of 60% OptiPrep (Sigma) in TXNE buffer. Subsequently, 7.5 mL of 28%

    OptiPrep and 1.8 mL of TXNE buffer were layered on top. Gradients were

    centrifuged at 200,000 g for 3 h at 4°C. 1-mL fractions were taken from the top of the

    gradient and proteins were precipitated for 30 min on ice by addition of an equal

    volume of 20% trichloroacetic acid and pelleted at 10,000 g for 15 min at 4°C. Pellets

    were washed with cold acetone and solubilized in SDS sample buffer.

    Chemotaxis

    Transwell chemotaxis assays were performed and analyzed as previously described

    (Lorenowicz et al., 2006). Crosslinking of surface PrP was performed by incubating

    cells for 30 min at 37°C with 0.5 µg/mL of anti-PrP SAF61 Ab.

    ECIS adhesion assays

    Cell adhesion to fibronectin (FN), BSA, Fc-VCAM or Fc-ICAM was measured using

    Electrical Cell-Substrate Impedance Sensing system (ECIS, Applied Biophysics).

    ECIS 8W10E electrode arrays were coated with 20 µg/mL FN or BSA during 16 h at

    4°C. For Fc-ICAM/VCAM coating, electrode arrays were first coated with 4 µg/mL

    of AffiniPure F(ab')2 Goat Anti-Human IgG (Jackson ImmunoResearch) for 1h at

    37°C in 20mM Tris, pH 8.0; 150mM NaCl; 1mM CaCl2; 2mM MgCl2. BSA (1%) was

    added for 30 min at 37°C to block non-specific binding. After blocking, human

    recombinant Fc-ICAM-1 or Fc-VCAM-1 were added at a concentration of 1 µg/mL

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • and incubated for 16 h at 4°C. The electrical resistance of cells (500,000 cells per

    well) seeded on protein-coated arrays was measured in real-time at a frequency of 32

    kHz.

    Plate adhesion assays

    Cells were added to F(ab’)2 / Fc-VCAM-coated wells of flat-bottom 96-wells

    Maxisorp plates (100,000 cells per well). Immediately after cell seeding, stimuli were

    added to the wells and cells were allowed to adhere for 30 min at 37°C. Subsequently,

    non-adherent cells were removed by washing three times with PBS-0.5% BSA.

    Adherent cells were fixed with 3.7% formaldehyde, incubated with Hoechst to stain

    nuclei and counted on an Axiovert wide-filed microscope (Zeiss).

    Adhesion and transendothelial migration under flow

    Confluent HUVEC monolayers on FN-coated parallel-plate flow chamber slides (µ-

    slide VI0.4, Ibidi) were treated with 10 ng/mL TNF for 16 h. Flow chambers were

    mounted on an inverted widefield fluorescence microscope (Axiovert 200, Zeiss)

    fitted in a 37°C and 5% CO2 chamber. ShCtrl- and shPrP-U937 cells were differently

    labeled with either calcein Green AM or calcein Red-Orange AM (2.5 µM, Life

    Technologies). After washing cells were resuspended in assay buffer (20 mM Hepes

    (pH 7.4), 132 mM NaCl, 6 mM KCl, 1.2 mM K2HPO4, 1 mM MgSO4, 1 mM CaCl2,

    0.1% D-(+)-glucose, 2.5% human albumin). Differently calcein-labeled shCtrl- and

    shPrP-U937 cells were mixed at 1:1 ratio to a final total cell concentration of 1x106

    cells/mL and subsequently stimulated with 100 ng/mL phorbol-12-myristate-13-

    acetate (PMA) or with 100 ng/mL CXCL12 for 10 min. Stimulated cell mixes were

    flown over TNF-activated HUVEC monolayers at a flow rate of 0.5 mL/min

    corresponding to a shear stress of 0.9 dynes/cm2. Time-lapse bright-field and

    fluorescence images were acquired from four random microscope fields for 30-60 min

    using an Orca R2 digital CCD camera (Hamamatsu). Quantification of adherent cells

    per frame was performed using the ‘analyze particles’ application of ImageJ after

    thresholding of the fluorescence video images. Transendothelial migration of U937

    cells was assessed in similar experiments as above except for the immobilization of

    CXCL12 on the endothelial surface (100 ng/mL, 15 min at 37°C) prior to U937 cell

    perfusion. Time-lapse microscopy was performed with a LSM510 META confocal

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • microscope (Zeiss). Scoring of transmigrating cells was based on shape changes (from

    round to spread) and loss of brightness in the DIC channel.

