Draft - Semantic Scholar...Draft 3 44 Introduction 45 Salmonella enterica, a rod-shaped,...

Draft

BaeR protein acts as an activator of nuclear factor kappa B

(NF-κB) and Janus kinase 2 (JAK2) to induce inflammation

in murine cell lines

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2016-0057.R1

Manuscript Type: Article

Date Submitted by the Author: 27-Mar-2016

Complete List of Authors: Lee, Seung-Jin; Kyungpook National University, College of Veterinary

Medicine, Laboratory of Veterinary Pharmacokinetics and Pharmacodynamics Birhanu, Biruk; Kyungpook National University, College of Veterinary medicine, Laboratory of Veterinary Pharmacokinetics and Pharmacodynamics Awji, Elias; Lovelace Respiratory Research Institute, COPD Program Kim, Myung-Hee; Korea Research Institute of Bioscience and Biotechnology Division of Biological Infrastructure, Infection and Immunity Research Center Park, Ji-yong; Cleanbio Research Institute Suh, Joo-Won; Myongji University, Center for Neutraceutical and Pharmaceutical Materials

Park, Seung-Chun; Kyungpook National University, College of Veterinary Medicine

Keyword: BaeR, JAK-2, NF-ΚB, <i>S. enterica</i> Paratyphi A, Nitric oxide

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

1

BaeR protein acts as an activator of nuclear factor-kappa B (NF-κB) 1

and Janus kinase 2 (JAK2) to induce inflammation in murine cell lines 2

3

Seung-Jin Leea, Biruk Tesfaye Birhanu

a, Elias Gebru Awji

b, Myung-Hee Kim

c, Ji-Yong 4

Parkd, Joo-Won Suh

e,*, Seung-Chun Park

a,* 5

6

Running title: BaeR as an activator of nuclear factor-kappa B 7

8

aLaboratory of Veterinary Pharmacokinetics & Pharmacodynamics, College of Veterinary 9

Medicine, Kyungpook National University, Daegu 702-701, Republic of Korea 10

bCOPD Program, Lovelace Respiratory Research institute, Albuquerque, NM 87108 11

cInfection and Immunity Research Center, Korea Research Institute of Bioscience and 12

Biotechnology, KRIBB, Daejeon 305-806, Republic of Korea 13

dCleanbio Research Institute, Daejeon 301-212, Korea 14

eCenter for Nutraceutical and Pharmaceutical Materials, Division of Bioscience and 15

Bioinformatics, Science campus, Myongji University, 449-728, Yongin, Gyeonggi, Republic of 16

Korea 17

18

*Co-corresponding authors: Seung-Chun Park ([email protected]) and Joo-Won Suh 19

([email protected]) 20

80 Daehakro, College of Veterinary Medicine, Kyungpook National University, Buk-gu, 21

Daegu, Korea, 41566 22

Tel: 82-53-950-5964; Fax: 82-53-950-5955 23

Page 1 of 27



Draft

2

Abstract 24

BaeR, a response regulator protein, partakes in multi-drug efflux, bacterial virulence activity, 25

and other biological functions. Recently, BaeR was shown to induce inflammatory responses 26

by activating the mitogen-activated protein kinases (MAPKs). In this study, we investigated 27

additional pathways used by BaeR to induce an inflammatory response. BaeR protein was 28

purified from Salmonella enterica Paratyphi A and subcloned into a pPosKJ expression 29

vector. RAW 264.7 cells were treated with BaeR, and RNA was extracted by TRIzol reagent 30

for RT-PCR. Cytokine gene expression was analyzed by using the comparative cycle 31

threshold method, while western blotting and ELISA were used to assess protein expression. 32

We confirmed that BaeR activates NF-κB, thereby inducing an inflammatory response and 33

increases the production of IL-1β and IL-6. During this process, the JAK2/STAT1 pathway 34

was activated, resulting in an increase in the release of IFN I and II. Additionally, COX-2 35

was activated and its expression increased with time. In conclusion, BaeR induced 36

inflammatory response through activation of NF-κB in addition to the MAPKs. Furthermore, 37

activation of the JAK2/STAT1 pathway and COX-2 facilitated the cytokine binding activity, 38

suggesting an additional role for BaeR in the modulation of the immune system of the host 39

and the virulence activity of the pathogen. 40

41

Keywords: BaeR; JAK-2; NF-κB; Nitric oxide; S. enterica Paratyphi A 42

43

Page 2 of 27



Draft

3

Introduction 44

Salmonella enterica, a rod-shaped, gram-negative, flagellated bacterium consists of multiple 45

serovars known to cause infectious diseases in humans and animals. Salmonella enterica 46

serovar Paratyphi A is known to cause multiple infections in humans (Maskey et al. 2006; 47

McClelland et al. 2004). Furthermore, the emergence of drug-resistance, as for other bacterial 48

agents, renders the bacterium a major public health threat (McClelland et al. 2004). 49

These bacteria, like others, interact with the immune system of the host, which is the 50

existing and primary means for protecting a body against an incoming pathogen (Maskey et 51

al. 2006; Sheela et al. 2003; Humphries et al. 2011). In the process, different types of 52

inflammatory molecules, like chemokines and cytokines, are produced in macrophages. NF-53

