DNA conformation at the 5′ end of the chicken adult β-globin gene

Cell, Vol. 35, 467-477, December 1983 (Part I), Copyright 0 1983 by MIT

DNA Conformation at the 5’ End of the Chicken Adult @-Globin Gene

0092-8674/83/i 20467-l 1 $02.00/O

Joanne M. Nickel and Gary Felsenfeld Section on Physical Chemistry Laboratory of Molecular Biology National Institute of Arthritis, Diabetes, and Digestive and Kidney Diseases Bethesda, Maryland 20205

Summary

We have examined the conformation of DNA cloned from the hypersensitive region 5’ of the chicken adult ,&globin gene, in order to determine whether the unusual sensitivity to nucleases is related to altered secondary structure of the DNA. The region contains a large number of sites for methylation; we have studied the effect of methylation at Hpall sites on the topological properties of a small plasmid containing the region. We find that methylation does not alter the supercoiling properties of the plasmid under a wide variety of conditions; we find no evidence for conversion of any measurable segment of DNA to the Z conformation, even at high superhelix densities. We have also devised a protocol for mapping precisely the sites sensitive to Sl nuclease. The data are not consistent with the presence of cruciform structures. They reveal, however, a major cutting site located within a tract of 16 consecutive deoxyguanosine residues in the center of the hypersensitive region. Susceptibility to cutting is dependent upon supercoiling, but methylation at Hpall sequences has no effect on the Sl cutting pattern.

Introduction

The 5’ ends of transcriptionally active eucaryotic genes are often distinguished by a decreased level of methylation at position 5 of cytosine, and by the presence of sites that are unusually sensitive to nucleases when the DNA is packaged in chromatin. It is possible that both of these phenomena are connected to DNA secondary structure: Perhaps unusual nucleotide sequences lead to structural features that affect nuclease sensitivity, and perhaps DNA methylation has an effect on DNA structure.

In order to investigate both of these possibilities, we have made use of the 5’ region of the chicken adult p (0”) globin gene. When packaged in chromatin, the 5’ end of this gene has been shown to be highly susceptible to digestion by both nonspecific nucleases and restriction endonucleases. This hypersensitivity to nucleases is correlated with gene expression, and involves a region extending from -60 to -260 bp 5’ of the site of initiation of transcription. Within this region is a 115-bp segment that can be excised from nuclear chromatin by the action of the endonuclease Mspl, a fact which suggests that the region does not have a nucleosome bound to it (McGhee et al., 1981). Larsen and Weintraub (1982) have shown

that the single strand-specific Sl nuclease also cleaves this region preferentially within the erythrocyte nucleus. Furthermore, they report that these same preferred sites of Sl nuclease cleavage exist in the protein-free DNA of supercoiled recombinant plasmids, in plasmids transfected into L-cells, and in plasmids reconstituted with core histones in vivo. This leads them to suggest that the nuclease hypersensitivity associated with active genes is related to the altered DNA secondary structure (Larsen and Wein- traub, 1982; Weintraub, 1983).

Several kinds of altered DNA conformation are possible (see review, Cantor, 1981). Where palindromic sequences are present, rearrangement to cruciform structures may occur. Where the sequence contains runs of alternating purines and pyrimidines, it may be converted to the left- handed Z form. When the sequence has a low denaturation temperature, it may possess a certain amount of single- strand character. All three of these conformations are stabilized when the sequence is incorporated in supercoiled molecules, since formation of any of the three conformations relieves the torsional strain of supercoiling. In each case, the DNA would be susceptible to digestion by Sl nuclease; the cruciform structure is susceptible at the loops, whereas the Z form is susceptible at the junctions between B and Z DNA (Singleton et al., 1983).

Methylation of DNA at position 5 of cytosine provides another possible mechanism for altering DNA conformation, particularly in the 5’-flanking region of the p” globin gene, which contains six times the genomic abundance of the sequence CpG, the usual site of methylation in animals (Razin and Riggs, 1980). Methylation has been shown to enhance greatly the stability of the Z form of the alternating copolymer poly(dC-dG). poly(dC-dG) (Behe and Felsen- feld, 1981). It is also possible that methylation could alter the stability of cruciform or partially single-stranded conformations Finally, the presence of 5methyl cytosine might affect the local conformation of B form DNA in the same way as any other base substitution.

In this paper, we test the idea that the 5’-flanking hypersensitive region of the /3” globin gene can assume an altered secondary structure that underlies its increased susceptibility to nucleases. To analyze the conformational behavior of this region, the sequence spanning -407 to +I96 in the gene was subcloned into pUC7 (Veira and Messing, 1982) to form pGF3, a small plasmid in which conformational changes in the insert might be expected to have a measurable effect on the overall conformation of the plasmid. We use this plasmid first to study the effects of methylation, taking advantage of the high proportion of Hpall (Mspl) sites upstream of the PA globin structural gene and making use of the Hpall methylase. As already mentioned, in certain cases methylation at position 5 of cytosine can have dramatic effects on the conformation of a DNA sequence. However, we find no effect of methylation on the supercoiling properties of the plasmid under a wide variety of conditions, nor do we find evidence for a conversion of any measurable segment of DNA to a

Cell 468

lefthanded conformation, even at high superhelix densities.

We have also carried out a detailed mapping of the Sl nuclease-sensitive sites in the same plasmid. The Sl nuclease sensitivity is dependent upon supercoiling. We find that the major cutting site is not within a palindrome, but rather is located within a tract of 16 consecutive deoxyguanosine residues in the center of the chromatin-hypersensitive region. Moreover, DNA methylation has no effect on the Sl-cutting pattern. Although it cuts within the hypersensitive region, Sl does not cleave the supercoiled plasmid at the same sequences as those cut in chromatin by DNase I, DNase II, or micrococcal nuclease. The domain of Sl sensitivity in the plasmid does not seem large enough to account directly for the overall nuclease sensitivity, which extends over a region 200 base pairs long. However, local structural deformations, or modifications such as methylation, may serve to alter the interactions of DNA with specific proteins; these in turn could modify the normal structure of chromatin over considerable distances.