    Cell motility on immobilized Fc-VCAM-1

    IBIDI µ-slides were coated with F(ab')2 Goat Anti-Human IgG and Fc-VCAM-1 as

    described for ECIS arrays. Subsequently, CXCL12 was absorbed on the dishes by

    incubation for 1 h at 37°C with 100 ng/mL CXCL12 in assay buffer. Motility of cells

    on Fc-VCAM-1 was recorded from four microscopic fields with a wide-field

    microscope as described above. Cell tracking on videos and calculation of

    accumulated distance and velocity was performed using Gradientech Tracking Tool

    software.

    Flow cytometry

    Cells were stimulated with CXCL-12 (100 ng/mL) for 15 min at 37°C, cooled on ice

    and labeled with SAF32 anti-PrP antibody and anti-1 or anti-2 integrin antibodies

    for 1 h at 4°C. Cells were then fixed in 4% paraformaldehyde, blocked in 50 mM

    NH4Cl and incubated with Alexa dye-labeled secondary antibodies. Labeled cells

    were analyzed by flow cytometry using a FACSCanto flow cytometer (BD

    Biosciences). Integrin activation was induced with 100 ng/mL PMA or with 1mM

    MnCl2 for 10 min at 37°C in Hank’s Balanced Salt Solution containing 1mM

    Ca2+/Mg2+.

    Time-course experiments of Fc-VCAM binding to cells was performed according to

    (Chan et al., 2003). For Fc-VCAM/ APC- labelled F(ab’)2 binding we followed the

    protocol described in (Konstandin et al., 2006). Fluorescence was measured by flow

    cytometry using a FACSCanto flow cytometer (BD Biosciences).

    Immunofluorescence

    For confocal microscopy analysis, antibody-labeled cells as above were resuspended

    in mounting medium (Vectashield) containing DAPI, and mounted on a glass slide.

    Alternatively, cells were seeded on Fc-VCAM and CXCL12-coated IBIDI µ-slides,

    allowed to migrate/polarize for 20 min and fixed with 4% paraformaldehyde in assay

    buffer, blocked using 50 mM NH4Cl in PBS and subsequently permeabilized with

    PBS-0.1% Triton X-100 for 2 min. After blocking in PBS-1% BSA, cells were

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • subsequently incubated with primary antibodies for 30 min at room temperature and

    Alexa488-labelled goat anti-mouse antibodies. To stain nuclei, Hoechst was added in

    the washing buffer. Fluorescence images were obtained with the LSM510 META

    (Zeiss) or with a SP8 (Leica) confocal microscopes.

    For colocalization analysis between PrP and 1 integrin, ROIs were selected on

    digital pictures and Pearson’s coefficients were determined using the Colocalisation

    Test plugin from ImageJ (Costes randomization method). In polarized cells, ROIs

    were selected of the capped and non-capped membrane domains. In non-polarized

    cells, ROIs were made around the membrane of each cell halves. We considered that

    colocalization existed at Pearson’s coefficient values from 0.5 to 1.0.

    DNA constructs

    Monomeric EGFP (mEGFP) was inserted between the signal peptide (1-22) and

    mature PrP (23-253) by ligation independent cloning. A 121 bp fragment containing

    the PrP signal peptide was PCR amplified from human PrP cDNA (TrueClone from

    Origene) using MFB001(5’-

    GCAGGGGCGCAACAGACCCCGGTGCCACCATGGCGAACCTTGGCTGCTGG

    ATGC-3’) and MFB002 (5’-

    CCACCAGGCCGGCCAGCACCCGGTCCGCAGAGGCCCAGGTCACTCCATG

    TG-3’) and inserted in frame in front of mEGFP in XmaI-digested mEGFP-LIC as

    described (Bierings et al., 2012), resulting in sp-mEGFP-LIC. A 754 bp fragment

    containing mature PrP was PCR amplified using MFB003 (5’-

    GGGCGCGCCTGGTGGGGCCAAGAAG CGCCCGAAGCCTGGAGGATG -3’)

    and MFB004 (5’- GCGGCCGCCTGCTCGTCCATCATC

    CCACTATCAGGAAGATGAGG -3’) and inserted in frame behind mEGFP in SacII-

    digested sp-mEGFP-LIC using ligation independent cloning. All plasmids were

    verified by sequence analysis.

    Rescue of PrP expression

    U937 cells stably expressing shRNA targeting human PrP were cultured for 48 hours

    in puromycin-free medium. After 48 hours cells were transfected by electroporation

    (Neon Transfection System, Life Technologies) with a GFP-PrP or GFP construct

    according to manufacturers’ recommendations. GFP-positive cells were sorted using a

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • FACSAria II cell sorter (BD biosciences). Cells were allowed to recover for 2 hours

    in complete medium before seeding on Fc-VCAM-coated IBIDI µslides.