κB is also known to play a key role in innate and adaptive immune responses (Oeckinghaus et 54

al. 2006). 55

Exposure of macrophages to different salmonella products in vitro, elicits the differentiation 56

of immune cells and release of immune molecules (Eckmann and Kagnoff, 2001; 57

Rosenberger et al. 2000; Wyant, Tanner and Sztein, 1999; Galdiero et al. 1993; Ciacci-58

Woolwine et al. 1998). In previous studies, we identified and evaluated the structural and 59

immunobiological properties of several proteins derived from bacterial agents (Kim et al. 60

2008; Hwang et al. 2008; Kang et al. 2009; Gebru et al. 2011). Multiple biological activities 61

of BaeR have been outlined (Baranova and Nikaido, 2002; Nagakubo et al. 2002; Nishino et 62

al. 2007; Nishino, Nikaido and Yamaguchi, 2009; Hu et al. 2011). Identification and 63

characterization of proteins, like BaeR, and the determination of their role during infection 64

provide a new insight into the host-pathogen interaction. In addition, understanding their role 65

and mechanism in the immune response of the host can guide the design of new antimicrobial 66

therapies. 67

In E. coli, BaeR senses and defends against divalent toxicity and functions as a response 68

Page 3 of 27



Draft

4

regulator (Ruiz and Silhavy, 2005; Raffa and Raivio, 2002). Furthermore, the protein plays a 69

critical role in the regulation of the expression of several genes associated with cell 70

adaptation to stresses (Oshima et al., 2002; Nishino et al., 2005). BaeR was also recently 71

reported to affect the initiation of replication indirectly by regulating the expression of the 72

dnaA gene (Wunier and Morigen, 2015). Recently, a previously unknown role of BaeR 73

protein purified from S. Paratyphi A was identified; BaeR induces an inflammatory reaction 74

in murine and human cell lines by activating the MAPK system (Lee et al. 2013). However, 75

the complete inhibition of the three MAPKs (ERK1/2, JNK, and p38 MAPK) in macrophages 76

results in the reduction, but not the complete inhibition of inflammatory cytokines, suggesting 77

the presence of other pathways activated by BaeR. Furthermore, the involvement of the NF-78

κB pathway, a key player in the secretion of proinflammatory cytokines and regulation of 79

inflammatory responses, in BaeR-induced inflammatory response is still unclear. Hence, in 80

this study, RAW 264.7 cells were used as an in vitro model to investigate the role of the NF-81

κB pathway and Janus kinase 2 (JAK2) in the inflammatory response induced by BaeR. 82

83

Page 4 of 27



Draft

5

Materials and Methods 84

Reagents and inhibitors 85

PDTC (inhibitor of NF-κB), AG490 (inhibitor of JAK-2), L-NIL hydrochloride (inhibitor of 86

iNOS), lipopolysaccharide (LPS), Griess reagent, and dimethylsulfoxide (DMSO) were 87

purchased from Sigma–Aldrich Chemical Co. (St Louis, MO, USA). Antibodies against 88

JAK2, STAT1, their phospho-forms, and β-actin were obtained from Cell signaling (Danvers, 89

MA, USA. All inhibitors were dissolved in DMSO as stock solutions and further diluted in 90

PBS to obtain the working solutions at the final concentration. 91

Cell culture 92

Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, CA, USA) was used to 93

culture RAW 264.7 cells (KCLB 40071, Korea). The medium was supplemented with 10% 94

FBS, 100 µg/mL of streptomycin, and 100 U/mL of penicillin (Gibco, Grand Island, NY, 95

USA). Cells were allowed to grow under 5% CO2 in humidified air at 37°C and were 96

passaged once every two days. 97

Separation and purification of BaeR protein 98

The method for the preparation of BaeR protein was adapted from our previous study. Briefly, 99

the amplification of BaeR gene was performed using forward and reverse primers, 5′-100

GGAATTCCATATGACTGAATTACCCATTG-3′ and 5′-101

CCGCTCGAGTTATACCAGGCGACACGC-3′, respectively, which carry the NdeI and 102

XhoI region from the DNA of S. Paratyphi A (ATCC 9150). Subcloning of the PCR product 103

into pPosKJ expression vector results in the production of BaeR attached to the hexa-104

histidine tag and bacterial hemoglobin (6×His-VHb) (Kwon et al. 2005). The LB-ampicillin 105

medium was used to culture strain C41 (DE3) at 37°C to overexpress BaeR until an OD600 106

value of 0.6–1.0 was reached. For induction of protein expression, the temperature was 107

reduced to 21°C and the cells were incubated overnight with 0.5 mM isopropyl-β-D-108

Page 5 of 27



Draft

6

thiogalactopyranoside. Cells were harvested by centrifugation at 5,000 × g at 4°C for 10 min 109

and pellets were resuspended in an ice-cold buffer A for ultra-sonication. The cell lysates 110

obtained after centrifugation of the crude cells at 11,000 × g for 1 h at 4°C were applied to 111

Ni-NTA agarose (Qiagen, Hilden, Germany) column after washing the column with buffer A, 112

and eluting the resin-bound proteins with 250 mM imidazole. BaeR protein was separated 113

from 6×His-VHb by incubation with rTEV protease (GIBCO, Carlsbad, CA, USA) for three 114

days at 10°C, followed by size-exclusion and Ni-NTA affinity column chromatography, and 115

concentrated to 15 mg/mL. Coomassie blue staining and 10% SDS-PAGE were used to 116

assess the homogeneity of the protein. EndoTrap® Red column (Hyglos GmbH, Germany) 117

technique was applied to purify BaeR from any residual LPS. Finally, the purified protein 118

was dissolved in endotoxin-free HEPES buffer before storage at -70°C. 119

RNA purification and quantitative RT-PCR 120

RAW 264.7 cells were cultured at 5 × 105 cells/mL in 3-cm culture dishes and incubated for 121