Results

Effect of Methylation on DNA Conformation- Electrophoretic Analysis of Supercoiling We first investigated the effects of methylation on the structure of the 5’-flanking region of the PA globin gene. The structure of pGF3, the recombinant plasmid used in these experiments, is diagrammed in Figure 1. Since the globin gene insert constitutes - 18% (603/3318 bp) of the total length of the recombinant plasmid, any major conformational changes the globin gene sequence may undergo should confer a detectable alteration on the structure of the entire plasmid. The protocol involves methylating the 5position of the internal cytosine of the Hpall site (CCGG) of the supercoiled plasmid with Hpall methylase, and monitoring conformational changes by direct electropho- retie analysis. The entire plasmid contains 22 Hpall sites (14 in the vector and 8 in the chicken sequence) and 212 total CpG sequences (179 in the vector and 33 in the chicken sequence), the usual sites of methylation in eu- caryotes (at the 5-position of cytosine). Methylation with Hpall methylase will modify a subset of all possible se-

pGF3

Figure 1. Map of pGF3

The Pvull fragment encompassing the region -407 to +I96 of the chicken 0” globin gene was cloned into the Hincll site of pUC7 (Veira and Messing, 1982). The thin line represents the chicken sequence; the thick line represents the vector consisting of Ml3 sequences (open area) and pBR322 sequences (hatched area). The cuttrng sites of various restriction enzymes used in our experiments are also denoted.

quences available for methylation in vivo in the entire plasmid (22/212 = IO%), whereas for the globin gene insert itself the proportion is higher (8/33 = 24%).

To determine if methylation at the Hpall sites affects DNA conformation, the DNA of both methylated and mock- methylated plasmids pUC7 and recombinant pGF3 was nicked with DNase I in the presence of ethidium bromide and subsequently treated with DNA ligase after ethidium bromide removal. The resulting relaxed closed circular plasmids were electrophoresed on agarose gels to display the distribution of individual topoisomers around the fully relaxed state. A change in the DNA twist should be evidenced by an offsetting or staggering of the individual bands that represent DNAs with the same linking number. As can be seen in Figure 2, the bands corresponding to discrete linking number species migrate identically in both methylated and unmethylated pUC7 and pGF3. Assuming that we could detect a band shift corresponding to 10% of the interband distance, this method should have de- tected an effect of methylation on total DNA twist corresponding to 36” or larger. If every methylated site in the plasmid contributed equally to the change in twist, there would be a change of 36122 = 1,7’/methylated site. Since 8/22 = 37% of all methylatable Hpall sites of pGF3 are within the globin gene region, this indicates that methylation has little effect on the conformation of this particular piece of eucaryotic DNA.

To extend this analysis to topoisomers encompassing the full range of resolvable superhelical densities, methylated and unmethylated pGF3 were treated with various amounts of an extract from chicken erythrocytes containing DNA topoisomerase I activity. The resulting distribution of DNAs was resolved on agarose gels as shown in Figure 3. The bands corresponding to discrete linking numbers migrate identically in both pGF3 samples. This can be seen both in the gels themselves and in the corresponding densitometer scans of the unmethylated (Figure 3, lane d and Scan A) and methylated plasmid (Figure 3, lane m and Scan B).

The effect of introducing high levels of supercoiling is to favor local changes in the twist of DNA that reduce the torsional strain of supercoiling. For example, formation of Z DNA in tracts of appropriate sequence are favored by high levels of supercoiling (Singleton et al., 1982; Peck et al., 1982). We wished to determine whether pGF3 dis- played anomalous behavior under such conditions, and particularly whether methylation at the Hpall sites would result in any abrupt conformational transitions. To accomplish this, DNA gyrase was used to induce approximately twice the normal level of negative supercoiling in both methylated and unmethylated plasmids. The resulting overwound DNAs were analyzed on agarose gels containing various concentrations of chloroquine (50, 100, 150 pg/ml) to resolve the full range of superhelical densities, as shown in Figure 4. If a segment of the methylated plasmid underwent (for example) a transition from B to Z form in this overwound state, this would relieve the superhelical strain (loss of about 2 negative supercoils for each

5’ End of Chicken p-Globin Gene 469

10 bp of DNA undergoing the transition) and enable gyrase to insert additional negative supercoils during the reaction. Such increased superhelical density should be detectable on chloroquine-containing agarose gels. The experimental results of Figure 4 show that the gyrase did act upon the plasmids to introduce negative supercoils, since a higher

B

Figure 2. Electrophoretic Analysis of Relaxed Closed Circular Plasmids

pUC7 (lanes a-c) and pGF3 (lanes f-h) were nicked by DNase I in the presence of ethidium bromide, ligated, and analyzed on 1% agarose gels as described in Experimental Procedures. Unmethylated (lanes a and f), methylated (lanes b and g), and the combination of methylated and unmethylated plasmids mixed during ligation (lanes c and h) were analyzed. Controls in lanes d and e are unmethylated and methylated plasmids that were nicked by DNase I/ethidium bromide treatment but not ligated. The densitometer tracings of unmethylated (lane f) and methylated (lane g) pGF3 are shown as Scans A and B, respectively.

chloroquine concentration is required to unwind the gyrase- treated DNA than untreated samples (compare Figure 4, lanes c and d with lanes a and b at the different chloroquine concentrations). There is no difference in the superhelical distributions of the methylated and control plasmids treated with gyrase, as can be seen most clearly in Figure 4 in the gel containing 100 pg/ml chloroquine (compare lanes a and b). At this chloroquine concentration, there is good resolution of topoisomers with different linking numbers, yet there is no difference between the two samples. Methylation at the sequence CCGG does not induce a change in the handedness of the DNA even when the plasmids are under high negative superhelical strain. It should be noted that the data in Figure 3 also show that in the range of superhelix densities resolved on the gel (0 to - -0.03) there is no anomalous behavior such as might be associated with a B-Z transition, either before or after methylation

Sl Nuclease Sensitivity of the 5’-Flanking Region of the .BA Globin Gene The single strand-specific nuclease Sl is known to cleave at specific sites on supercoiled DNA; these sites usually contain inverted repeat sequences capable of rearranging to the cruciform conformation (Lilley, 1980; Panayotatos and Wells, 1981). Larsen and Weintraub (1982) have recently probed the chromatin structure of several active genes and found that regions hypersensitive to DNase I are also sensitive to Sl They report that a similar pattern of sensitivity to Si can be observed in a supercoiled recombinant plasmid containing the same DNA sequences In the following experiments, we map the Sl- sensitive sites of the p” globin gene in detail, both in unmethylated and methylated plasmids.

