Draft

Calpain inhibitor attenuates atherosclerosis and

inflammation in atherosclerotic rats through eNOS/NO/NF-κB pathway

Journal: Canadian Journal of Physiology and Pharmacology

Manuscript ID cjpp-2016-0652.R1

Manuscript Type: Article

Date Submitted by the Author: 07-Mar-2017

Complete List of Authors: Yu, Lan; Liaoning Medical University

Yin, Meihui; Liaoning Medical University, Yang, Xueyan; Liaoning Medical University, Lu, Meili; Liaoning Medical University, Tang, Futian; Liaoning Medical University Wang, Hongxin; Liaoning Medical University,

Is the invited manuscript for consideration in a Special

Issue?:

Keyword: calpain inhibitor CAI, atherosclerosis, nitric oxide, endothelial nitric oxide synthase, NF-κB

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

Calpain inhibitor attenuates atherosclerosis and inflammation in atherosclerotic

rats through eNOS/NO/NF-κB pathway

Lan Yu *ab

, Meihui Yin *a

, Xueyan Yang ac

, Meili Lu

a, Futian Tang

a, Hongxin Wang

a

a Key Laboratory of Cardiovascular and Cerebrovascular Drug Research of Liaoning

Province, Jinzhou Medical University, Jinzhou 121001, China

b Central Hospital of Yingkou Development Areas, Yingkou, 115007, China

c Internal Medicine-Cardiovascular Departments, the First Affiliated Hospital of Jinzhou

Medical University, Jinzhou 121001, China

Corresponding authors: Futian Tang (email: tangft@163.com) and Hongxin Wang (email:

tangfutian690515@163.com)

*These authors contributed equally to this work.

Page 1 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

Abstract:

We previously reported that calpain, the Ca2+

-sensitive cysteine protease, gets involved in

the atherogenesis. This study was to investigate the effects of calpain inhibitor (CAI, 5

mg/kg/d) with or without NG-nitro-L-arginine-methyl ester (L-NAME) (100 mg/kg/d), the

inhibitor of nitric oxide synthase (NOS), on atherosclerosis and inflammation in rat

model induced by high cholesterol diet (HCD). The results demonstrated HCD increased

protein expression of calpain-1 but not calpain-2 in aortic tissue. In addition, CAI reduced

the thickness of atherosclerotic intima compared to HCD group, which was weakened by

the L-NAME combination. CAI with or without L-NAME decreased the activity of

calpain in the aorta. Besides, CAI decreased the expressions of vascular cell adhesion

molecule-1 (VCAM-1), intracellular cell adhesion molesul-1 (ICAM-1) and monocyte

chemoattractant protein-1 (MCP-1) in the aorta at the levels of both mRNA and protein.

Furthermore, CAI increased the activity and the protein expression of endothelial NOS

(eNOS) accompanied by increased content of NO and down-regulated the protein

expression of nuclear factor κB (NF-κB) of the nucleus in the aorta. However, the

above-mentioned effects were at least partly cancelled by L-NAME except for the protein

expression of eNOS. The results suggested that CAI attenuated atherosclerosis and

inflammation through eNOS/NO/NF-κB pathway.

Key Words: calpain inhibitor CAI, atherosclerosis; nitric oxide; endothelial nitric oxide

synthase; NF-κB

Introduction

Atherosclerosis has been reported to be the main cause of coronary artery disease

(CAD) and stroke (Peters et al. 2012). Vascular endothelial dysfunction-mediated

inflammatory response gets involved in the initiation and development of atherosclerosis.

Endothelial dysfunction contributes to atherosclerosis largely due to the decrease in

bioavailability of nitric oxide (NO) which is originated from endothelial NO synthase

(eNOS) (Sharma et al. 2015). Compared with apolipoprotein E knockout (ApoE KO)

mice, ApoE/eNOS double KO mice showed the increase in atherosclerotic lesion, which

suggested that eNOS protects the ApoE KO mice against the development of

Page 2 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

atherosclerosis (Kus et al. 2014). In addition, the combination of a NO-donating property

enhances the anti-atherogenic activity of atorvastatin (Momi et al. 2012). Endothelial

dysfunction-mediated inflammation contributes to the atherogenesis largely depending on

the induction of expression of inflammatory molecules including intercellular adhesion

molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) and monocyte

chemoattractant protein-1 (MCP-1) (Shah et al. 2015). Release impairment of NO from

endothelial cells leads to the up-regulation of ICAM-1, VCAM-1 and that NO synthesis

inhibition increases the gene expression of MCP-1 in endothelial cells (Kang et al. 2005;

Khan et al. 1996; Sohn et al. 2005a). Administration of NO donors to the animal deficient

in NO maintains the endothelial function and inhibits pathological interactions between

leukocytes in the circulation and the vascular endothelium (De Caterina et al. 1995; Sohn

et al. 2005b). In addition, the expressions of ICAM-1, VCAM-1 and MCP-1 are

associated with the activation of nuclear factor κB (NF-κB), a transcription protein

(Zeiher et al. 1995). In the physiological state, as a heterodimer of the p50 and p65

subunits, NF-κB stays in the cytoplasm. However, upon stimulation in the pathological

state, p50 and p65 can go to the nucleus, where affecting the expression of genes such as

ICAM-1, VCAM-1 and MCP-1 (Hall et al. 2006; Jones et al. 2003).