    GTPase activation assay

    Cells were lysed in 25 mM Tris-HCl, pH 7.2, 150 mM NaCl, 10 mM MgCl2,

    1% NP-40 and 5% glycerol and cOmplete Protease Inhibitor Cocktail Tablets, Roche.

    RhoA-GTP was isolated from cell lysates using a pull-down assay as previously

    described (Alblas et al., 2001).

    Immunobloting

    Cells were stimulated in suspension and lysed in cold NP-40 buffer (25 mM Tris-HCl,

    pH 7.2, 150 mM NaCl, 10 mM MgCl2, 10 mM CaCl2 1% NP-40 and 5% glycerol)

    containing Halttm protease and phosphatase inhibitor cocktail (Thermo Scientific).

    Phospho-ERM and total moesin levels were determined by Western blotting. Pixel

    density was determined using ImageJ. Data represent phospho-ERM/moesin ratios

    and were normalized to t=0 of shCtrl cells.

    To determine phospho-cofilin and total cofilin levels, U937 cells were lysed in sample

    buffer after 30 min adhesion to VCAM-coated plates. Equal loading was controlled

    by detection of total cofilin. Pixel density values was determined using ImageJ. Data

    represent phospho-cofilin/cofilin ratios. Values were normalized to shCtrl.

    Actin polymerization assay

    CXCL12-induced changes in intracellular content of F-actin were measured by

    Alexa488-phaloidin staining as described in (Voermans et al., 2001). Labeled cells

    were analyzed by flow cytometry using a FACSCanto flow cytometer (BD

    Biosciences)

    Statistical analysis

    Data are represented as mean±SD or mean±SEM. Statistical comparisons of means

    were performed using either two-tailed Student t test, one-way ANOVA with

    Bonferroni post hoc test or two-way ANOVA (Bonferroni’s multiple comparisons

    test)post hoc test. Statistical significance is represented by asterisks: * p

  • Acknowledgements

    We are grateful to Dr Peter Hordijk for critically reading our manuscript. We also

    thank Erik Mul for his assistance with flow cytometry assays and Nicoletta Sorvillo

    for helping with monocyte isolation. We are grateful to Maaike Scheenstra for sharing

    with us her protocol for monocyte transduction and to Dr Keith Burridge and Dr

    Metello Innocenti for their helpful comments.

    This work was financed with a grant from Sanquin Blood Supply (PPOC 11-006). RB

    was supported by a European Hematology Association Research Fellowship.

    Author contribution

    D.D.R., S.T., E.V-E., C.P. and R.B. performed the research and analyzed the data;

    M.F-B. designed the research, analyzed the data and wrote the paper. D.G.

    contributed reagents.

    D.R. and S.T. contributed equally to this study.

    Conflict of interest disclosure: the authors declare no competing financial interests.

    Correspondence: Mar Fernandez-Borja, Department of Molecular Cell Biology,

    Sanquin Research, Plesmanlaan 125, 1066CX Amsterdam, The Netherlands; e-mail:

    [email protected]

    Competing interests

    The author(s) declare no competing financial interests

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

    mailto:[email protected]

  • References

    Alblas, J., Ulfman, L., Hordijk, P. and Koenderman, L. (2001). Activation of

    Rhoa and ROCK are essential for detachment of migrating leukocytes. Mol. Biol. Cell

    12, 2137-2145.

    Alon, R., Feigelson, S. W., Manevich, E., Rose, D. M., Schmitz, J., Overby, D. R.,

    Winter, E., Grabovsky, V., Shinder, V., Matthews, B. D. et al. (2005).

    Alpha4beta1-dependent adhesion strengthening under mechanical strain is regulated

    by paxillin association with the alpha4-cytoplasmic domain. J. Cell Biol. 171, 1073-

    1084.

    Bakker, G. J., Eich, C., Torreno-Pina, J. A., Diez-Ahedo, R., Perez-Samper, G.,

    van Zanten, T. S., Figdor, C. G., Cambi, A. and Garcia-Parajo, M. F. (2012).

    Lateral mobility of individual integrin nanoclusters orchestrates the onset for

    leukocyte adhesion. Proc. Natl. Acad. Sci. U. S. A 109, 4869-4874.

    Ballerini, C., Gourdain, P., Bachy, V., Blanchard, N., Levavasseur, E., Gregoire,

    S., Fontes, P., Aucouturier, P., Hivroz, C. and Carnaud, C. (2006). Functional

    implication of cellular prion protein in antigen-driven interactions between T cells and

    dendritic cells. J. Immunol. 176, 7254-7262.