We first determined the approximate location of Sl cleavage sites in the globin insert of pGF3. Plasmids were digested in either low or high salt buffers with sufficient Sl nuclease to produce linear molecules (Form Ill) (Figure 5, lanes d and e), which were then further digested with appropriate restriction endonucleases. The fragment distribution was determined by gel electrophoresis and appropriate blotting techniques. As shown in Figure 6, Sl cuts only once within each molecule, and the cuts are made at specific sites. The presence of two fragments -200 and -400 bp long in the Sl/EcoRI double digest (Figure 6, lanes e-h) shows that the 632-bp EcoRl fragment containing the globin insert has been cleaved internally by Si. Double digests with Sl and a variety of restriction endonucleases show that methylation at CCGG sequences has no effect on susceptibility to Sl

A somewhat more detailed analysis using Sl/BamHI digests is shown in Figure 7. In this case, hybridization was carried out with separate probes specific for the 5’ (-407 to -214) or 3’ (-214 to +196) portions of the globin insert. Hybridization to the combined probes reveals a strong Sl-cutting site within the globin sequence (Figure 7, lanes d and e), yielding fragments 226 and 381 bp long under both high and low salt conditions. There are also

Cell 470

minor fragments of length 191, 250, 358, and 415 bp. When the hybridization probes are used separately, it is found that the 5’.specific probe hybridizes to the major 226-bp band as well as to minor bands at 191 and 358 bp, while the 3’specific probe hybridizes to the major 381- bp band and to minor bands at 250 and 415 bp. The positions of the cutting sites are diagrammed at the bottom of Figure 7. The major site, A, is located at -187 to -179 within the 5’-flanking region of the PA globin gene; minor sites B and C are at (-222 to -213) and (-55 to -48) respectively.

The limits of resolution of gel-blotting transfer experiments do not permit exact correlation of the Sl cleavage sites with the base sequence of pGF3. To accomplish this precise mapping, we chose Sl conditions known to generate predominantly nicked circular (Form II) pGF3 DNA (Figure 5, lanes b and c). The preferential site of first attack by Sl can be assayed by the protocol outlined in Figure 8. This procedure introduces label into the PA globin gene primarily at the restriction site (Sl ends are not labeled;

see below) and one can determine exactly the distance of the Sl cut from this labeled position.

This analysis with the Pstl site 3’ end-labeled by terminal transferase with [a-3’P]3’-dATP is shown in Figure 9. The Pstl/BamHI double digest should yield two fragments: fragment A extends from -213 to +I96 of the p” globin gene and fragment B extends from -407 to -210 (see schematic diagram in Figure 9). The majority of pGF3 molecules are not cut by Sl within the chicken sequence and therefore migrate as full length fragments of 417 (A) and 203 (B) nucleotides. The bands migrating with the mobility of -180 bases in A and -122 bases in B result from full length DNA fragments resistant to denaturation under these gel conditions, We have attempted various denaturation procedures but there is always some proportion of double-stranded fragments probably due to the high GC composition (>70%) of these fragments. As can be seen particularly in the overexposed panels A and B on the right side, the controls without Sl also contain cleavages at specific sites within the DNA. These could

A B pGF3 pGF3-Me

I I I 1 0 .05 ,075 0.1 0.15 0.2 0.25 0.3 0.4 0 .05 ,075 0.1 0.15 0.2 0.25 0.3 0.4~1 abcdefghijklmnopqr

Figure 3. Electrophoretic Analysis of Topoisomers of Unmethylated (Lanes a-i) and Methylated (Lanes j-r) pGF3

Plasmids were incubated with the designated amounts of a chicken erythrocyte extract containing DNA topoisomerase I, dproteinized, and analyzed on 1% agarose gels Densitometer tracings are provided for unmethylated (lane d and Scan A) and methylated (lane m and scan B) pGF3.

50 pg/ml chloroquine 100 pg/ml chloroquine 150 &ml chloroquine +GYRASE

r I +M --M

a b

CONTROL +GYRASE CONTROL +GYRASE CONTROL t 1 I 1

+h4 I I I I

-M +M --M I I

+M --M +M -M +fVl -M c d a b c d a b c d

Both methylated (lane a) and unmethylated (lane b) pGF3 were treated with DNA gyrase and analyzed on 1% agarose gels containing 50, 100, or 150 fig/ml chloroquine. Methylated (lane c) and unmethylated (lane d) pGF3 control DNAs were also analyzed on the same gels

5’ End of Chicken /3-Globrn Gene 471

arise from the small population of nicked circles contained in the starting material (see Figure 5, lane a) or the nicks could be generated by small amounts of endonuclease contamination of the restriction enzymes, or by the rather complex manipulations to which the DNA has been sub- jected. However, above this background of endonucleo- lytic cleavage, the experimental samples clearly contain cleavage specifically generated by Sl Within fragment A there is a region of Sl susceptibility 23 to 28 nucleotides downstream from the Pstl cutting site. These Si cleavages are within a stretch of 16 consecutive deoxyguanosine residues; specifically, the cuts are -186 to -191 with strongest cutting at -190, -189, as can be seen when aligned with the sequence for this region in Figure 12. In Figures 9 and IO, the template strand is analyzed, and the cuts are actually occurring in the string of Cs complementary to the string of Gs. In Figure 11, cutting in the string of Gs is measured.

Specific Sl cleavages in fragment B (Figure 9B) are not as prominent and can only be seen in the darker exposure on the right. There is a series of sites 31, 33, and 35 nucleotides upstream of the -210 Pstl site in a sequence TGGGG-a small deoxyguanosine tract. The cutting patterns in fragments A and B are not changed by methylation at Hpall sites (compare Figure 9, lanes b and c), nor are

II

Ia

I

they induced by some component in the methylase, since they are present in control pGF3 Si digests not incubated with the Hpall methylase (Figure 9, lane a).