24 h, prior to treatment with BaeR only or pre-treated for 30 min with different doses (3, 10, 122

or 30 µM) of each inhibitor. LPS (100 ng/mL) and BaeR-unstimulated cells were used as a 123

positive and negative controls, respectively. TRIzol® reagent (Invitrogen) was used to extract 124

total RNA. The cDNA was synthesized after RNA pellets were suspended in DEPC-treated 125

water and frozen at -70°C using the cDNA EcoDry Premix (Takara, Tokyo, Japan) as 126

specified by the manufacturer. The real-time PCR was performed using 2X iQ SYBR Green 127

Supermix and a CFX96 Real-time thermal cycler (Bio-Rad, Hercules, CA, USA). PCR 128

amplification was conducted using specific primers (Table 1) and β-actin as a reference gene. 129

The real time-PCR cycles include: enzyme activation and initial denaturation for 5 min at 130

95°C, and 40 cycles of amplification at 95°C for 10 s, followed by 55°C (IL-1β and IL-6), 131

58°C (iNOs), or 62°C (TNF-α, IFN-α4, IFN-β, IFN-γ, and Cox-2) for 20 s. Amplification 132

specificity was confirmed by analyzing the melting peaks of the PCR products. The threshold 133

Page 6 of 27



Draft

7

cycles (Cts) were measured in separate tubes. Cytokine gene expression was analyzed based 134

on the “comparative cycle threshold method [∆∆Ct]” for relative quantification and presented 135

as 2−∆∆Ct

by using the built-in software of the Gene Expression Analysis for CFX manager 136

v1.6 Real-Time PCR Detection System (Bio-Rad). Gene expression was expressed as the n-137

fold difference relative to the normalized expression of unstimulated samples. All procedures 138

were conducted in triplicate. 139

Determination of proinflammatory cytokine expression and ELISA 140

Cell treatment with BaeR with or without inhibitors was performed as stated above and 141

ELISA kits (Invitrogen, Carlsbad, CA, USA) were used to measure protein levels of 142

proinflammatory cytokines in culture supernatants. For the inhibition experiments, GraphPad 143

Prism software (GraphPad software, Inc., San Diego, CA, USA) was used to calculate the 144

concentrations of inhibitors required to reduce BaeR-induced cytokine production by 50% 145

(IC50). 146

Western blotting and SDS/PAGE analysis 147

Western blot analysis was conducted to determine the induction and levels of protein 148

expression. Cells were stimulated with 3 µg/mL of BaeR for different times. Briefly, cells 149

were washed with ice-cold PBS and centrifuged at 4000 × g for 5 min at 4°C and total protein 150

was extracted using Pierce Protein Extraction Reagent (Pierce) containing protease inhibitor 151

following the manufacturer’s protocol. Proteins were separated by SDS-PAGE in 10% gels 152

and transferred to PVDF membranes before being blocked with 5% BSA in TBST for 1 h. 153

Membranes were probed with polyclonal antibodies against p-JAK2, p-STAT1 (1:1000), and 154

β-actin as a loading control, for 90 min at room temperature. Membranes were then washed 155

five times for 10 min with Tris-buffered saline Tween®-20 (TBST) and incubated for 60 min 156

with an anti-mouse IgG-HRP secondary antibody (1:1000, Santa Cruz). Finally, the signal 157

was detected with an enhanced chemiluminescence (ECL) system (Pierce). 158

Page 7 of 27



Draft

8

159

Statistical analysis 160

The mean ± SD values of at least three independent experiments were used for data analysis. 161

A one-way analysis of variance (ANOVA) and Duncan’s Multiple Range test were used to 162

compute the statistical differences and P < 0.05 was considered statistically significant. 163

164

165

Page 8 of 27



Draft

9

Results 166

BaeR induces NO production and proinflammatory cytokine mRNA expression in RAW 264.7 167

cells in a time dependent manner 168

NO assay was used to examine the kinetics of BaeR on NO induction at different time 169

intervals (0–12 h). BaeR induced NO production in RAW 264.7 cells in a time-dependent 170

manner over the incubation period and reached a maximum at 12 h (Fig. 1). 171

172

COX-2 expression is induced by BaeR 173

Western blotting was applied to investigate the effect of BaeR on COX-2 expression. In 174

RAW 264.7 cells, Cox-2 mRNA expression increased with time for up to at least 8 h. In 175

addition, BaeR treatment resulted in a dose-dependent increase in COX-2 protein expression 176