    Biasini, E., Turnbaugh, J. A., Unterberger, U. and Harris, D. A. (2012). Prion

    protein at the crossroads of physiology and disease. Trends Neurosci. 35, 92-103.

    Bierings, R., Hellen, N., Kiskin, N., Knipe, L., Fonseca, A. V., Patel, B., Meli, A.,

    Rose, M., Hannah, M. J. and Carter, T. (2012). The interplay between the Rab27A

    effectors Slp4-a and MyRIP controls hormone-evoked Weibel-Palade body exocytosis.

    Blood 120, 2757-2767.

    Bravo-Cordero, J. J., Magalhaes, M. A., Eddy, R. J., Hodgson, L. and Condeelis,

    J. (2013). Functions of cofilin in cell locomotion and invasion. Nat. Rev. Mol. Cell

    Biol. 14, 405-415.

    Buensuceso, C., de, V. M. and Shattil, S. J. (2003). Detection of integrin alpha

    IIbbeta 3 clustering in living cells. J. Biol. Chem. 278, 15217-15224.

    Carman, C. V. and Springer, T. A. (2003). Integrin avidity regulation: are changes

    in affinity and conformation underemphasized? Curr. Opin. Cell Biol. 15, 547-556.

    Chan, J. R., Hyduk, S. J. and Cybulsky, M. I. (2001). Chemoattractants induce a

    rapid and transient upregulation of monocyte alpha4 integrin affinity for vascular cell

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • adhesion molecule 1 which mediates arrest: an early step in the process of emigration.

    J. Exp. Med. 193, 1149-1158.

    Chan, J. R., Hyduk, S. J. and Cybulsky, M. I. (2003). Detecting rapid and transient

    upregulation of leukocyte integrin affinity induced by chemokines and

    chemoattractants. J. Immunol. Methods 273, 43-52.

    Chen, E. J., Shaffer, M. H., Williamson, E. K., Huang, Y. and Burkhardt, J. K.

    (2013). Ezrin and moesin are required for efficient T cell adhesion and homing to

    lymphoid organs. PLoS. One. 8, e52368.

    Cinamon, G., Shinder, V. and Alon, R. (2001). Shear forces promote lymphocyte

    migration across vascular endothelium bearing apical chemokines. Nat. Immunol. 2,

    515-522.

    Colby, D. W. and Prusiner, S. B. (2011). Prions. Cold Spring Harb. Perspect. Biol.

    3, a006833.

    de Almeida, C. J., Chiarini, L. B., da Silva, J. P., PM, E. S., Martins, M. A. and

    Linden, R. (2005). The cellular prion protein modulates phagocytosis and

    inflammatory response. J. Leukoc. Biol. 77, 238-246.

    Eddy, R. J., Pierini, L. M., Matsumura, F. and Maxfield, F. R. (2000). Ca2+-

    dependent myosin II activation is required for uropod retraction during neutrophil

    migration. J. Cell Sci. 113, 1287-1298.

    Fehon, R. G., McClatchey, A. I. and Bretscher, A. (2010). Organizing the cell

    cortex: the role of ERM proteins. Nat. Rev. Mol. Cell Biol. 11, 276-287.

    Friedl, P. and Weigelin, B. (2008). Interstitial leukocyte migration and immune

    function. Nat. Immunol. 9, 960-969.

    Gomez-Mouton, C. and Manes, S. (2007). Establishment and maintenance of cell

    polarity during leukocyte chemotaxis. Cell Adh. Migr. 1, 69-76.

    Grabovsky, V., Feigelson, S., Chen, C., Bleijs, D. A., Peled, A., Cinamon, G.,

    Baleux, F., Arenzana-Seisdedos, F., Lapidot, T., van, K. Y. et al. (2000).

    Subsecond induction of alpha4 integrin clustering by immobilized chemokines

    stimulates leukocyte tethering and rolling on endothelial vascular cell adhesion

    molecule 1 under flow conditions. J. Exp. Med. 192, 495-506.

    Hyduk, S. J. and Cybulsky, M. I. (2009). Role of alpha4beta1 integrins in

    chemokine-induced monocyte arrest under conditions of shear stress.

    Microcirculation. 16, 17-30.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Isaacs, J. D., Jackson, G. S. and Altmann, D. M. (2006). The role of the cellular

    prion protein in the immune system. Clin. Exp. Immunol. 146, 1-8.

    Ivetic, A. and Ridley, A. J. (2004). Ezrin/radixin/moesin proteins and Rho GTPase

    signalling in leucocytes. Immunology 112, 165-176.

    Kent, D. G., Copley, M. R., Benz, C., Wohrer, S., Dykstra, B. J., Ma, E., Cheyne,

    J., Zhao, Y., Bowie, M. B., Zhao, Y. et al. (2009). Prospective isolation and

    molecular characterization of hematopoietic stem cells with durable self-renewal

    potential. Blood 113, 6342-6350.