We wished to corroborate the assignments of Sl-susceptible sites by secondary restriction at a site downstream from the Sl hypersensitive region; Ball was chosen because it cleaves at -167 to yield a fragment spanning -407 to -167 near the region of interest. The protocol (outlined in Figure 8) is similar to that for Pstl except that the Ball-generated ends are 5’ end-labeled by polynucleotide kinase and [y-32P]ATP. Figure IO shows an analysis of such a digest on a denaturing gel. Again there is some nondenatured fragment migrating at -130 bases, and the

.a b c m d e

Figure 5. Electrophoretrc Analysis of pGF3 Digested with Sl Nuclease

Form I pGF3 DNA (lane a) was digested with Sl to yield predominantly nicked Form II (lanes b and c) or linear Form III (lanes d and e) species. Methylated (lanes c and e) and unmethylated (lanes b and d) pGF3 were analyzed on 1% nondenaturrng agarose gels. Markers (lane m) are Hrndlll digest of X DNA and Haelll drgest of 4X174 replicative form DNA.

n- m- -3317 b”

--2368 I-

Figure 6. Autoradiogram of Products of Double-Stranded Sl Drgestion of pGF3

Methylated (+M) and unmethylated (-M) supercoiled plasmrds were digested with Sl in either low (upper panel) or high (lower panel) salt, followed by digestion wrth the designated restriction nucleases as described in Experimental Procedures. Pstl cuts once in the recombinant plasmid within the chicken sequence and Pvul cuts twice within the vector sequence such that the pA globin gene resides on a fragment 2368 bp in length (see Figure 1). EcoRl cleaves the vector to excise the entire 600.bp pA globin gene region. Controls not treated with Sl (-Sl) were also analyzed. Following electrophoresis, the nondenaturing 1.5% agarose gels were transferred to DBM paper and hybridized to the labeled 600.bp chicken insert sequence of pGF3. I, II, and III designate the mobility of the corresponding pGF3 supercoiled. nicked, and linear molecules, respectively.

Cell 472

I 5’and 3 Robe ’ ‘5’ Probe’ ‘3’ Probe’

ab cde f 9 h i

310- 271/278-

234-

l%l-

Barn HI I

-4J7

A. 226bp -187 -179

B. - 191 bp -222

-213

BamHl f

+Ea

I 381 bp

415 bp I

c. ’ I 35% bp -55

250 -44

Figure 7. Autoradiogram of Products of Double-Stranded Sl Nuclease Digestion of pGF3

Supercoiled plasmid was digested with Si in low (lanes a, d, f, and h) or high (lanes b, e, g, and i) salt buffer and subsequently restricted with BamHl to excise the chicken 0” globin gene insert The digestion products were analyzed on a 2.5% nondenaturing agarose gel which was then transferred to DBM paper. Identical blots were hybridized with either 5’ and 3’ probes (lanes a-e), or 5’ probe alone (lanes f and g) or 3’ probe alone (lanes h and i). Generation of the specific probes is detailed in Experimental Procedures. Control lanes a and b were generated by Sl digestion of pGF3 and omitting secondary restriction, Control lane c was generated by BamHl digestion of pGF3 without Sl treatment. Insert panel contrasts the Si digestion of methylated (+M) versus unmethylated (-M) pGF3 in low salt (lanes j and k) and high salt (lanes I and m) buffer. The markers are Haelll digest of 4x174 RF DNA. The summary of the double strand Si-cutting site analysis is shown at the bottom of the figure. The two major cleavage fragments (designated A on the blot) map to yield cutting pattern A shown in the diagram. The minor cutting patterns I3 and C are derived from the corresponding bands B and C designated on the blot.

DNA not treated with Sl (Figure IO, lanes d-f) shows a background of discrete bands. However, the Sl-treated pGF3, whether control or methylated (Figure 10, lanes a- c) shows a predominant susceptible domain 15 to 20 nucleotides upstream from the -167 Ball site. This corresponds again to cutting within the long deoxyguanosine tract, with the major cutting at -184 and -185 (see Figure 12). We attribute the slight offsetting of the cleavage sites compared to Pstl secondary cleavage to Sl exonuclease activity. In addition to this predominant cleavage, there is a minor product 52 to 54 nucleotides long (designated by arrows in Figure IO) which results from cleavage at the sequence TATA at position -218 to -220. We could not discern this with Pstl secondary cleavage because it is only 9 bases from the Pstl site. There is also a very minor component that corresponds to cleavage at -242.

Both these analyses of single-strand Sl cleavage sites involved labeling the same DNA strand, the template

strand. We used a similar strategy to map the Sl susceptible sites on the complementary nontemplate strand of this same Ball fragment. Figure 11 shows the denaturing gel analysis of such an experiment. Although the resolution of the individual bands is blurred, probably because of secondary structure interactions during electrophoresis, it can be seen that the major cleavage site on this strand encompasses a region directly opposite the susceptible region on the complementary template strand. The exact St sites on both strands are mapped to the sequence of the region in the diagram at the bottom of Figure II. In addition to this predominant site, Sl also attacks at several other places marked by arrows to the right of the gel in Figure Il. As with the complementary strand, there is a minor product 52 to 54 bases long (-218 to -220 on the sequence). Additional sites map to -198 (32 bases long) at the end of the G stretch, -228 (62 bases long) bordering a GCGC sequence, and -367 (200 bases long) bordering

5’ End of Chicken p-Globin Gene 473

ANALYSIS OF SINGLE-STRANDED Sl CLEAVAGE SITES WITHIN CHICKEN fi” GLOBIN GENE REGION OF pGF3

Supercoiled pGF3

Sl I

One Single Stranded Cleavage per Molecule

II Bai I resricmn ( - 166, + 1671 1 I Pst I renr~cf~on I - 214)

21 Polynucleotide kinase 21 Terminal transferase + ly “‘PI ATP + ICI “PI 3’ dATP

31 Barn HI restriction to excm 31 Barn HI reStriction to excise entire chicken sequence entire chcken sequence from plasmid from plasmid

+ + Denaturing gel Denaturing gel

Figure 8. Procedure for Mapping the Smgle-Stranded Sl Cleavage Sites within the Chicken PA Globin Gene Region of pGF3

a TGTG sequence. All these latter regions are much less susceptible to Sl attack than is the deoxyguanosine stretch. None of these Sl cleavages is found in the relaxed closed circular pGF3 DNA (data not shown).