Calpains, the Ca2+

dependent cysteine proteases, strictly regulate their substrate

proteins by the limited proteolysis (Subramanian et al. 2012). Calpain family is

comprised of 15 homologues of catalytic subunits and 2 homologues of regulatory

subunits. Among the superfamily, Calpain-1 and calpain-2 are categorized as

“conventional calpain” (Daugherty et al. 2000). By using pharmacological inhibitors or

mice deficient in calpain-1 or calpain-2 or mice over-expressing calpastatin, the

endogenous inhibitor, many studies demonstrated that inactivation of calpain inhibited

atherosclerosis, suggesting the involvement of calpains in the development of

atherosclerosis (Clinkinbeard et al. 2013; Hua and Nair 2015; Miyazaki et al. 2013;

Ruetten and Thiemermann 1997; Takeshita et al. 2013). We previously reported that

calpain-1 gets involved in the atherogenesis by up-regulating the scavenger receptor

CD36 expression (Yang et al. 2016). In addition to conventional calpain, one of

unconventional calpain isozyme, calpain-6, appears to be induced in macrophages during

atherogenesis, thereby facilitating form cell formation (Miyazaki et al. 2016). Calpains

Page 3 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

have also been implicated to play a critical deleterious role in endothelial dysfunction

(Stalker et al. 2003). Activated calpain by Ca2+

damages the cells by the selective

degradation of the proteins such as eNOS and IκB (Averna et al. 2008; Dong et al. 2009).

Calpains also mediates the inflammatory processes via the NF-κB activation (Li et al.

2014). Taken together, these studies indicated that calpains get involved in the

atherosclerosis largely through endothelial dysfunction and inflammatory response.

Nevertheless, the molecular mechanisms underlying the involvement remain to be

investigated. This study was to evaluate the significance of NO in the inhibition of

atherosclerosis by calpain inhibitor CAI in rat model with early atherosclerosis induced

by high dose of vitamin D2 and diet with high content of cholesterol. The results

demonstrated that CAI inhibited the atherosclerosis through eNOS/NO/NF-κB pathway.

Materials and methods

Chemicals

Calpain inhibitor I (N-acetyl-leu-leu-norleucinal, CAI) was the product of Santa Cruz

Biotechnology (sc-29119, MW: 383.5). NG-nitro-L-arginine-methyl ester (L-NAME) was

purchased from Beyotime Institute of Biotechnology, Shanghai, China.

Atherosclerosis model of rats

The study was approved by the Committee on the Ethics of Animal Experiments of the

Jinzhou Medical University, China (Permit Number LNMU-2015-118) and performed in

accordance with the Guide for the Care and Use of Laboratory Animals of the National

Institutes of Health (Institute of Laboratory Animal Resources (U.S.). Committee on Care

and Use of Laboratory Animals.). Thirty-two six-week-old male Sprague–Dawley (SD)

rats (Animal Center, Jinzhou Medical University, China) were randomly and equally

divided into Control, HCD, CAI and CAI+ L-NAME groups. The atherosclerotic rat

model was established as described previously (Tang et al. 2006a). Briefly, vitamin D2

(300,000 IU/kg/day) (Sigma) was given to all rats by gavage for 4 days followed by fed

with animal chow in control group (Con) and high cholesterol diet (HCD) containing 2%

cholesterol in HCD, CAI and CAI+ L-NAME groups for 8 weeks. Rats in CAI and CAI+

Page 4 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

L-NAME groups were intraperitoneally injected CAI (0.5mg/kg/day) combined with or

without L-NAME (100 mg/kg/d). At the end of the experiment, the blood was collected

from eyes of rats under light anesthesia by ether from which serum was separated for

biochemical analysis. The rats were then sacrificed by peritoneal injection of over dose of

pentobarbital sodium (30 mg/kg) and the aortic issue was separated.

Morphological changes in aortic arch

Six-micrometer-thick section of aortic arch fixed in 10% formalin was stained with

hematoxylin and eosin as previously reported method (Tang et al. 2007) and the ratio of

thickness between intima (I) and intima plus media (I+M) was calculated.

Contents of cholesterol in aorta and lipid profiles in serum

Cholesterol content in lysate of aorta and the serum levels of total cholesterol (TC),

triacylglycerol (TG), low density lipoprotein (LDL) cholesterol and high density

lipoprotein (HDL) cholesterol were determined using kit from Beijing Zhongsheng

Bioengineering Company (China) as previously reported method (Tang et al. 2007; Tang

et al. 2006a).

Activity of calpain in aorta

Calpain activity in lysate of aorta was measured using a fluorescence substrate

N-succinyl-LLVY-AMC (Amyjet Scientific Inc, China) as previously reported method

(Tang et al. 2015).

Content of NO and eNOS activity in aorta

NO content and eNOS activity in lysate of aorta was determined using kit from

Nanjing Jiancheng Bioengineering Company (China) as previously reported method

(Tang et al. 2006b).

Immunohistochemical analysis of eNOS in vascular endothelia

Sections of aortic arch were used to determine the protein expression of eNOS as

previously reported method (Tang et al. 2007). The first and second antibody was rabbit

Page 5 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

anti-rat eNOS and sheep anti-rabbit IgG-peroxidase antibodies provided by Abcam

Company (Cambridge, MA, USA) respectively.

Contents of VCAM-1, ICAM-1 and MCP-1 in aorta

Contents of VCAM-1, ICAM-1 and MCP-1 in lysate of aorta was measured using

ELISA kits from R&D Systems (Minneapolis, MN, USA) as previously reported method

(Tang et al. 2016). The color absorbance at 450 nm was measured using a Bio-Rad

microplate reader.

mRNA expression of ICAM-1, VCAM-1 and MCP-1 in aorta

The mRNA expression of ICAM-1, VCAM-1 and MCP-1 in aorta was analyzed using

the BioRad iQ5 Real Time PCR system (BioRad Company) as previously reported

method (Tang et al. 2016). Primers used for qPCR are provided in Table 1.

Table 1. Primers used for qPCR.