(Fig. 2A and 2B). 177

178

BaeR activates the NF-κB signaling pathway in RAW 264.7cells 179

The activation of NF-κB by BaeR was determined by detecting cytoplasmic IκBα 180

degradation and nuclear NF-κB proteins by western blotting. IκBα antibodies were applied to 181

evaluate IκBα degradation. RAW 264.7 cells were exposed to 3 µg/mL of BaeR for different 182

times (0, 5, 15, 30, 45, and 60 min), followed by extraction of cytoplasmic and nuclear 183

proteins. As shown in Fig. 2C, IκBα was degraded within 5 min after exposure to BaeR and 184

reached the maximum degradation at 15 min, but was persistently observed from 30 min 185

onward. In addition, an anti-p65 antibody was used to examine the effect of BaeR on the 186

nuclear translocation of NF-κB. Nuclear p65 protein was expressed from 5 min to 15 min 187

after exposure to BaeR, consistent with the degradation of IκBα (Fig. 2D). These results 188

demonstrate that BaeR is capable of activating NF-κB through degradation of IκBα in RAW 189

264.7 cells. 190

Page 9 of 27



Draft

10

Using a pharmacological approach, NF-κB inhibition with its specific inhibitor, PDTC, 191

resulted in a significant reduction (P < 0.05) of NO production and iNos mRNA levels (75%) 192

(Fig. 2E and 2F). Similarly, IL-1β (96%) and IL-6 (53%) mRNA expression levels were 193

reduced when cells were treated with 30 µM of PDTC. However, TNF-α mRNA expression 194

was not affected (Fig. 3A). In addition, ELISA indicated that IL-1β and IL-6 protein levels 195

were reduced by PDTC at the same concentration, while no significant effect on the level of 196

TNF-α was detected (Fig. 3B). 197

198

BaeR induces type I and II IFN mRNA expression in RAW 264.7 cells 199

In this study, IFN-β expression was highly induced in RAW 264.7 cells treated with 3 µg/mL 200

of BaeR, while IFN-α4 and IFN-γ were moderately expressed (Fig. 4A). The production of 201

the interferons increased in a time-dependent manner and the maximum expression was 202

observed at 4 h. However, mRNA expression of IFNs induced by BaeR was only maintained 203

for 12 h. 204

205

BaeR activates the JAK/STAT1 signaling pathway in RAW 264.7cells 206

An immunoblot analysis was conducted to determine Janus kinases/signal transducer and 207

activator of transcription (JAK/STAT), specifically JAK-2/STAT1 pathway, activation in RAW 208

264.7 cells during the BaeR-induced inflammatory process. As shown in Fig. 4B, BaeR 209

treatment resulted in JAK-2 and STAT1 phosphorylation as early as 45 min and detectable 210

levels of the phosphorylated proteins were observed up to 60 min after stimulation. 211

To determine the precise role of JAK2 on the production of NO and the expression of 212

iNOs mRNA, a specific inhibitor of JAK-2 (AG490) was used. Cells were treated with 213

various concentrations of AG490 in the culture medium 1 h prior to stimulation with BaeR (3 214

µg/mL). BaeR-induced NO production was significantly downregulated by JAK-2 inhibitor 215

Page 10 of 27



Draft

11

(AG490) (IC50, 50 µM) (Fig. 4C). Similar to NO production, the inhibitor significantly 216

decreased BaeR-induced expression of iNOs mRNA by 75%. Moreover, ELISA indicated 217

that treatment with AG490 at a concentration of 30 µM resulted in a decrease in IL-1β (89%) 218

and IL-6 (96%) protein levels, consistent with the reduction in their mRNA levels. No 219

significant effect on the level of TNF-α was detected (Fig. 5A and 5B). AG490 IC50 values 220

for IL-1β and IL-6 inhibition were 2.86 µM and 3.88 µM, respectively. 221

222

223

224

225

Page 11 of 27



Draft

12

Discussion and Conclusion 226

227

Macrophages are known to be activated during the immune response of the body and play a 228

vital role in recognizing different bacterial components and sending of signals. Likewise, 229

macrophages respond to different Salmonella products, like LPS, BaeR proteins, porins, and 230

flagellin in in vitro modeling and induce a cytokine response identical to that of live bacteria 231

in vivo (Rosenberger et al. 2000; Wyant, Tanner and Sztein, 1999; Galdiero et al. 1993; 232

Ciacci-Woolwine et al. 1998; Lee et al. 2013) 233

Accordingly, identification and characterization of proteins, like BaeR, and 234

determination of their role during infection provide a new insight into the host-pathogen 235

interaction. Thus, in this study, we aimed to gain further insights into the mechanisms of 236

BaeR-induced inflammatory response in RAW 264.7 macrophages. 237

NO, produced by iNOS after recognition of various bacterial components via pattern 238

recognition receptors, including Toll-like receptors, by host cells, plays a critical role in 239

innate defense mechanisms of the host against infectious agents (Okamoto et al. 2010; Alam 240

et al. 2002). A study reported that NO is produced through increased iNos mRNA expression 241

by treating RAW 264.7 cells with BaeR (Lee et al. 2013). 242

MAPKs facilitate the production of NO and proinflammatory cytokines after activation 243

by live bacteria and their components (Gebru et al. 2011; Lee et al. 2013; Vitiello et al. 2008; 244

Ajizian, English and Meals, 1999; Chen and Wang, 1999; Galdiero et al. 2005). Furthermore, 245

BaeR was found to induce the activation of the three MAPKs (ERK1/2, JNK, and p38 MAPK) 246

in macrophages, along with higher levels of phosphorylated proteins, resulting in iNOS 247

induction (Lee et al. 2013). In this study, BaeR also increased NO production in a time-248

dependent manner. 249

Page 12 of 27



Draft

13

BaeR also initiated the production of COX-2 after its mRNA expression. The mRNA 250

expression increased for a few hours and tended to decline at the end. COX-2 protein 251

concentration increased with increasing concentrations of BaeR. Similarly, LPS also initiate 252

the release of COX-2 proteins to induce inflammatory responses (Prestes-Carneiro et al. 253