    Konstandin, M. H., Sester, U., Klemke, M., Weschenfelder, T., Wabnitz, G. H.

    and Samstag, Y. (2006). A novel flow-cytometry-based assay for quantification of

    affinity and avidity changes of integrins. J. Immunol. Methods 310, 67-77.

    Langhorst, M. F., Reuter, A., Luxenhofer, G., Boneberg, E. M., Legler, D. F.,

    Plattner, H. and Stuermer, C. A. (2006). Preformed reggie/flotillin caps: stable

    priming platforms for macrodomain assembly in T cells. FASEB J. 20, 711-713.

    Lee, J. H., Katakai, T., Hara, T., Gonda, H., Sugai, M. and Shimizu, A. (2004).

    Roles of p-ERM and Rho-ROCK signaling in lymphocyte polarity and uropod

    formation. J. Cell Biol. 167, 327-337.

    Linden, R., Martins, V. R., Prado, M. A., Cammarota, M., Izquierdo, I. and

    Brentani, R. R. (2008). Physiology of the prion protein. Physiol Rev. 88, 673-728.

    Liu, L., Schwartz, B. R., Lin, N., Winn, R. K. and Harlan, J. M. (2002).

    Requirement for RhoA kinase activation in leukocyte de-adhesion. J. Immunol. 169,

    2330-2336.

    Lorenowicz, M. J., van, G. J., de, B. M., Hordijk, P. L. and Fernandez-Borja, M.

    (2006). Epac1-Rap1 signaling regulates monocyte adhesion and chemotaxis. J.

    Leukoc. Biol. 80, 1542-1552.

    Loubet, D., Dakowski, C., Pietri, M., Pradines, E., Bernard, S., Callebert, J.,

    Ardila-Osorio, H., Mouillet-Richard, S., Launay, J. M., Kellermann, O. et al.

    (2012). Neuritogenesis: the prion protein controls beta1 integrin signaling activity.

    FASEB J. 26, 678-690.

    Ludwig, A., Otto, G. P., Riento, K., Hams, E., Fallon, P. G. and Nichols, B. J.

    (2010). Flotillin microdomains interact with the cortical cytoskeleton to control

    uropod formation and neutrophil recruitment. J. Cell Biol. 191, 771-781.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Malaga-Trillo, E., Solis, G. P., Schrock, Y., Geiss, C., Luncz, L., Thomanetz, V.

    and Stuermer, C. A. (2009). Regulation of embryonic cell adhesion by the prion

    protein. PLoS. Biol. 7, e55.

    Mange, A., Milhavet, O., Umlauf, D., Harris, D. and Lehmann, S. (2002). PrP-

    dependent cell adhesion in N2a neuroblastoma cells. FEBS Lett. 514, 159-162.

    Margadant, C., Monsuur, H. N., Norman, J. C. and Sonnenberg, A. (2011).

    Mechanisms of integrin activation and trafficking. Curr. Opin. Cell Biol. 23, 607-614.

    Martinelli, S., Chen, E. J., Clarke, F., Lyck, R., Affentranger, S., Burkhardt, J. K.

    and Niggli, V. (2013). Ezrin/Radixin/Moesin proteins and flotillins cooperate to

    promote uropod formation in T cells. Front Immunol. 4, 84.

    Minamide, L. S., Striegl, A. M., Boyle, J. A., Meberg, P. J. and Bamburg, J. R.

    (2000). Neurodegenerative stimuli induce persistent ADF/cofilin-actin rods that

    disrupt distal neurite function. Nat. Cell Biol. 2, 628-636.

    Morel, E., Fouquet, S., Strup-Perrot, C., Pichol, T. C., Petit, C., Loew, D.,

    Faussat, A. M., Yvernault, L., Pincon-Raymond, M., Chambaz, J. et al. (2008).

    The cellular prion protein PrP(c) is involved in the proliferation of epithelial cells and

    in the distribution of junction-associated proteins. PLoS. One. 3, e3000.

    Mouillet-Richard, S., Ermonval, M., Chebassier, C., Laplanche, J. L., Lehmann,

    S., Launay, J. M. and Kellermann, O. (2000). Signal transduction through prion

    protein. Science 289, 1925-1928.

    Nourshargh, S., Hordijk, P. L. and Sixt, M. (2010). Breaching multiple barriers:

    leukocyte motility through venular walls and the interstitium. Nat. Rev. Mol. Cell Biol.

    11, 366-378.

    Petit, C. S., Besnier, L., Morel, E., Rousset, M. and Thenet, S. (2013). Roles of the

    cellular prion protein in the regulation of cell-cell junctions and barrier function.