Genes Forward primer(5’-3’) Reverse primer(5’-3’) GAPDH

MCP-1

ICAM-1

VCAM-1

CCACCCATGGCAAATTCCATGGCA

CTCACCTGCTGCTACTCATTCAC

GTGATGCTCAGGTATCCATCCA

GTTCCAGCGAGGGTCTACC

TCTAGACGGCAGGTCAGGTCCACC

ATGTCTGGACCCATTCCTTCTTG

CACAGTTCTCAAAGCACAGCG

AACTCTTGGCAAACATTAGGTGT

Protein expressions of calpain-1, calpain-2, CD68, eNOS and NF-κB in aorta

The protein expression of calpain-1, calpain-2, CD68, eNOS and p65 in aorta was

examined using Western blot as previously reported method (Luan et al. 2015; Tang et al.

2016). Nuclear proteins in aortic tissue were separated using Nuclear and Cytoplasm

Extraction Kit (Active Motif provided by Dakewe Biotech Limited, China) as previously

reported method (Tang et al. 2016). Antibodies against eNOS (1.1000), p65 (1:1500),

lamin B (1:1000) and GAPDH (1:500) were from Abcam (Cambridge, MA, USA).

Antibodies against calpain-1 (1:1000), calpain-2 (1:1000) and CD68 (1:2000) were from

Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Statistical analysis

Data are shown as the mean ±SEM and analyzed by one-way analysis of variance

(ANOVA) and the t-test using SPSS 17.0 software. P<0.05 showed the statistically

Page 6 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

significant difference.

Results

CAI reduces the atherosclerosis and CD68 protein expression independent of the

serum lipid profiles

As shown in Figure 1, rats in HCD group demonstrated the significant increases in the

ratio of I to (I+M) (Figure 1A and 1B), the cholesterol content (Figure 1C) and CD68

protein expression (Figure 1D) in the aorta, all representing the formation of

atherosclerosis. However, these increases were attenuated by CAI, the specific calpain

inhibitor, suggesting that activation of calpain implies in the pathogenesis of

atherosclerosis. In addition, combination of L-NAME, the specific NOS inhibitor, with

CAI partly abolished the inhibitory effects of CAI on atherosclerosis. The results

indicated that CAI reduces the atherosclerosis at least partly through regulation of

NOS/NO pathway. Furthermore, both CAI and L-NAME did not affect the lipid profiles

in serum changed by HCD (Figure 1E), suggesting that the actions of CAI and L-NAME

on atherosclerosis are independent of serum lipid profiles.

CAI inactivates calpain without affecting the protein expressions of calpain-1 and

calpain-2

Calpain activity (Figure 2A) and calpain-1 protein expression (Figure 2B) in aortic

tissue of rats in HCD group increased compared with that of control rats. CAI reduced the

calpain activity without affecting the protein expression of calpain-1. Calpain activity

was comparable between CAI and CAI+ L-NAME groups. CAI in combination with or

without L-NAME had no effect on calpain-1 protein expression compared with HCD. In

addition, the protein expression of calpain-2 was unchanged among all four groups.

These results suggested that inactivation of calpain rather than down-regulation of

calpain-1 or calpain-2 protein expression by CAI contributes the inhibition of

atherosclerosis.

CAI increases the NO content and the activity and protein expression of eNOS in

Page 7 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

aorta

NO synthesized by eNOS exerts effect of anti-atherosclerosis. In order to investigate

the involvement of eNOS/NO in the inhibition of atherosclerosis by CAI, we examined

the content of NO, the activity and protein expression of eNOS in aorta. The results

showed the significant decreases in the NO content (Figure 3A) and eNOS activity

(Figure 3B) and protein expression (Figure 3C and 3D) in rat aorta of HCD group

compared with that in control group, suggesting that deficiency of NO production might

contribute to the atherosclerosis. However, these decreases were changed inversely by

CAI. Expectedly, combination of L-NAME with CAI partly reduced the effects of CAI on

NO content and eNOS activity without affecting the eNOS protein expression. Taken

together, the results further confirmed the hypothesis that enhancement of eNOS/NO

pathway gets involved in the inhibition of CAI on atherosclerosis.

CAI inhibits the expressions of ICAM-1, VCAM-1 and MCP-1 in aorta

The results indicated that the mRNA and protein expressions of vascular inflammatory

molecules ICAM-1 (Figure. 4A and 4B), VCAM-1 (Figure. 4C and 4D) and MCP-1

(Figure. 4E and 4F) in HCD group significantly increased compared with that in control

group. However, these increases were reduced by CAI, which might at least partly

explain the mechanism underlying the inhibition of atherosclerosis by CAI. In addition,

combination of L-NAME with CAI partly abolished the effects of CAI on these

inflammatory molecules. Taken together, the results indicated that inhibition of

inflammation by CAI might be consequence of the enhancement of eNOS/NO pathway.

CAI reduces the NF-κB translocation into nucleus of aorta

NF-κB activation and nuclear translocation regulates the inflammation. Therefore, we

examined the protein expression of p65, the subunit of NF-κB in both cytoplasm and

nucleus of aorta to clarify the mechanisms underlying the regulation of inflammation by

CAI. The results showed that p65 protein expression significantly decreased in cytoplasm

(Figure. 5A), while increased in nucleus (Figure. 5B) in HCD group compared with that

in control group. However, the translocation was partly inhibited by CAI. Furthermore,

combination of L-NAME with CAI partly abolished the effects of CAI on nuclear

Page 8 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

translocation of NF-κB. Collectively, the results indicated that attenuation of

inflammation by CAI might be attributed to the inhibition of nuclear translocation of

NF-κB.