2007). As reported by Gilory et al. (1999; 2004), COX-2 plays a critical role in initiating the 254

proinflammatory process and resolution of inflammation at the beginning and after 48 h of 255

inflammation, respectively. This might indicate that bacterial BaeR partakes in both initiating 256

and regulating inflammation. This might indicate the indirect immune modulating activity of 257

BaeR. Hence, BaeR may be a candidate for determining the pathogenic role of bacteria and 258

site for treatment. 259

To induce inflammatory responses, in addition to MAPK activation, BaeR also activates 260

NF-κB by degrading IKB in the cytoplasm, thereby releasing NF-κB to the nucleus. In fact, 261

p65 has been identified after IkBα degradation, which represents the translocation of NF-κB 262

to the nucleus. This mechanism was unveiled by blocking NF-κB using an NF-κB inhibitor 263

and observing the reduction of NO and iNos mRNA. This report is in agreement with 264

previous studies describing the significance of NF-κB-dependent transcription of cytokines, 265

chemokines, cell adhesion molecules, factors of the complement cascade, and acute phase 266

proteins in controlling inflammatory processes (Chen and Manning, 1995; Kopp and Ghosh, 267

1995; Wissink et al. 1997; Huxford et al. 1998). Likewise, the rapid degradation of IκBα after 268

heterodimer formation with p65/p50 is critical for NF-κB nuclear translocation and binding 269

with DNA (Huxford et al. 1998). 270

In the process, we noticed that BaeR also increased the phosphorylation of JAK-2 and 271

STAT1 signaling molecules. The JAK-2/STAT1 signaling pathway is involved in a wide 272

range of activities, including host defense (Kubler, 2014). It is also implicated in the signaling 273

Page 13 of 27



Draft

14

of type II cytokine receptors, which are responsible for binding of IL-10-related cytokines 274

and facilitating IFN I and IFN II receptor binding (Dumoutier et al. 2003; Xu et al. 2001). 275

This suggests the involvement of IFN I and IFN II in the inflammatory response induced by 276

BaeR and explains the releasing of interferons. 277

Moreover, the presence of the regulatory protein, BaeR, in other Salmonella serovars and 278

E. coli (Nagakubo et al. 2002; Nishino et al. 2007; Nishino, Nikaido and Yamaguchi, 2009) 279

suggests that our results may have implication in determining the virulence of many other 280

bacterial agents. 281

In conclusion, in our previous study, MAPKs were identified as an integral part of BaeR-282

induced inflammatory response in RAW 264.7 cells (Lee et al. 2013). In addition, the present 283

study reveals that BaeR proteins are also responsible for initiating inflammation in 284

macrophages using the NF-κB pathway. This is in agreement with previous studies, which 285

support that NF-κB activation is necessary for IL-17 induced IL-6, IL-8, and MCP-1 286

inflammatory responses and MAPKs also participate in this process (Hata et al. 2002; Craig 287

et al. 2000). As suggested by Craig and co-workers, MAPK kinase stimulates p38 MAPK, 288

which, in turn, activates the DNA-binding activity of NF-κB (Craig et al. 2000). This shows 289

that NF-κB and MAPKs work in concert in BaeR-induced inflammatory responses. Even 290

though similar results were observed in human derived THP-1 macrophages (Lee et al. 2013), 291

understanding the peculiar role of this protein, determining the amount required for eliciting a 292

response, and its involvement in the pathogenesis and antibacterial activity in the host should 293

be clarified. Henceforward, we still encourage additional studies, which will help in 294

recognizing other possible signaling pathways induced during the BaeR-initiated 295

inflammatory process. 296

297

Page 14 of 27



Draft

15

Acknowledgment: This research was funded in part by the Daejeon Institute for Regional 298

Program Evaluation Promotion Project (R0004266) through the Research and Development 299

for Regional Industry of the Ministry of Trade, Industry and Energy and in part by the Bio-300

industry Technology Development Program, Ministry of Agriculture, Food and Rural Affairs 301

and the “Cooperative Research Program for Agriculture Science & Technology 302

Development” (Project No. PJ01128901), Rural Development Administration, Republic of 303

Korea. 304

305

Conflict of interest: The authors have no conflict of interest to declare. 306

307

Page 15 of 27



Draft

16

References 308

309

Ajizian, S.J., English, B.K., and Meals, E.A. 1999. Specific inhibitors of p38 and 310

extracellular signal-regulated kinase mitogen-activated protein kinase pathways block 311

inducible nitric oxide synthase and tumor necrosis factor accumulation in murine 312

macrophages stimulated with lipopolysaccharide and interferon-gamma. J. Infect. Dis. 313

179:939-944. 314

Alam, M.S., Akaike. T., Okamoto, S., Kubota, T., Yoshitake, J., Sawa. T., et al. 2002. Role 315

of nitric oxide in host defense in murine salmonellosis as a function of its antibacterial and 316

antiapoptotic activities. Infect. Immun. 70:3130-3142. 317

Baranova, N., and Nikaido, H. 2002. The baeSR two-component regulatory system activates 318

transcription of the yegMNOB (mdtABCD) transporter gene cluster in Escherichia coli and 319

increases its resistance to novobiocin and deoxycholate. J. Bacteriol. 184:4168–4176. 320