    Tissue Barriers. 1, e24377.

    Prieto, J., Eklund, A. and Patarroyo, M. (1994). Regulated expression of integrins

    and other adhesion molecules during differentiation of monocytes into macrophages.

    Cell Immunol. 156, 191-211.

    Schrock, Y., Solis, G. P. and Stuermer, C. A. (2009). Regulation of focal adhesion

    formation and filopodia extension by the cellular prion protein (PrPC). FEBS Lett.

    583, 389-393.

    Shulman, Z., Shinder, V., Klein, E., Grabovsky, V., Yeger, O., Geron, E.,

    Montresor, A., Bolomini-Vittori, M., Feigelson, S. W., Kirchhausen, T. et al.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • (2009). Lymphocyte crawling and transendothelial migration require chemokine

    triggering of high-affinity LFA-1 integrin. Immunity. 30, 384-396.

    Smith, A., Bracke, M., Leitinger, B., Porter, J. C. and Hogg, N. (2003). LFA-1-

    induced T cell migration on ICAM-1 involves regulation of MLCK-mediated

    attachment and ROCK-dependent detachment. J. Cell Sci. 116, 3123-3133.

    Stuermer, C. A., Langhorst, M. F., Wiechers, M. F., Legler, D. F., Von Hanwehr,

    S. H., Guse, A. H. and Plattner, H. (2004). PrPc capping in T cells promotes its

    association with the lipid raft proteins reggie-1 and reggie-2 and leads to signal

    transduction. FASEB J. 18, 1731-1733.

    Troegeler, A., Lastrucci, C., Duval, C., Tanne, A., Cougoule, C., Maridonneau-

    Parini, I., Neyrolles, O. and Lugo-Villarino, G. (2014). An efficient siRNA-

    mediated gene silencing in primary human monocytes, dendritic cells and

    macrophages. Immunol. Cell Biol. 92, 699-708.

    Voermans, C., Anthony, E. C., Mul, E., van der Schoot, E. and Hordijk, P. (2001).

    SDF-1-induced actin polymerization and migration in human hematopoietic

    progenitor cells. Exp. Hematol. 29, 1456-1464.

    Walsh, K. P., Kuhn, T. B. and Bamburg, J. R. (2014). Cellular prion protein: A co-

    receptor mediating neuronal cofilin-actin rod formation induced by beta-amyloid and

    proinflammatory cytokines. Prion. 8, 375-380.

    Watts, J. C., Huo, H., Bai, Y., Ehsani, S., Jeon, A. H., Shi, T., Daude, N., Lau, A.,

    Young, R., Xu, L. et al. (2009). Interactome analyses identify ties of PrP and its

    mammalian paralogs to oligomannosidic N-glycans and endoplasmic reticulum-

    derived chaperones. PLoS. Pathog. 5, e1000608.

    Wegener, J., Keese, C. R. and Giaever, I. (2000). Electric cell-substrate impedance

    sensing (ECIS) as a noninvasive means to monitor the kinetics of cell spreading to

    artificial surfaces. Exp. Cell Res. 259, 158-166.

    Worthylake, R. A. and Burridge, K. (2003). RhoA and ROCK promote migration

    by limiting membrane protrusions. J. Biol. Chem. 278, 13578-13584.

    Worthylake, R. A., Lemoine, S., Watson, J. M. and Burridge, K. (2001). RhoA is

    required for monocyte tail retraction during transendothelial migration. J. Cell Biol.

    154, 147-160.

    Zhang, C. C., Steele, A. D., Lindquist, S. and Lodish, H. F. (2006). Prion protein is

    expressed on long-term repopulating hematopoietic stem cells and is important for

    their self-renewal. Proc. Natl. Acad. Sci. U. S. A 103, 2184-2189.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Figures

    Figure 1. PrP resides in cholesterol-rich membrane domains on the surface of

    human pro-monocytic U937 cells. (A) Detection of PrP in live cells by flow

    cytometry using the SAF32 antibody. Mouse IgG2b was used as isotype control. (B)

    Triton X-100 cell lysates were fractionated in Optiprep density gradients. Fractions

    were collected from the top, proteins precipitated with trichloroacetic acid and

    analyzed by immunoblotting for the presence of PrP, the lipid raft-marker flotillin-1

    and the non-lipid raft marker transferrin receptor (TfR). PrP and flotillin-1 were

    enriched in the top fractions consistent with their localization in lipid rafts. (C) U937

    cells were stimulated or not with 100 ng/mL CXCL12 for 10 min at 37°C and then

    cooled on ice for PrP and integrin detection with SAF32 (PrP) and P5D4 (β1 integrin

    subunit). Pearson’s colocalization coefficients between PrP and 1 integrin were

    determined in the selected ROI’s (A and B) depicted in the scheme, both in polarized

    and non-polarized cells. In polarized cells, A included the integrin cluster and B, the

    remaining membrane. In non-polarized cells, each, A and B, correspond to one half of

    the membrane. The A/B ratio indicates the relative colocalization measured in A with