Discussion

We reported in this study that CAI, the specific inhibitor of calpain, attenuated the

atherosclerosis, increased the activity and the protein expression of eNOS, elevated the

content of NO, down-regulated the expression of ICAM-1, VCAM-1 and MCP-1 and

inhibited the nuclear translocation of NF-κB in aorta. However, all the beneficial effects

of CAI were partly abolished by L-NAME, the specific inhibitor of NOS, except for the

protein expression of eNOS. The results suggested that CAI inhibited the atherosclerosis

through eNOS/NO/NF-κB pathway.

By using pharmacological inhibitors or mice deficient in calpain-1 or calpain-2 or mice

over-expressing calpastatin, the endogenous inhibitor, many studies demonstrated that

inactivation of calpain inhibited the atherosclerosis, suggesting that calpains gets

involved in the pathogenesis of atherosclerosis (Clinkinbeard et al. 2013; Hua and Nair

2015; Miyazaki et al. 2013; Ruetten and Thiemermann 1997; Takeshita et al. 2013).

Expectedly, the present results demonstrated that CAI attenuated the atherosclerotic

lesion and reduced the vascular content of cholesterol in rats fed with high cholesterol

diet and excessive vitamin D. However, combination of CAI with L-NAME partly

abolished the inhibitory effect on atherosclerosis by CAI, suggesting that regulation of

endothelial NOS/NO pathway might contribute the inhibitory effect of CAI on

atherosclerotic lesions. Accumulative studies reported that the increase in production of

endothelial NO protected animals against atherosclerosis (De Caterina et al. 1995; Momi

et al. 2012; Zeiher et al. 1995). Regarding the roles of calpain-1 and calpain-2 in the

formation of atherosclerosis, both calpain-1 and calpain-2 are reportedly expressed in

macrophages in angiotensin II-infused athero-prone aorta, and are associated with their

inflammatory responses (Howatt et al. 2016). In addition, calpain-2 appears to be

upregulated in vascular endothelium during atherogenesis, and is contributed to

endothelial barrier dysfunction (Miyazaki et al. 2011). We examined the protein

expression of calpain-1 and calpain-2 in the aortic tissue and found that protein

Page 9 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

expression of calpain-1 rather than calpain-2 in atherosclerotic rat model increased

compared with that of control rats, suggesting that calpain-1 but not calpain-2 plays

important role in the formation of atherosclerosis of rat model. The present result was not

consistent with these reports and the inconsistency might be attributed to the different

animal models.

To further clarify the involvement of eNOS/NO pathway in the mechanism underlying

the inhibition of CAI on atherosclerosis, we examined the NO content, eNOS activity and

protein expression in aorta. As expected, CAI increased the eNOS activity and the

content of NO in aorta. In addition, CAI up-regulated eNOS protein expression in aortic

tissue assessed by both western blot and in endothelia evaluated by immunohistochemical

method. Consistently, combination of L-NAME weakened the effects of CAI on the

content of NO and eNOS activity without affecting the eNOS protein expression. The

results directly confirmed that the attenuation of the atherosclerosis by CAI was at least

partly mediated through eNOS/NO pathway. The present study was well in agreement

with the following reports. Kus et al. compared the atherosclerotic lesion between ApoE

KO mice and ApoE/eNOS double KO mice and found the increase in atherosclerotic

lesion in the latter mice, which suggested that eNOS plays the protective role against

atherosclerosis (Kus et al. 2014). Momi et al. reported that NO-donating property

enhances the anti-inflammatory and anti-atherogenic activity of atorvastatin (Momi et al.

2012). Regarding the possible mechanisms underlying the improvement of eNOS/NO

pathway by CAI, Averna et al. reported that incubation of endothelial cells in

Ca2+

-loading medium for a long time caused the degradation of eNOS through calpain

activation. The eNOS degradation further resulted in significant decrease in NO

production (Averna et al. 2008). Dong et al. also found that impaired endothelial function

was attributed to eNOS degradation mediated by calpain (Dong et al. 2009). Nevertheless,

the exact mechanisms need further investigated.

Inflammatory process is implied in atherosclerosis. To investigate the down-stream

response to the improvement of eNOS/NO pathway by CAI, we examined the

expressions of inflammatory molecules ICAM-1, MCP-1 and VCAM-1 in aorta at the

protein and mRNA levels. The results demonstrated that CAI lowered the expressions of

ICAM-1, VCAM-1 and MCP-1, which was partly reversed by combination of L-NAME.

Page 10 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

These results indicated that inhibition of inflammation by CAI was mediated by the

improvement of eNOS/NO pathway. Consistently, studies using atherosclerotic model

mice lacking of VCAM-1 or MCP gene or the mice over-expressing MCP-1 gene, have

showed the importance of these gene in atherogenesis (Cybulsky et al. 2001; Nelken et al.

1991). Furthermore, NO synthesis inhibition by high dosage of L-NAME to rats induces

vascular inflammation and atherosclerosis (Kataoka et al. 2004). These investigations

indicate that inflammation responses in atherogenesis are closely linked with the impaired

NO synthesis, and therefore improvement of NO production might be one of the

approaches for anti-inflammation, and anti-atherosclerosis. Regarding the mechanisms by

which calpain regulates the eNOS/NO function, subsequently inducing the inflammation,

there is study revealing that glucose induces loss of NO via a calpain-dependent decrease

in the association of heat shock protein 90 (hsp90) with eNOS (Stalker et al. 2003). In

addition, inhibition of calpain activity decreased endothelial cell surface expression of the

pro-inflammatory adhesion molecules ICAM-1 and VCAM-1 during hyperglycemia

(Stalker et al. 2003). These data demonstrate that calpains contribute to important

inflammatory events during hyperglycemia and that pharmacological inhibition of calpain

activity attenuates leukocyte endothelium interactions and preserves eNOS function.