Chen, C.C., and Manning, A.M. 1995. Transcriptional regulation of endothelial cell adhesion 321

molecules: A dominant role for NF-k B. Agents. Actions. Suppl. 47:135–141. 322

Chen, C.C., and Wang, J.K. 1999. p38 but not p44/42 mitogen-activated protein kinase is 323

required for nitric oxide synthase induction mediated by lipopolysaccharide in RAW 264.7 324

macrophages. Mol. Pharmacol. 55:481–488. 325

Ciacci-Woolwine, F., Blomfield, I.C., Richardson, S.H., and Mizel, S.B. 1998. Salmonella 326

flagellin induces tumor necrosis factor alpha in a human promonocytic cell line. Infect. 327

Immun. 66:1127-1134. 328

Craig, R., Larkin, A., Mingo, A.M., and Thuerauf, D.J., Andrews, C., McDonough, P.M., et 329

al. 2000. p38 MAPK and NF-κB collaborate to induce interleukin-6 gene expression and 330

a

Page 16 of 27



Draft

17

release. Evidence for a cytoprotective autocrine signaling pathway in a cardiac myocyte 331

model system. J. Biol. Chem. 275(31):23814–23824. 332

Dumoutier, L., Lejeune, D., Hor, S., Fickenscher, H., and Renauld, J.C. 2003. Cloning of a 333

new type II cytokine receptor activating signal transducer and activator of transcription 334

(STAT)1, STAT2 and STAT3. Biochem. J. 370(2): 391–396. 335

Eckmann, L., and Kagnoff, M.F. 2001. Cytokines in host defense against Salmonella. 336

Microbes Infect. 3:1191-1200. 337

Galdiero, F., L'ero, G.C., Benedetto, N., Galdiero, M., and Tufano, M.A. 1993. Release of 338

cytokines induced by Salmonella typhimurium porins. Infect. Immun. 61:155-161. 339

Galdiero, M., Tortora, A., Damiano, N., Vitiello, M., Longanella, A. and Galdiero, E. 2005. 340

Induction of cytokine mRNA expression in U937 cells by Salmonella typhimurium porins is 341

regulated by different phosphorylation pathways. Med. Microbiol. Immunol. 194:13-23. 342

Gebru, E., Kang, E.H., Damte, D., Lee, J.S., Jang, S.H., Kim, M.H., et al. 2011. The role of 343

Janus kinase 2 (JAK2) activation in pneumococcal EstA protein-induced inflammatory 344

response in RAW 264.7 macrophages. Microb. Pathog. 51:297-303. 345

Gilroy, D.W., Colville-Nash, P.R.., Willis, D., Chivers, J., Paul-Clark, M.J., and Willoughby, 346

D.A. 1999. Inducible cyclooxygenase may have anti-inflammatory properties. Nat. 347

Med. 5:698–701. 348

Gilroy, D.W., Newson, J., Sawmynaden, P., Willoughby, D.A., and Croxtall, J.D. 2004. A 349

novel role for phospholipase A2 isoforms in the checkpoint control of acute 350

inflammation. FASEB J. 18:489–498. 351

Hata, K., Andoh, A., Shimada, M., Fujino, S., Bamba, S., Araki, Y., et al. 2002. IL-17 352

Page 17 of 27



Draft

18

stimulates inflammatory responses via NF-κB and MAP kinase pathways in human colonic 353

myofibroblasts. Am J Physiol Gastrointest Liver. Physiol. 282(6):G1035-1044. 354

Hu, W.S., Chen, H.W., Zhang, R.Y., Huang, C.Y., and Shen, C.F. 2011. The expression levels 355

of outer membrane proteins STM1530 and OmpD, which are influenced by the CpxAR and 356

BaeSR two-component systems, play important roles in the ceftriaxone resistance of 357

Salmonella enterica serovar Typhimurium. Antimicrob. Agents. Chemother. 55:3829-3837. 358

Humphries, R.M., Yeganeh, N., Ward, K.W., Lewinski, M.A., and Ching, N. 2011. Enteric 359

fever in a 6-year-old traveler caused by Salmonella enterica serovars Typhi and Paratyphi A: 360

laboratory detection strategies and treatment options. J. Clin. Microbiol. 49:452-454. 361

Huxford, T., Huang, D.B., Malek, S., and Ghosh, G. 1998. The crystal structure of the 362

IkB/NF-kB complex reveals mechanisms of NF-kB inactivation. Cell. 95:759–770. 363

Hwang. M.H., Chang, Z.Q., Kang, E.H., Lim, J.H., Yun, H.I., Rhee, M.H., et al. 2008. 364

Surfactin C inhibits Mycoplasma hyopneumoniae-induced transcription of proinflammatory 365

cytokines and nitric oxide production in murine RAW 264.7 cells. Biotechnol. Lett. 30:229-366

233. 367

Kang, E.H., Gebru, E., Kim, M.H., Cheng, H., and Park, S.C. 2009. EstA protein, a novel 368

virulence factor of Streptococcus pneumoniae, induces nitric oxide and proinflammatory 369

cytokine production in RAW 264.7 macrophages through NF-kappaB/MAPK. Microb. 370

Pathog. 47:196-201. 371

Kim, M.H., Kang, B.S., Kim, S., Kim, K.J., Lee, C.H., Oh, B.C., et al. 2008. The crystal 372

structure of the estA protein, a virulence factor from Streptococcus pneumonia. Proteins. 373