Two controls were also done. We wished to assess the amount of 3’.dATP radioactivity that the terminal transferase would incorporate into internal nicks in the pGF3 molecule. To accomplish this, pGF3, after Sl digestion but before restriction, was incubated with terminal transferase to label all accessible 3’ ends, but not the specific ends generated by restriction enzymes in the experimental samples. The total sample thus labeled was analyzed on the gel of Figure 11, lanes b and d. In contrast, the experimental lanes a and c contain only 5% of their respective samples. Therefore, the procedures used in these experiments result in only minimal incorporation at Sl -generated or endogenous nicks, which do not interfere with the assignment of cleavage sites. We also preincubated supercoiled pGF3 under two different conditions chosen to overcome kinetic barriers to cruciform formation (IO mM Tris-HCI, pH 8.0, 30 mM NaCI, 1 mM EDTA, or 10 mM Tris-HCI pH 8.0, 10 mM NaCI, 1 mM EDTA, 0.01 mM

spermidine, 50°C for 2 hr; M. Gellert, personal communi- cation). No differences were found in the Sl nuclease digestion pattern, compared to Figure 9 (data not shown).

The summary of all the Sl data for the template strand only is presented in Figure 12, together with the sequence of pGF3 from Ball (-167) to Pvull (-407). This sequence, which we determined, is slightly different from that reported by Dolan et al. (1983) from their clone of the /IA globin gene. The Sl cleavage site obtained from the analysis of double strand cuts and blotting agrees well with results of the single strand end-labeling analysis.

Discussion

Chromatin structure in the 5’.flanking region of genes that are being expressed often displays unusual features (see review in Elgin, 1981). McGhee et al. (1981) have analyzed the chromatin structure of the chicken p* gene in great detail, and have shown that the 5’-flanking region of the active gene contains a segment about 200 base pairs long that is very sensitive to digestion by a wide variety of nucleases. The data strongly support the idea that this region is free of nucleosomes.

This region possesses a number of unusual features of nucleotide sequence that might affect the local conformation of the DNA. While there are no large palindromes that could give rise to cruciform structures (see below), there are several short alternating purine-pyrimidine tracts (6-8 bp long) that might be capable of transition to the left-handed Z conformation. Most notably, this region is GC-rich (70%) and contains 33 potentially methylatable (CpG) sites, six times the genomic abundance. Many of these sites are known to undergo strong modulation of methylation correlated with expression of the globin gene (McGhee and Ginder, 1979; Ginder and McGhee, 1981). Finally, this 5’.flanking region contains a tract of 16 deoxyguanosine residues extending from nucleotides -182 to -197.

In this paper, we have analyzed the effect of each of these sequences on the conformation of the 5’-flanking DNA, in the hope that we could relate the altered structure of chromatin in this region to unusual properties of the DNA. In carrying out these experiments, we have used a small recombinant plasmid so that any effects on the conformation of the insert (extending from -407 to +I96 and encompassing the entire hypersensitive region) would exert a measurable effect on the entire plasmid.

Although this plasmid contains 22 sites modified by Hpall methylase, we cannot detect any effect methylation at these sites has on plasmid conformation. Over a very wide range of linking numbers from fully relaxed to highly supercoiled, the methylated and unmethylated topoisomers of this plasmid migrate indistinguishably on electrophoretic gels (Figures 2-4). Thus, methylation at these sites cannot affect the local twist of the DNA by more than 1.7”/site and there certainly cannot be any special long range effects of such methylation on the DNA conforma-

Cell 474

tion of the 5’-flanking region of the PA globin gene. The analysis of topoisomers also reveals that methylation does not cause extensive regions to assume the Z conformation under moderate conditions of supercoiling. Furthermore, Sl nuclease-cutting patterns of unmethylated plasmids (see below) are not consistent with the presence of Z DNA segments in any appreciable fraction of molecules at superhelix densities of -0.05 to -0.06. We note that there is a very small amount of cutting at -228 and -367, both of which are near an alternating pyrimidine/purine or purine/pyrimidine tetranucleotide. On the other hand, no cuts are found near the sequence (GC)4 starting at -303, which is most likely to assume the Z conformation. The “normal” superhelix density that can be achieved within chromatin by the removal of one or more nucleosomes, while leaving adjacent nucleosomes fixed (for example in a 30-nm so- lenoid) is about -0.06. This would suggest that, in the absence of factors such as special proteins that bind preferentially to Z DNA, the chromatin of the 5’.flanking region would also be devoid of DNA in the Z conformation.

We have also made use of the single strand-specific nuclease Si to probe for other unusual DNA conformations in this region. This enzyme has been shown to cleave at the site of various “defects” in the normal B DNA structure, including the single strand loops of cruciforms (Lilley, 1980; Panayotatos and Wells, 1981) and the transitional nucleotides between stretches of B and Z DNA (Singleton et al., 1983). The data presented in Figures 9-11, and summa- rized in Figure 12, show that under both high and low salt

Figure 9. Mapping of Srngle-Stranded Sl Cleav- age Sites from the Pstl sate within the 0” Globin Gene Sequence of pGF3

Supercoiled DNA (C is pGF3 not incubated with Hpall methylase; -M is mock-methylated with Hpall methylase; +M is methylated) was digested with Sl and treated as outlined in Figure 8 for labeling at the 3’ end of the Pstl site. The two resulting fragments were denatured and analyzed on 6% acrylamide denaturing gels in 8.3 M urea. Control DNAs not treated with Sl (-Si) were identically analyzed. Panels A and EI refer to analysis of fragments A (417 bases long, -213 to +196) and B (203 bases long; -407 to -210), respectively. The two right panels are longer ex- posures of the same gel. The schematic diagram at the bottom of the figure depicts the two fragments and the positions of the =P label. The markers were denatured fragments resulting from Hpall digest of pBR322.

solvent conditions, cutting by Sl is restricted to a small number of sites. None of the sites is part of a potential cruciform. The absence of cruciforms is not surprising: analysis of the nucleotide sequence of this region shows that all palindromic sequences involve either considerable mismatching of base pairs, or large separations that would give rise to long single strand loops if rearrangement to the cruciform conformation occurred. The cost in energy of such a rearrangement in most cases exceeds the gain from relief of supercoiling stress. The one possible excep- tion, involving the region -262 to -300, might be margin- ally stable under normal supercoiling conditions, but there is no evidence from our Sl data for the presence of a cruciform at this position.