The expressions of inflammatory molecules can be up-regulated by NF-κB activation.

In the physiological state, as a heterodimer of the p50 and p65 subunits, NF-κB stays in

the cytoplasm. However, upon stimulation in the pathological state, p50 and p65 can go

to the nucleus, where affecting the expression of genes such as ICAM-1, VCAM-1 and

MCP-1 (Chen et al. 1995). To examine the mechanism underlying the

eNOS/NO-mediated inhibition of inflammation by CAI, we observed the effect of CAI

on p65 translocation into nucleus. The study demonstrated that CAI attenuated the p65

nuclear translocation, which was partly abolished by combination of L-NAME. Part of

this result was supported by the finding that knockdown of endogenous P65 in HUVECs

through siRNA decreased the expressions of ICAM-1 and VCAM-1 at the mRNA and

protein levels (Wu et al. 2014). Taken together, these results indicated that CAI inhibited

the endothelial inflammation at least in part through eNOS/NO mediated attenuation of

p65 translocation into nucleus, subsequently reducing the atherosclerosis.

In summary, the results suggested that CAI attenuated the inflammation and

Page 11 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

atherosclerosis in rats through eNOS/NO/NF-κB pathway.

This study has several limitations. Firstly, HCD+L-NAME group should be assigned to

investigate the effect of L-NAME alone on the atherosclerosis, which might exclude the

direct effect of L-NAME on the atherosclerosis. Secondly, the use of non-selective

inhibitor of NOS, L-NAME can not exclude the facts that other isoforms of NOS, as well

as arginase might be also involved in pathogenesis, which requires the use of selective

inhibitor of NOS in the future study. Finally, the study lacks the mechanisms by which

calpain regulates the eNOS/NO pathway, which requires further investigation in the

future study, e.g. by checking the dissociation of HSP90 from eNOS.

Declarations

Conflict of interest

The authors declare that they have no competing interests.

Acknowledgment

This work was supported by National Natural Science Foundation of China

(No.81374008), Talent Fund of Liaoning Medical University (No. 2014-18) and Natural

Science Foundation of Liaoning Province (No. 2015020325). We thank Yingjie Zhang

for her critical suggestions in the revision of our manuscript.

Reference

Averna, M., Stifanese, R., De Tullio, R., Passalacqua, M., Salamino, F., Pontremoli, S.,

and Melloni, E. 2008. Functional role of HSP90 complexes with endothelial

nitric-oxide synthase (eNOS) and calpain on nitric oxide generation in endothelial cells.

J. Biol. Chem. 283(43): 29069-29076. doi: 10.1074/jbc.M803638200.

Chen, C.C., Rosenbloom, C.L., Anderson, D.C., and Manning, A.M. 1995. Selective

inhibition of E-selectin, vascular cell adhesion molecule-1, and intercellular adhesion

molecule-1 expression by inhibitors of I kappa B-alpha phosphorylation. J. Immunol.

155(7): 3538-3545.

Clinkinbeard, T., Ghoshal, S., Craddock, S., Creed Pettigrew, L., and Guttmann, R.P.

2013. Calpain cleaves methionine aminopeptidase-2 in a rat model of

ischemia/reperfusion. Brain Res. 1499: 129-135. doi: 10.1016/j.brainres.2012.12.039.

Cybulsky, M.I., Iiyama, K., Li, H., Zhu, S., Chen, M., Iiyama, M., Davis, V.,

Gutierrez-Ramos, J.C., Connelly, P.W., and Milstone, D.S. 2001. A major role for

Page 12 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

VCAM-1, but not ICAM-1, in early atherosclerosis. J. Clin. Invest. 107(10):

1255-1262. doi: 10.1172/JCI11871.

Daugherty, A., Manning, M.W., and Cassis, L.A. 2000. Angiotensin II promotes

atherosclerotic lesions and aneurysms in apolipoprotein E-deficient mice. J. Clin.

Invest. 105(11): 1605-1612. doi: 10.1172/JCI7818.

De Caterina, R., Libby, P., Peng, H.B., Thannickal, V.J., Rajavashisth, T.B., Gimbrone,

M.A., Jr., Shin, W.S., and Liao, J.K. 1995. Nitric oxide decreases cytokine-induced

endothelial activation. Nitric oxide selectively reduces endothelial expression of

adhesion molecules and proinflammatory cytokines. J. Clin. Invest. 96(1): 60-68. doi:

10.1172/JCI118074.

Dong, Y., Wu, Y., Wu, M., Wang, S., Zhang, J., Xie, Z., Xu, J., Song, P., Wilson, K., Zhao,

Z., Lyons, T., and Zou, M.H. 2009. Activation of protease calpain by oxidized and

glycated LDL increases the degradation of endothelial nitric oxide synthase. J. Cell

Mol. Med. 13(9A): 2899-2910. doi: 10.1111/j.1582-4934.2008.00416.x.

Hall, G., Hasday, J.D., and Rogers, T.B. 2006. Regulating the regulator: NF-kappaB

signaling in heart. J. Mol. Cell Cardiol. 41(4): 580-591. doi:

10.1016/j.yjmcc.2006.07.006.

Howatt, D.A., Balakrishnan, A., Moorleghen, J.J., Muniappan, L., Rateri, D.L., Uchida,

H.A., Takano, J., Saido, T.C., Chishti, A.H., Baud, L., and Subramanian, V. 2016.

Leukocyte Calpain Deficiency Reduces Angiotensin II-Induced Inflammation and

Atherosclerosis But Not Abdominal Aortic Aneurysms in Mice. Arterioscler. Thromb.