70:578-583. 374

Page 18 of 27



Draft

19

Kopp, E.B., and Ghosh, S. 1995. NF-k B and rel proteins in innate immunity. Adv. Immunol. 375

58:1–27. 376

Kubler, P. 2014. Janus kinase inhibitors: Mechanisms of action. Aust. Prescr. 37:154-7. 377

Kwon, S.Y., Choi, Y.J., Kang, T.H., Lee, K.H., Cha, S.S., Kim, G.H., et al. 2005. Highly 378

efficient protein expression and purification using bacterial hemoglobin fusion vector. 379

Plasmid. 53:274-282. 380

Lee, S.J., Awji,. E.G., Kim, M.H., and Park, S.C. 2013. BaeR protein from Salmonella 381

enterica serovar Paratyphi A induces inflammatory response in murine and human cell lines. 382

Microbes. Infect. 15:951-957. 383

Maskey, A.P., Day, J.N., Phung, Q.T., Thwaites, G.E., Campbell, J.I., Zimmerman, M., et al. 384

2006. Salmonella enterica serovar Paratyphi A and S. enterica serovar Typhi cause 385

indistinguishable clinical syndromes in Kathmandu, Nepal. Clin. Infect. Dis. 42:1247-1253. 386

McClelland, M., Sanderson, K.E., Clifton, S.W., Latreille, P., Porwollik, S., Sabo, A., et al. 387

2004. Comparison of genome degradation in Paratyphi A and Typhi, human-restricted 388

serovars of Salmonella enterica that cause typhoid. Nat. Genet. 36 (12):1268-1274. 389

Nagakubo, S., Nishino, K., Hirata, T., and Yamaguchi, A. 2002. The putative response 390

regulator BaeR stimulates multidrug resistance of Escherichia coli via a novel multidrug 391

exporter system, MdtABC. J. Bacteriol. 184:4161-4167. 392

Nishino, K., Nikaido, E., and Yamaguchi, A. 2009. Regulation and physiological function of 393

multidrug efflux pumps in Escherichia coli and Salmonella. Biochim. Biophys. Acta. 1794 394

(5):834–843. 395

Nishino, K., Nikaido, E., and Yamaguchi, A. 2007. Regulation of multidrug efflux systems 396

Page 19 of 27



Draft

20

involved in multidrug and metal resistance of Salmonella enterica serovar Typhimurium. J. 397

Bacteriol. 189:9066-9075. 398

Oeckinghaus, A., and Ghosh, S. 2009. The NF-kB Family of Transcription Factors and Its 399

Regulation, Cold Spring. Harb. Perspect. Biol. 1:a000034:1-14. 400

Oshima T, Aiba H, Masuda Y, Kanaya S, et al. 2002. Transcriptome analysis of all two-401

component regulatory system mutants of Escherichia coli K-12. Mol. Microbiol. 46: 281-291. 402

Okamoto, T., Khan, T., Oyama, K., Fujii, S., Sawa, T., and Akaike, T. 2010. A new paradigm 403

for antimicrobial host defense mediated by a nitrated cyclic nucleotide. J. Clin. Biochem. 404

Nutr.46:14-19. 405

Prestes-Carneiro, L.E., Shio, M.T., Fernandes, P.D., and Jancar, S. 2007. Cross-Regulation of 406

iNOS and COX-2 by its Products in Murine Macrophages Under Stress Conditions. Cell 407

Physiol. Biochem. 20:283-292. 408

Raffa, R.G. and Raivio, T.L. 2002. A third envelope stress signal transduction pathway in 409

Escherichia coli. Mol. Microbiol. 45: 1599-1611. 410

Rosenberger, C.M., Scott, M.G., Gold, M.R., Hancock, R.E., and Finlay, B.B. 2000. 411

Salmonella Typhimurium infection and lipopolysaccharide stimulation induce similar 412

changes in macrophage gene expression. J. Immunol. 164:5894-5904. 413

Ruiz, N. and Silhavy, T.J. 2005. Sensing external stress: watchdogs of the Escherichia coli 414

cell envelope. Curr. Opin. Microbiol. 8: 122-126. 415

Sheela, R.R., Babu, U., Mu, J., Elankumaran, S., Bautista, D.A., Raybourne, R.B., et al. 416

2003. Immune Responses against Salmonella enterica Serovar Enteritidis Infection in Virally 417

Immunosuppressed Chickens. Clin. Diagn. Lab. Immun. 4:670–679. 418

Page 20 of 27



Draft

21

Vitiello, M., D’Isanto, M., Finamore, E., Ciarcia, R., Kampanaraki, A., and Galdiero, M. 419

2008. Role of mitogen-activated protein kinase in the iNOS production and cytokine 420

secretion by Salmonella enterica serovar Typhimurium porins. Cytokine. 41:279-285. 421

Wissink, S., van de Stolpe, A., Caldenhoven, E., Koenderman, L., and van der Saag, P.T. 422