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • respect to B. Scale bar, 10 µm. (D) Stable U937 cell lines were generated by

    puromycin-selection of cells transduced with lentiviruses expressing small hairpin

    RNAs to human PrP (shPrP-1, -2 and -3) or with non-targeting shRNA (shCtrl). PrP

    expression was examined by flow cytometry using the SAF32 anti-PrP Ab. Graphs

    represent the average of three independent transduction/ selection experiments.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Figure 2. PrP regulates U937 cell and primary monocyte adhesionto 1 integrin

    ligands. (A) CXCL12-induced migration of shCtrl- and shPrP-U937 cells was

    determined using a Transwell assay. Due to the inter-experimental variation of

    absolute migration values, the migration values of shCtrl-U937 were set to 100% to

    determine statistical significance of the differences. Data are from three independent

    experiments performed in triplicate. Statistical analysis was performed using 2-tailed

    unpaired Student t-test. (B) CXCL12-induced migration of U937 cells incubated with

    either anti-PrP SAF61 antibody or IgG2a was determined using a Transwell assay as

    in (A). (C) Representative ECIS experiment showing real-time changes in electrical

    resistance upon adhesion of shCtrl- and shPrP-U937 cells to FN or BSA. The black

    arrow indicates addition of cells to the electrodes and the green arrow indicates PMA

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • addition to stimulate cell adhesion. (D) PMA-stimulated adhesion of shCtrl- and

    shPrP-U937 to BSA and FN was determined dividing the resistance at t=1h by the

    resistance at t=0 after PMA addition (n=3). Statistical significance was analyzed using

    two-way ANOVA); (E) PMA-stimulated shCtrl- and shPrP-U937 cell adhesion to

    VCAM-1 and ICAM-1 was calculated as in (D) (n=6 for VCAM; n=4 for ICAM).

    Statistical significance was analyzed using two-way ANOVA. (F) ECIS adhesion

    assay of shCtrl- and shPrP-primary human monocytes as in C. (G) Quantification of

    PMA-stimulated adhesion as in (D) (n=3). Statistical significance was analyzed using

    unpaired two-tailed Student t-test.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Figure 3. PrP regulates U937 cell and primary monocyte adhesion to endothelial

    cells under shear stress. (A) Mixed populations of red-labelled shCtrl- and green-

    labelled were incubated with PMA or CXCL12 for 10 min before being perfused over

    TNF-stimulated endothelial monolayers. Upper panels show DIC and fluorescence

    snapshots of 30 min video recordings of U937 adhesion to the endothelium (arrow

    indicates the direction of flow). Lower panels show the result of image processing

    with ImageJ software to automatically count adherent U937 cells. Bar: 50 µm. (B)

    Graph shows the total number of CXCL12-stimulated cells adherent to the

    endothelium in three microscopic fields of a representative flow experiment. (C)

    Same as in (B) for PMA-stimulated cells. (D) Percentage of CXCL12-stimulated

    shCtrl- and shPrP-U937 cells adherent to the endothelium per microscopic field after

    10 min of flow (n=3). (E) Same as in (D) for PMA-stimulated cells. (F) Same as in

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • (D) for CXCL12-stimulated primary monocytes. Statistical analysis was performed

    using unpaired two-tailed Student t-test.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Figure 4. Defective uropod formation in migrating PrP-silenced cells. (A) shCtrl

    and shPrP-U937 cells were seeded on Fc-VCAM-1/ CXCL12-coated plates and

    recorded using a widefield microscope. Figure shows snapshots of these video

    recordings. Migrating shCtrl-U937 cells develop long uropods (arrowheads). In

    contrast, uropod formation is impaired in shPrP-U937 cells. Bar graphs represent the

    quantification of accumulated distance, cell velocity and directness by manual cell

    tracking using Gradientech Tracking Tool software. Statistical analysis was

    performed using two-tailed unpaired Student t-test. (B) shCtrl- and shPrP-U937 cells

    were seeded on Fc-VCAM-1 and CXCL12-coated IBIDI -slides, allowed to migrate

    for 20 min, and processed for immunofluorescence detection of phospho-ERM

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • proteins and 1 integrins. The bar graph shows the average length of the uropod in

    cells migrating on VCAM as described above (n=3, ≥40 cells (each for shCtrl- and

    shPrP-U937 cells) per experiment). Statistical analysis was performed using unpaired

    two-tailed Student’s t-test. Bar: 20 m (C) shPrP-U937 cells were transfected with