Vasc. Biol. 36(5): 835-845. doi: 10.1161/ATVBAHA.116.307285.

Hua, Y., and Nair, S. 2015. Proteases in cardiometabolic diseases: Pathophysiology,

molecular mechanisms and clinical applications. Biochim. Biophys. Acta 1852(2):

195-208. doi: 10.1016/j.bbadis.2014.04.032.

Institute of Laboratory Animal Resources (U.S.). Committee on Care and Use of

Laboratory Animals. Guide for the care and use of laboratory animals. In NIH

publication. U.S. Dept. of Health and Human Services, Public Health Service,

Bethesda, Md. p. v.

Jones, W.K., Brown, M., Ren, X., He, S., and McGuinness, M. 2003. NF-kappaB as an

integrator of diverse signaling pathways: the heart of myocardial signaling? Cardiovasc.

Toxicol. 3(3): 229-254.

Kang, D.G., Moon, M.K., Choi, D.H., Lee, J.K., Kwon, T.O., and Lee, H.S. 2005.

Vasodilatory and anti-inflammatory effects of the

1,2,3,4,6-penta-O-galloyl-beta-D-glucose (PGG) via a nitric oxide-cGMP pathway. Eur.

J. Pharmacol. 524(1-3): 111-119. doi: 10.1016/j.ejphar.2005.08.061.

Kataoka, C., Egashira, K., Ishibashi, M., Inoue, S., Ni, W., Hiasa, K., Kitamoto, S., Usui,

M., and Takeshita, A. 2004. Novel anti-inflammatory actions of amlodipine in a rat

model of arteriosclerosis induced by long-term inhibition of nitric oxide synthesis. Am.

J. Physiol. Heart Circ. Physiol. 286(2): H768-774. doi: 10.1152/ajpheart.00937.2002.

Khan, B.V., Harrison, D.G., Olbrych, M.T., Alexander, R.W., and Medford, R.M. 1996.

Nitric oxide regulates vascular cell adhesion molecule 1 gene expression and

redox-sensitive transcriptional events in human vascular endothelial cells. Proc. Natl.

Acad. Sci. U S A 93(17): 9114-9119.

Kus, K., Wisniewska, A., Toton-Zuranska, J., Olszanecki, R., Jawien, J., and Korbut, R.

2014. Significant deterioration of anti-atherogenic efficacy of nebivolol in a double

Page 13 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

(apolipoprotein E and endothelial nitric oxide synthase) knockout mouse model of

atherosclerosis in comparison to single (apolipoprotein E) knockout model. J. Physiol.

Pharmacol. 65(6): 877-881.

Li, X., Luo, R., Chen, R., Song, L., Zhang, S., Hua, W., and Chen, H. 2014. Cleavage of

IkappaBalpha by calpain induces myocardial NF-kappaB activation, TNF-alpha

expression, and cardiac dysfunction in septic mice. Am. J. Physiol. Heart Circ. Physiol.

306(6): H833-843. doi: 10.1152/ajpheart.00893.2012.

Luan, A., Tang, F., Yang, Y., Lu, M., Wang, H., and Zhang, Y. 2015. Astragalus

polysaccharide attenuates isoproterenol-induced cardiac hypertrophy by regulating

TNF-alpha/PGC-1alpha signaling mediated energy biosynthesis. Environ. Toxicol.

Pharmacol. 39(3): 1081-1090. doi: 10.1016/j.etap.2015.03.014.

Miyazaki, T., Koya, T., Kigawa, Y., Oguchi, T., Lei, X.F., Kim-Kaneyama, J.R., and

Miyazaki, A. 2013. Calpain and atherosclerosis. J. Atheroscler. Thromb. 20(3):

228-237.

Miyazaki, T., Taketomi, Y., Takimoto, M., Lei, X.F., Arita, S., Kim-Kaneyama, J.R., Arata,

S., Ohata, H., Ota, H., Murakami, M., and Miyazaki, A. 2011. m-Calpain induction in

vascular endothelial cells on human and mouse atheromas and its roles in VE-cadherin

disorganization and atherosclerosis. Circulation 124(23): 2522-2532. doi:

10.1161/CIRCULATIONAHA.111.021675.

Miyazaki, T., Tonami, K., Hata, S., Aiuchi, T., Ohnishi, K., Lei, X.F., Kim-Kaneyama,

J.R., Takeya, M., Itabe, H., Sorimachi, H., Kurihara, H., and Miyazaki, A. 2016.

Calpain-6 confers atherogenicity to macrophages by dysregulating pre-mRNA splicing.

J. Clin. Invest. 126(9): 3417-3432. doi: 10.1172/JCI85880.

Momi, S., Monopoli, A., Alberti, P.F., Falcinelli, E., Corazzi, T., Conti, V., Miglietta, D.,

Ongini, E., Minuz, P., and Gresele, P. 2012. Nitric oxide enhances the

anti-inflammatory and anti-atherogenic activity of atorvastatin in a mouse model of

accelerated atherosclerosis. Cardiovasc. Res. 94(3): 428-438. doi: 10.1093/cvr/cvs100.

Nelken, N.A., Coughlin, S.R., Gordon, D., and Wilcox, J.N. 1991. Monocyte

chemoattractant protein-1 in human atheromatous plaques. J. Clin. Invest. 88(4):

1121-1127. doi: 10.1172/JCI115411.

Peters, S.A., den Ruijter, H.M., Bots, M.L., and Moons, K.G. 2012. Improvements in risk

stratification for the occurrence of cardiovascular disease by imaging subclinical

atherosclerosis: a systematic review. Heart 98(3): 177-184. doi:

10.1136/heartjnl-2011-300747.