1997. NF-k B/Rel family members regulating the ICAM-1 promoter in monocytic THP-1 423

cells. Immunobiol. 198:50–64. 424

Wyant, T.L., Tanner, M.K., and Sztein, M.B. 1999. Salmonella typhi flagella are potent 425

inducers of proinflammatory cytokine secretion by human monocytes. Infect. Immun. 426

167:3619-3624. 427

Xu, W., Presnell, S.R., Parrish-Novak, J., Kindsvogel, W., Jaspers, S., Chen, Z., et al. 2001. A 428

soluble class II cytokine receptor, IL-22RA2, is a naturally occurring IL-22 antagonist. Proc. 429

Natl. Acad. Sci. USA. 98(17): 9511–9516. 430

Yao Y., Wunier and Morigen. 2015. Absence of the BaeR protein leads to the early initiation 431

of DNA replication in Escherichia coli. Mol. Res. 14 (4): 16888-16895. 432

Page 21 of 27



Draft

Fig 1. The effect of BaeR protein on NO production and iNOs mRNA expression. NO level was analyzed by measuring nitrite levels in the Griess reaction, after stimulation with BaeR (3 µg/mL) for the indicated

incubation times. Data are expressed as the means ± SD from three independent experiments. a–c Within

groups, bars without a common letter differ (P < 0.05). 46x24mm (300 x 300 DPI)

Page 22 of 27



Draft

Fig 2. Mechanisms of BaeR-induced inflammatory responses. RAW 264.7 cells were stimulated with 3 µg/mL or different concentrations of BaeR (A and B). Protein expression in cell lysates was examined by using different antibodies targeting IκBα and p65. Levels of β-actin (C-cytoplasm, D-nucleus) were used as an

indication of equal loading. (A) Relative expression level of COX-2 mRNA after exposure to BaeR (3 µg/mL) within the specified time. (B) Western blot analysis of COX-2 protein expression, which increased with

increasing BaeR concentrations. (C) Degradation of IκB in the cytoplasm within 5 min after exposure to BaeR protein to release NF-κB into the nucleus. (D) Releasing of p65 in the nucleus after degradation of IκB.

Values were normalized to the level of β-actin expression in each sample. (E) Decrease in the level of NO

after blockage of NF-κB by various concentrations of PDTC. (F) Reduction of iNOs mRNA expression after inhibition of NF-κB by PDTC. 139x109mm (300 x 300 DPI)

Page 23 of 27



Draft

Fig 3. Effect of NF-κB on the expression of different cytokines after exposure to BaeR protein. RAW 264.7 cells were treated with different concentrations of PDTC 1 h prior to exposure to 3 µg/mL of BaeR for 8 h. The supernatants were used to quantitatively analyze the relative expression of IL-1β, IL-6, and TNF-α by

ELISA. Reduction of IL-6 and IL-1β mRNA expression (A) and protein concentration (B). No significant difference was observed on TNF-α mRNA expression and protein concentration. Data are expressed as the means ± SD from three independent experiments. a–d Within groups, bars without a common letter differ

significantly (P < 0.05). 81x60mm (300 x 300 DPI)

Page 24 of 27



Draft

Fig 4. Effects of BaeR protein on the expression of type I and II IFN, JAK-2, and STAT1. (A) IFN-β reaches its peak within 4 h and all three IFNs were not detected after 12 h. (B) Phosphorylation of JAK-2 and STAT1

induced by BaeR. (C) Reduction of NO production and iNOs mRNA expression after JAK-2 inhibition by

AG490. 100x56mm (300 x 300 DPI)

Page 25 of 27



Draft

Fig 5: Effect of the JAK2/STAT1 pathway on the expression of inflammatory cytokines. Different concentrations of AG490 were applied before RAW 264.7 cells were treated with 3 µg/mL of BaeR. (A) IL-1β and IL-6 mRNA expression and protein concentration were significantly reduced after JAK2 was blocked by

different concentrations of AG490, while TNF-α expression was not affected. 75x50mm (300 x 300 DPI)

Page 26 of 27



Draft

Table 1. Oligonucleotides for gene expression analysis

Gene Oligonucleotide sequence (5′-3′)

IL-1β F:TGAGCACCTTCTTTTCCTTCA

R:TTGTCTAATGGGAACGTCACAC

IL-6 F:TAATTCATATCTTCAACCAAGAGG

R :TGGTCCTTAGCCACTCCTTC

TNF-α F :CTGTAGCCCACGTCGTAGC

R:GGTTGTCTTTGAGATCCATGC

iNOs F:TGTGGCTACCACATTGAAGAA

R:TCATGATAACGTTTCTGGCTCTT

INF-α4 F: ACAGTCCAGAAGACCAGAAGC

R: GTCACATCCTAGAGAGCAGGTT

INF-β F: GCTTCCATCATGAACAACAGGT

R: AGGTGAGGTTGATCTTTCCATTCAG

INF-γ F:CCAAGCGGCTGACTGAACT

R:TGGCCCGGAGTGTAGAGAT

COX-2 F:CACTACATCCTGACCCACTT

R:ATGCTCCTGCTTGAGTATGT

β -actin F: GTCATCACTATTGGCAACGAG

R:TTGGCATAGAGGTCTTTACGG

Page 27 of 27



Draft - Semantic Scholar...Draft 3 44 Introduction 45 Salmonella enterica, a rod-shaped,...

Documents

Transcript of Draft - Semantic Scholar...Draft 3 44 Introduction 45 Salmonella enterica, a rod-shaped,...