The principal site of Sl attack is in the tract of 16 consecutive deoxyguanosine residues. Although this tract lies within the 200.bp region accessible to nucleases in active erythrocyte chromatin, the exact cleavage sites do not overlap those found in chromatin for DNase I, DNase II, or micrococcal nuclease (McGhee et al., 1981); the structure giving rise to Sl sensitivity is clearly not identical to that which confers sensitivity to the other nucleases in chromatin.

Sensitivity to Sl in noncruciform structures was first reported by Hentschel (1982) who found that repeating dinucleotide sequences such as 5’(GpA)” could be cut by that enzyme. He suggested that the availability of out-of- register base-paired structures would tend to stabilize locally denatured conformations. Such denatured forms

5’ End of Chrcken @-GlobIn Gene 475

# Bases a b c d e f

90

76

67

34

26

19, 18-

15 i

BamHl Bal I

t 1 I *

-407 - 167

Frgure 10. Mapping of Single-Stranded Sl Cleavage Sites from the Ball Site within the Template Strand of the Region Flanking the 8” Globin Sequence of pGF3

Supercoiled DNA (C is pGF3 not incubated with Hpall methylase; -M is mock-methylated, and +M is methylated with Hpall methylase) was digested with Si and treated as outlined In Figure 8 for labeling at the 5’ end of Ball site at -167. The isolated fragment was analyzed on a denaturing gel as in Figure 9. Control plasmids not digested by Sl (-Sl) were Identically treated. The markers were denatured fragments resulting from Hpall digestion of pBR322.

are likely to be especially stable because the loop on one strand is matched by an uninterrupted opposite strand. Our results differ from Hentschel’s, however: we do not see a bimodal distribution of cutting sites, and we observe a dependence of Sl cutting on supercoiling not present in the system which he studied. We find that relaxed circular and linear DNA are resistant to attack by Sl. This is not surprising, since formation of a locally denatured structure such as that described above results in relief of supercoiling stress, and the structure should therefore be favored in supercoiled molecules. It is important to note that we do

Non-Template Strand

Template Strand

Figure 11. Mapprng of Srngle-Stranded Sl Cleavage Sites from Ball Site within the Nontemplate Strand of the Region Flanking the pA Globin Sequence in pGF3

Supercoiled DNA [either control (lane a) or Sl -digested (lane c)] was treated as outlined in Figure 8, except the Bail site at -167 was labeled at the 3’ end with [Lu-32P]3’-dATP by terminal transferase. The Isolated fragment was analyzed on a denaturing gel as In Figure 10. Lanes b and d contained pGF3 plasmids labeled with terminal transferase before Ball restriction, but after Sl digestion for lane d. These samples were subsequently restricted wrth Ball and the same protocol was followed. Markers were denatured fragments of Hpall digest of pBR322. The sequence of this region of the chicken PA globin gene is shown at the bottom of the figure. The arrows denote single-stranded Sl cleavage sites mapped within this Ball fragment on both the template (see Figure 10) and nontemplate strand. The length of the arrows denotes relative cleavage frequencies as measured by densitometer tracrng of the autoradiograms.

not know if the Sl-sensitive structures pre-existed before Sl challenge. It is conceivable that the low pH of digestion results in preferential denaturation of the poly(dG) tract due to protonation of the cytosine amino group.

The susceptible deoxyguanosine tract lies near the center of the 115bp fragment released by Mspl digestion of nuclei active in the expression of the PA globin gene (McGhee et al., 1981). As discussed earlier, the response to Mspl had led us to suggest that this region is free of nucleosomes in these cells. There is some evidence sug-

Cell 476

Fv” II u -4* -38” -P - p

CCGTCTGGTGTGCTGGGAGGAAGGACCCAACAGACCCAAGCTGTGGTCTC

-7 -9” -$ -$ -$ CTGCCTCACAGCAATGCAGAGTGCTGTGGTTTGGAACTGTGTGAGGGGCA

-Y - 3,ca -$ -F -70 -$ CCCAGCCTGGCGCGCGCTGTGCTCACACAGCACTGGGGTGAGCACAGGGTGCCA

SliPsI I + + i2m PSI

-Y -7 -$ -2y TGCCCACACCGTGCATGGGGATGTATGGCGCACTCCGGTATAGAGCTGCA

-Y - I,80 -170

GAGCTGGGAATCGGGGGGGCiGGGGGGGGCGGGTGGTGGTATGGCC

Figure 12. Summary of Si Cleavage Sites within the Chicken PA Globin Sequence in pGF3

The sequence extending from the Pvull site at -407 to Ball at -167 is listed. The major product from double-stranded Si cleavage (obtained from analysis of Figure 7) is denoted as site A, and the minor cleavage product of the same reaction is site B. The major products obtained from analysis of single-stranded Sl cleavages (both Sl/Pstl above and Sl/Ball marked below the sequence) are designated by arrows. The length of the arrows reflects the relative frequency of cutting at each position. Minor single- strand Sl products are also present in the region around -220 and -242. For comparison, the locatron of chromatin nuclease cleavage sites as mapped by McGhee et al. (1981) is as follows: micrococcal nuclease (-230 to -260) DNase I (-145 to -160 and -65 to -85) and DNase II (-110 to -140). Non-template strand is depicted, but cuts shown are on template strand.

gesting that nucleosomes form poorly on synthetic poly(dG). poly(dC) (Simpson and Kunzler, 1979) and it is possible that this contributes to the release of histones from this DNA segment. Weintraub (1983) has in fact shown recently that this region loses nucleosomes preferentially in competition with protein-free DNA. However, Weintraub (1983) did not detect Sl cutting at the cluster of deoxyguanosines within a recombinant plasmid, as we observe; he reported instead that Sl-cutting sites on recombinant plasmids were located primarily at position -150 with a minor site, which we also observe, at -50. Our procedure differs from that of Weintraub in that we first restrict the Sl -nicked plasmid, then terminally label the double-stranded restriction cut, while Weintraub labels the nicks, and then cuts with restriction enzyme. We have chosen conditions in which the nicked sites are not labeled (see Results), and it is in fact quite difficult to label nicked DNA termini uniformly and at high efficiency. It seems particularly likely that the extended G . C sequence would be resistant to local denaturation at nicks, and therefore resistant to labeling by Weintraub’s procedure. The procedure described here (see Figure 8) ensures that each Si-nicking site is accorded equal weight in the analysis. Furthermore, the use of purified restriction fragments for the final denaturing gels ensures a straightforward and unequivocal assignment of cutting sites within the globin sequence.