Ruetten, H., and Thiemermann, C. 1997. Effect of calpain inhibitor I, an inhibitor of the

proteolysis of I kappa B, on the circulatory failure and multiple organ dysfunction

caused by endotoxin in the rat. Br. J. Pharmacol. 121(4): 695-704. doi:

10.1038/sj.bjp.0701180.

Shah, P., Bajaj, S., Virk, H., Bikkina, M., and Shamoon, F. 2015. Rapid Progression of

Coronary Atherosclerosis: A Review. Thrombosis 2015: 634983. doi:

10.1155/2015/634983.

Sharma, A., Sellers, S., Stefanovic, N., Leung, C., Tan, S.M., Huet, O., Granville, D.J.,

Cooper, M.E., de Haan, J.B., and Bernatchez, P. 2015. Direct Endothelial Nitric Oxide

Synthase Activation Provides Atheroprotection in Diabetes-Accelerated

Atherosclerosis. Diabetes 64(11): 3937-3950. doi: 10.2337/db15-0472.

Sohn, E.J., Kang, D.G., Choi, D.H., Lee, A.S., Mun, Y.J., Woo, W.H., Kim, J.S., and Lee,

Page 14 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

H.S. 2005a. Effect of methanol extract of Sorbus cortex in a rat model of

L-NAME-induced atherosclerosis. Biol. Pharm. Bull 28(7): 1239-1243.

Sohn, E.J., Kang, D.G., Mun, Y.J., Woo, W.H., and Lee, H.S. 2005b. Anti-atherogenic

effects of the methanol extract of Sorbus cortex in atherogenic-diet rats. Biol. Pharm.

Bull 28(8): 1444-1449.

Stalker, T.J., Skvarka, C.B., and Scalia, R. 2003. A novel role for calpains in the

endothelial dysfunction of hyperglycemia. FASEB J. 17(11): 1511-1513. doi:

10.1096/fj.02-1213fje.

Subramanian, V., Uchida, H.A., Ijaz, T., Moorleghen, J.J., Howatt, D.A., and

Balakrishnan, A. 2012. Calpain inhibition attenuates angiotensin II-induced abdominal

aortic aneurysms and atherosclerosis in low-density lipoprotein receptor-deficient mice.

J. Cardiovasc. Pharmacol. 59(1): 66-76. doi: 10.1097/FJC.0b013e318235d5ea.

Takeshita, D., Tanaka, M., Mitsuyama, S., Yoshikawa, Y., Zhang, G.X., Obata, K., Ito, H.,

Taniguchi, S., and Takaki, M. 2013. A new calpain inhibitor protects left ventricular

dysfunction induced by mild ischemia-reperfusion in in situ rat hearts. J. Physiol. Sci.

63(2): 113-123. doi: 10.1007/s12576-012-0243-6.

Tang, F., Chan, E., Lu, M., Zhang, X., Dai, C., Mei, M., Zhang, S., Wang, H., and Song,

Q. 2015. Calpain-1 Mediated Disorder of Pyrophosphate Metabolism Contributes to

Vascular Calcification Induced by oxLDL. PLoS One 10(6): e0129128. doi:

10.1371/journal.pone.0129128.

Tang, F., Lu, M., Yu, L., Wang, Q., Mei, M., Xu, C., Han, R., Hu, J., Wang, H., and Zhang,

Y. 2016. Inhibition of TNF-alpha-mediated NF-kappaB activation by Ginsenoside Rg1

contributes the attenuation of cardiac hypertrophy induced by abdominal aorta

coarctation. J. Cardiovasc. Pharmacol. 68(4): 257-264. doi:

10.1097/FJC.0000000000000410.

Tang, F., Wu, X., Wang, T., Wang, P., Li, R., Zhang, H., Gao, J., Chen, S., Bao, L., Huang,

H., and Liu, P. 2007. Tanshinone II A attenuates atherosclerotic calcification in rat

model by inhibition of oxidative stress. Vascul. Pharmacol. 46(6): 427-438. doi:

10.1016/j.vph.2007.01.001.

Tang, F.T., Chen, S.R., Wu, X.Q., Wang, T.Q., Chen, J.W., Li, J., Bao, L.P., Huang, H.Q.,

and Liu, P.Q. 2006a. Hypercholesterolemia accelerates vascular calcification induced

by excessive vitamin D via oxidative stress. Calcif. Tissue Int. 79(5): 326-339. doi:

10.1007/s00223-006-0004-8.

Tang, F.T., Qian, Z.Y., Liu, P.Q., Zheng, S.G., He, S.Y., Bao, L.P., and Huang, H.Q. 2006b.

Crocetin improves endothelium-dependent relaxation of thoracic aorta in

hypercholesterolemic rabbit by increasing eNOS activity. Biochem. Pharmacol. 72(5):

558-565. doi: 10.1016/j.bcp.2006.05.018.

Wu, X.Y., Fan, W.D., Fang, R., and Wu, G.F. 2014. Regulation of microRNA-155 in

endothelial inflammation by targeting nuclear factor (NF)-kappaB P65. J. Cell

Biochem. 115(11): 1928-1936. doi: 10.1002/jcb.24864.

Yang, X., Yin, M., Yu, L., Lu, M., Wang, H., Tang, F., and Zhang, Y. 2016. Simvastatin

inhibited oxLDL-induced proatherogenic effects through

calpain-1-PPARgamma-CD36 pathway. Can. J. Physiol. Pharmacol. 94(12): 1336-1343.

doi: 10.1139/cjpp-2016-0295.

Zeiher, A.M., Fisslthaler, B., Schray-Utz, B., and Busse, R. 1995. Nitric oxide modulates

the expression of monocyte chemoattractant protein 1 in cultured human endothelial

Page 15 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

cells. Circ. Res. 76(6): 980-986.