    GFP-PrP or GFP (negative control) cDNA by electroporation and sorted by flow

    cytometry to enrich for transfected cells. Sorted cells were seeded on immobilized Fc-

    VCAM-1/ CXCL12 and fixed after for 20 min for the immunodetection of 1

    integrins and PrP. The bar graph shows average uropod length in GFP-PrP and GFP-

    expressing cells (n=3). Statistical analysis was performed using unpaired two-tailed

    Student’s t-test. Bar: 10 m.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Figure 5. PrP silencing impairs ERM protein activation. (A) Phosphorylated ERM

    proteins were detected with an antibody that recognizes a phosphorylated threonine

    residue conserved in all three proteins. Blots were reprobed with antibodies against

    total moesin. Quantification of band density was performed as described in the

    methods section (n=5). Statistical analysis was done using two-way ANOVA

    (Bonferroni’s multiple comparisons test). Since this test takes into account all the time

    points, differences at t=0 of CXCL12 stimulation, although with similar values as t=0

    for PMA stimulation, is not significant when compared with later time points. (B)

    CD44 and flotillin-1 were immunodetected in shCtrl- and shPrP-U937 cells migrating

    on immobilized VCAM. Bar: 10 m.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Figure 6. Increased motility and membrane protrusive activity of PrP-deficient

    U937 cells on the endothelium under shear stress. (A) DIC and fluorescence

    snapshots of a video recording of PMA-stimulated calcein Red-Orange-labeled

    shCtrl-U937 cells and calcein Green-labeled shPrP-U937 cells on TNF-activated

    endothelial cells under shear stress. ShPrP-U937 cells undergo shape changes while

    crawling over the endothelium (lower green cell) while the shCtrl-U937 cell is

    motionless and maintains a spherical shape. Time is indicated on the figures in

    min:sec. (B) Percentage of shCtrl- and shPrP-U937 cells that displayed dynamic

    membrane protrusions after adhesion to endothelial cells under flow (n=3). (C)

    Percentage of adherent shCtrl- and shPrP-U937 cells that migrated across the

    endothelium (n=3). Statistical analysis was performed using unpaired two-tailed

    Student’s t-test.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Figure 7. PrP regulates integrin avidity. (A) Flow cytometry analysis of total and

    activated 1 integrins on shCtrl- (black line) and shPrP- (red line) U937 cells treated

    or not with CXCL12, PMA or Mn2+ for 10 min at 37°C. Cells were incubated with

    mouse IgG1 as isotype control (grey shaded area). No differences for total or

    activated integrins were detected between shCtrl- and shPrP-U937. (B) Cells were

    stimulated for different time-points with CXCL12, PMA or Mn2+ in the presence of

    Fc-VCAM. Cell-bound Fc-VCAM was detected with APC-labelled F(ab’)2 goat anti

    human IgG and analyzed by flow cytometry (n=3). (C) Similar experiment as in (B)

    except that cells were mixed with pre-formed multimeric Fc-VCAM/ F(ab’)2-APC

    complexes (n=3). Statistical analysis was performed using two-way ANOVA.

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t

  • Figure 8. PrP silencing enhances RhoA activation. (A) A pull-down assay was used

    to assess the levels of GTP-bound active RhoA in shCtrl- and shPrP-U937 stimulated

    with CXCL12 or PMA for the indicated times (in min). Total RhoA was detected in

    the corresponding whole cell lysates for input. Graphs represent quantification of the

    bands as described in the methods section (n=6). (B) Cell F-actin content was

    determined at different time points of CXCL12 stimulation by flow cytometry using

    Alexa488-labelled phaloidin (n=3). (C) Cells were incubated for 30 min at 37°C with

    1 or 5 m cytochalasin B and subsequently seeded on electrode arrays for the ECIS

    adhesion assay. Figure shows a representative graph corresponding to one of three

    independent experiments showing changes in adhesion from the moment of cell

    addition. Bar graph represents the increase in resistance from the moment of cell

    addition until 1h after PMA addition (n=3). (D) Phospho-cofilin and total cofilin were

    detected by immunoblotting of cell lysates of cells after 30 min adhesion to

    immobilized Fc-VCAM. Bar graphs show the quantification of band densities of three

    independent experiments. Statistical analysis was performed using two-way ANOVA

    (A, B, C) and two-tailed Student’s t-test (D).

    Jour

    nal o

    f Cel

    l Sci

    ence

    Acc

    epte

    d m

    anus

    crip

    t