The results with Sl nuclease are of particular interest because they show that even a sequence rich in G .C base pairs, which should be relatively stable to local denaturation, can be a preferential site of attack by a single strand-specific nuclease. Homopolymer sequences are found in the 5’-flanking regions of other genes, These, too, are likely to be sites of Sl attack, and it may be that their tendency to form partially denatured structures allows them to play a role in regulation.

Although there are several other unusual structural features within the DNA of this Y-flanking region, they do not necessarily play a simple role in organizing chromatin structure. In particular, we can find no evidence that methylation (at least at the Hpall subset which represents 24% of all CpG sites in the chicken sequence) operates as a switch to alter DNA conformation dramatically, nor can we find evidence of Z DNA sequences within the region under normal supercoiling conditions. It is probable that some of these unusual features of DNA structure present in the 5’.flanking region of the globin gene are parts of the regulatory mechanism of gene expression and will have an effect on chromatin structure. Such mecha- nisms must involve specific proteins that recognize these unusual DNA structures; further studies should center on a search for those proteins.

Experimental Procedures

The plasmid pCAjYG1 which contains the p” chicken globin gene cloned into pBR322 (Ginder et al., 1979) was digested with Pvull, and the fragment extending from -407 to +I96 (transcription starts at +l) in the globin gene was isolated and subcloned into the Hincll site of pUC7 (Veira and Messing, 1982). Plasmid DNA was methylated with Hpall methylase (New England Biolabs) as suggested by the supplier. Control DNAs were mock-methylated by incubation with the methylase in the absence of the methyl donor, S- adenosylmethionine. After methylation, the samples were deproteinized by incubation with proteinase K followed by extensive phenol extraction and ethanol precipitations. To assay for completeness of methylation, the plasmid preparation was digested with both Hpall and Mspl and analyzed on 1% agarose gels.

To generate relaxed closed circular topoisomers, the supercoiled pGF3 (13.5 pg/ml) was first digested with DNase I (2 rg/ml) in the presence of ethidium bromide (0.3 mg/ml) in 5 mM Tris-HCI, pH 8.0, 60 mM NaCI, IO mM MgCl*. These conditrons were chosen to maximize the production of nicked circles (Form II), which were then deproteinized and ligated after ethidium bromide removal at a DNA 5’termini concentration of 0.15 pM with 0.01 units Tq DNA ligase (New England Biolabs) in 50 mM Tris-HCI, pH 8.0, IO mM MgCI,, 20 mM dithiothreitol, 50 pg/ml bovine serum albumin, and 1 mM ATP. The reactions were ended by adding EDTA to 15 mM final concentration and the samples were analyzed on 1.5% agarose gels (50 V, 18 hr) in 40 mM Tris-phosphate buffer, pH 7.8, containing 1 mM EDTA.

Nicking closing extract purified from chicken erythrocytes (Camerini- Otero and Felsenfeld, 1977) was used to relax supercoiled DNA in 0.2 M NaCI, 20 mM Tris-HCI, pH 8.0, 0.25 mM EDTA, 5% glycerol. The reactions proceeded for 30 min at 37°C were terminated by addition of EDTA and SDS to 1 mM and O.l%, respectively, and were analyzed on 1.5% agarose gels in Tris-phosphate buffer.

Methylated and control plasmids were negatively supercoiled to approximately twice normal negative superhelical density by E. coli DNA gyrase and deproteinized, and the resulting topoisomers were analyzed on 1% agarose gels containing 50,100, or 150 pg/ml chloroquine in Tris-phosphate buffer, 50 V for 18 hr.

Sl nuclease digestions were done in both high and low salt; low salt buffer contained 30 mM sodium acetate, titrated to pH 4.5 with acetic acid, 3 mM ZnS04, 0.2 mM EDTA, and 50 mMNaCl whereas the high saltbuffer

5’ End of Chicken fl-Globin Gene 477

contained 0.3 M NaCI. The amount of Si nuclease (P-L Biochemicals) required to digest plasmids to the desired products (Form II or Ill) was determined for each plasmid DNA by titration. To generate linear Form Ill, 1 unit Sl/rg plasmid was incubated 37°C for 30 mm. The resulting DNA was deproteinized, secondarily digested with EcoRI, Pstl, or Pvul (New England Biolabs; all 1 unit/pg DNA, 37°C 30 min), analyzed on 1.5 or 2.5% agarose gels in Tris-acetate buffer, pH 7.8, and transferred to diazobenzy- loxymethylcellulose (DBM) paper (Wahl et al., 1979) (Schleicher and Schuell). To prepare probe for the entire chicken PA globin sequence, pGF3 was digested at the BamHl sites in the cloning vector (Figure I), and the 600.bp globin fragment was isolated from agarose gels and uniformly labeled with [n-32P]dCTP (New England Nuclear) by nick translation. To prepare probes specific for the 5’ and 3’ domains of the globin gene in pGF3, the plasmid was digested at its unique Pstl site (-214) and labeled at the 3’ ends with [a-32P]3’-dATP (New England Nuclear) and terminal deoxynucleotidyltransferase (P-L Biochemicals) (Maxam and Gilbert, 1980). The labeled plasmid was then restricted at the two BamHl sites in the cloning vector and the two DNA probes (-407 to -214 and -214 to +196) rn the globin region were isolated after separation on an acrylamide gel. All autoradiography used Kodak XARd film and DuPont Lighning Plus inten- sifying screens at -70°C.