Page 16 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

Figure legends

Fig. 1. CAI reduces the atherosclerotic lesion and CD68 expression without affecting the

lipid profiles in serum. Rats were randomly divided into 4 groups: Con, HCD, CAI and

CAI+ L-NAME groups. A: Histological changes of aortic arch. B: Ratio of I to (I+M), I:

thickness of intima, M: thickness of media. C: Cholesterol content in aorta. D: CD68

protein expression in aorta. E: Concentrations of TC, LDL, HDL and TG in serum. Data

are expressed as the means ± SEM. n=8. *P<0.05 was considered statistically significant.

Fig. 2. CAI reduces calpain activity without affecting the protein expressions of calpain-1

and calpain-2 in aorta. Rats were randomly divided into 4 groups: Con, HCD, CAI and

CAI+ L-NAME groups. A: Calpain activity. B: Calpain-1 protein expression. C: Calpain-2

protein expression. Data are expressed as the means ± SEM. n=8 for A; n=4 for B and C.

*P<0.05 was considered statistically significant.

Fig. 3. CAI increases the NO content and the activity and protein expression of eNOS in

aorta. Rats were randomly divided into 4 groups: Con, HCD, CAI and CAI+ L-NAME

groups. A: NO content in aorta. B: eNOS activity. C: Representative photographs of

Western blot of eNOS protein expression (upper panel) and the quantitation (lower panel).

D: Representative photographs of immunohistochemistry of eNOS protein expression

(left panel) and the quantitation (right panel). Data are expressed as the means ± SEM.

n=8 for A and B; n=4 for C and D. *P<0.05 was considered statistically significant.

Fig. 4. CAI inhibits the expressions of ICAM-1, VCAM-1 and MCP-1 in aorta. Rats were

randomly divided into 4 groups: Con, HCD, CAI and CAI+ L-NAME groups. A: ICAM-1

protein level. B: ICAM-1 mRNA level. C: VCAM-1 protein level. D: VCAM-1 mRNA

level. E: MCP-1 protein level. F: MCP-1 mRNA level. Data are expressed as the means ±

SEM. n=4. *P<0.05 was considered statistically significant.

Fig. 5. CAI partly blocks the nuclear translocation of NF-κB in aorta. Rats were

randomly divided into 4 groups: Con, HCD, CAI and CAI+ L-NAME groups. A:

Representative photographs of Western blot of p65 protein expression in cytoplasm

Page 17 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

(upper panel) and the quantitation (lower panel). B: Representative photographs of

Western blot of p65 protein expression in nucleus (upper panel) and the quantitation

(lower panel). Data are expressed as the means ± SEM. n=4. *P<0.05 was considered

statistically significant.

Page 18 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

Fig. 1. CAI reduces the atherosclerotic lesion and CD68 expression without affecting the lipid profiles in serum. Rats were randomly divided into 4 groups: Con, HCD, CAI and CAI+ L-NAME groups. A: Histological changes of aortic arch. B: Ratio of I to (I+M), I: thickness of intima, M: thickness of media. C: Cholesterol

content in aorta. D: CD68 protein expression in aorta. E: Concentrations of TC, LDL, HDL and TG in serum. Data are expressed as the means ± SEM. n=8. *P<0.05 was considered statistically significant.

199x152mm (300 x 300 DPI)

Page 19 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

Fig. 2. CAI reduces calpain activity without affecting the protein expressions of calpain-1 and calpain-2 in aorta. Rats were randomly divided into 4 groups: Con, HCD, CAI and CAI+ L-NAME groups. A: Calpain

activity. B: Calpain-1 protein expression. C: Calpain-2 protein expression. Data are expressed as the means ± SEM. n=8 for A; n=4 for B and C. *P<0.05 was considered statistically significant.

199x92mm (300 x 300 DPI)

Page 20 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

Fig. 3. CAI increases the NO content and the activity and protein expression of eNOS in aorta. Rats were randomly divided into 4 groups: Con, HCD, CAI and CAI+ L-NAME groups. A: NO content in aorta. B: eNOS activity. C: Representative photographs of Western blot of eNOS protein expression (upper panel) and the

quantitation (lower panel). D: Representative photographs of immunohistochemistry of eNOS protein expression (left panel) and the quantitation (right panel). Data are expressed as the means ± SEM. n=8 for

A and B; n=4 for C and D. *P<0.05 was considered statistically significant.

199x146mm (300 x 300 DPI)

Page 21 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

Fig. 4. CAI inhibits the expressions of ICAM-1, VCAM-1 and MCP-1 in aorta. Rats were randomly divided into 4 groups: Con, HCD, CAI and CAI+ L-NAME groups. A: ICAM-1 protein level. B: ICAM-1 mRNA level. C: VCAM-1 protein level. D: VCAM-1 mRNA level. E: MCP-1 protein level. F: MCP-1 mRNA level. Data are

expressed as the means ± SEM. n=4. *P<0.05 was considered statistically significant.

199x138mm (300 x 300 DPI)

Page 22 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology

Draft

Fig. 5. CAI partly blocks the nuclear translocation of NF-κB in aorta. Rats were randomly divided into 4 groups: Con, HCD, CAI and CAI+ L-NAME groups. A: Representative photographs of Western blot of p65

protein expression in cytoplasm (upper panel) and the quantitation (lower panel). B: Representative

photographs of Western blot of p65 protein expression in nucleus (upper panel) and the quantitation (lower panel). Data are expressed as the means ± SEM. n=4. *P<0.05 was considered statistically significant.

199x121mm (300 x 300 DPI)

Page 23 of 23

https://mc06.manuscriptcentral.com/cjpp-pubs

Canadian Journal of Physiology and Pharmacology