To map the exact Sl cleavage site on the nucleotide sequence, it was necessary to digest under conditions favoring scission of only one strand of the DNA duplex. To accomplish thus, Si digestions were done at 0.1 or 0.5 unit/pg DNA for IO or 30 min at 37°C in low and high salt buffers, respectively, as described above. In this way nicked circular (Form II) methylated and control DNA was generated. The final products were analyzed by electrophoresis on agarose gels to ensure generation of the proper DNA form. After extensive deproteinization and ethanol precipita- trons, the DNAs were digested with 1 unit/pg DNA of either Pstl (cutting site at -214) or Ball (-167, +166), and 3’ end-labeled (Pstl site) with terminal transferase and [a-32P]3’-dATP, or 5’ end-labeled (Ball site) with T4 polynucleotide kinase (P-L Biochemicals) and [y-3*P]ATP (Maxam and Gilbert, 1980). The labeled plasmids were then secondarily restricted with BamHl (1 unit/fig DNA) and the appropriate terminally labeled fragments were isolated fromn 5% polyacrylamide gels. Pstl/BamHI yielded 2 fragments of interest spanning -407 to -214 and -214 to +196, whereas Ball/BamHI yielded a single fragment extending from -407 to -167. By isolating these individual fragments labeled at a specific site, it is possible to map the original Sl-cutting site within these fragments with an accuracy of +I base pair To do this, the individual fragments were denatured in 80% formamide and analyzed on denaturing 6% polyacrylamrde gels in 8.3 M urea, 1200 V (Maxam and Gilbert, 1980).

Acknowledgments

We wish to thank Drs. Jim McGhee, Martin Gellert, and Kiyoshr Mizuuchi for helpful discussion and comments, and Ms. Mary O’Dea for treating the plasmids with gyrase.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adverfisesement” in accordance with 18 USC. Section 1734 solely to indicate this fact,

Received June 21, 1983; revised September 12, 1983

References

Behe, M., and Felsenfeld, G. (1981). Effects of methylation on a synthetic polynucleotide: the B-Z transition in poly(dG-m’dC). poly(dG-m’dC). Proc. Natl. Acad. Sci. USA 78, 1619-1623.

Cantor, C. R. (1981). DNA choreography. Cell 25, 293-295.

Camerini-Otero, R. D., and Felsenfeld, G. (1977). Supercoiling energy and nucleosome formation: the role of the argrnine-rich histone kernel. Nucleic Acids Res. 4, 1159-l 181.

Dolan, M., Dodgson, J. B., and Engel. J. D. (1983). Analysis of the adult chicken /I-globin gene. J. Biol. Chem. 258, 3983-3990.

Elgin, S. C. R. (1981). DNase l-hypersensitive sites of chromatrn. Cell 27, 413-415.

Grnder. G. D., Wood, W. I., and Felsenfeld, G. (1979). Isolation and characterization of recombinant clones containing the chicken adult p- globin gene. J. Biol. Chem. 254, 8099-8102.

Grnder, G. D., and McGhee, J. D. (1981). DNA methylation in the chicken adult @-globin gene: a relationship with gene activity. In Organization and Expression of Globin Genes, G. Stamatoyannopoulos and A. W. Nienhuis, eds. (New York: Alan R. LISS), pp. 191-201.

Hentschel, C. C. (1982). Homocopolymer sequences in the spacer of a sea urchin histone gene repeat are sensitive to Sl nuclease. Nature 295, 714-716.

Larsen, A., and Weintraub, H. (1982). An altered DNA conformation de- tected by Sl nuclease occurs at specific regions in active chick globin chromatin. Cell 29, 609-622.

Lilley, D. M. (1980). The inverted repeat as a recognizable structural feature in supercoiled DNA molecules. Proc. Natl. Acad. Sci. USA 77, 64686472.

Maxam, A. N., and Gilbert, W. (1980). Sequencing end-labeled DNA with base-specific chemical cleavages. Meth. Enzymol. 6.5, 490-560.

McGhee, J. D., and Ginder, G. D. (1979). Specific DNA methylation sites in the vicinity of the chicken fi-globin genes. Nature 280. 418-420.

McGhee, J. D., Wood, W. I., Dolan, M., Engel, J. D., and Felsenfeld, G. (1981). A 200 base pair region at the 5’ end of the chicken adult fl-globin gene is accessible to nuclease digestion. Cell 27, 45-55.

Panayotatos, N., and Wells, R. D. (1981). Crucrform structures in supercoiled DNA. Nature 289, 466-470.

Peck, L. J., Nordheim, A., Rich, A., and Wang, J. C. (1982). Flipping of cloned d(pCpG),-d(pCpG,) DNA sequences from right- to left-handed helical structure by salt, Co(lll), or negative supercoiling. Proc. Natl. Acad. Sci. USA 79, 4560-4564.

Razin, A., and Riggs, A. D. (1980). DNA methylatron and gene function. Science 210, 604-610.

Simpson, R. T., and Kunzler, P. (1979). Chromatin core panicles formed from the inner histones and synthetic DNAs of defined sequence. Nucleic Acids Res. 6, 1387-l 415.

Singleton, C. K., Klysik, J., Stirdivant, S. M., and Wells, R. D. (1982). Left handed Z-DNA is induced by supercoiling in physiological ionic conditions. Nature 299, 312-316.

Singleton, C. K., Klysik, J., and Wells, R. D. (1983). Conformational flexibility of junctions between contiguous B- and Z-DNAs in supercoiled plasmids. Proc. Natl. Acad. Sci. USA 80, 2447-2451.

Veira, J., and Messing, J. (1982). The pUC plasmids, an MlSmp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 79, 259-268.

Wahl, G. M., Stern, M., and Stark, G. R. (1979). Efficient transfer of large DNA fragments from agarose gels to diazobenzyloxymethyl-paper and rapid hybridization by using dextran sulfate. Proc. Natl. Acad. Sci. USA 76, 3683-3687.

Weintraub, H. (1983). A dominant role for DNA secondary structure in forming hypersensrtrve structures in chromatin. Cell 32, 1191-1203.

DNA conformation at the 5′ end of the chicken adult β-globin gene

Documents

Transcript of DNA conformation at the 5′ end of the chicken adult β-globin gene