1

Supplementary Information

Materials and Methods

RNA extraction, reverse transcription, and real-time reverse transcription-PCR. Total

RNA from cells and primary tumor material was extracted using Trizol reagent (Invitrogen,

Carlsbad, CA) according to the manufacturer's instructions. The extracted RNA was

pretreated with RNase-free DNase, and 2 μg RNA was used for cDNA synthesis with random

hexamers. For PCR amplification of SPHK1, an initial amplification using SPHK1 primers

was done with a denaturation step at 95°C for 10 min, followed by 28 cycles of denaturation at

95°C for 1 min, primer annealing at 55°C for 30 s, and primer extension at 72°C for 30s.

Upon completion of the cycling steps, a final extension at 72°C for 5 min was done before the

reaction was stored at 4°C. Real-time PCR was applied for quantifying the folds of change of

SPHK1 mRNA relative to NSCLC cells and transformed NSCLC cell lines, and among 8

paired primary NSCLC (T) and adjacent non-tumor lung tissue (ANT) from the same patient.

Primers were designed with Primer Express v 2.0 (Applied Biosystems) and sequences of the

primers were: SPHK1 forward primer, 5'-CTTGCAGCTCTTCCGGAGTC-3'; SPHK1 reverse

primer, 5'-GCTCAGTGAGCA TCAGCGTG-3'; c-IAP1 forward primer, 5'-GCTCAGTAACT

GGGAACCAAA-3'; c-IAP1 reverse primer, 5'-ATCATTGCGACCCACATAATA-3'; c-IAP2

forward primer, 5'-GATGTT TCAGATCTACCAGTG-3'; c-IAP2 reverse primer, 5'-GAAAT

GTACGAACTGTACCCT-3'; Bcl-xl forward primer, 5'-TCCTTGTCTACGCTTTCCACG-3';

Bcl-xl reverse primer, 5'-GG TCGCATTGTGGCCTTT-3'; TRAF1 forward primer, 5'- GCCC

TTCCGGAACAAGGTC -3'; TRAF1 reverse primer, 5'- CGTCAATGGCGTGCTCAC -3';

A2O forward primer, 5'-CTGCCCAGGAATGCTACAGATAC-3'; A2O reverse primer, 5'-C

AGGGTCACCAAGG GTACAAA-3'. β-actin forward primer, 5'- CTCCATCCTGGCCTC

GCTGT -3'; β-actin reverse primer, 5'- GCTGTCACCTTCACCGTTCC -3'. Expression data

2

were normalized to the housekeeping geneβ-actin as a loading control.

Cell survival assay. Cells were plated in six-well plates at a density of 1×103 cells/well and

incubated for 24h, followed by doxorubicin treatment (0.1, 0.2 or 0.4 μM) or Docetaxel

treatment (1, 5 or 10 nM) and further incubation for 24 h. Numbers of surviving cells were

determined by the trypan blue exclusion method.

TUNEL assay. The DeadEndTM Fluorometric TUNEL System (Promega, Madison, WI) was

used for TUNEL assay according to the manufacturer's instruction. Briefly, cells treated with

Doxorubicin or Docetaxel, or vehicle control, were washed once with cold PBS followed by

fixation in freshly prepared 4% formaldehyde solution in PBS (pH 7.4) for 25 min at 4°C.

The fixed slides were washed with PBS for 5 min, followed by permeabilizzion with 0.2%

Triton X-100 in PBS for 5 min. After a 5-min rinse with PBS, and cells were covered with

100 µL Equilibration Buffer for 5 min, followed by a 60-min incubation with 2 x SSC at 37°C

to terminate the reaction and a 5-min PBS wash. The samples were then stained in the dark

with 1µg/ml propidium iodide (PI) solution for 15 min. After a final wash with H2O for 5

min at ambient temperature and air-dry, samples were immediately analyzed under a

fluorescence microscope using a standard fluorescein filter set to view the green fluorescence

of fluorescein at 520 nm, the red fluorescence of PI at 620nm, and the blue DAPI at 460nm.

Annexin-V binding assay. The ApopNexinTM FITC Apoptosis Detection Kit (Millipore,

Lake Placid, NY) was used to quantitatively examine apoptotic cells according to

manufacturer’s instruction. Cells were treated with Doxorubicin or Docetaxel in multi-well

plates and subjected to a 6-h incubation, followed by washes with PBS and then with the

Annexin-V binding solution. Subsequently, 150 μl of an Annexin-V antibody in Binding

Buffer was added to each culture well and incubated for 15 min, followed by addition of 1.5 μl

of PI at 1 mg/ml and a further incubation for 5 min. After washing with the Annexin-V

3

Binding Buffer, positive Annexin-V staining was visualized under a fluorescence microscope

equipped with a filter for fluorescein isothiocyanate (excitation: 490 nm, emission: 525 nm),

and PI staining was assessed with the filter for Texas red (excitation: 570 nm, emission: 610

nm).

Pharmacological Inhibitors. The inhibitors were dissolved in Me2SO (cell culture grade;

Sigma) and used in the following concentrations: LY294002 (10 μM; specific inhibitor of the

p110 catalytic subunit of PI3K), Akt inhibitor X (10 μM; specific inhibitor of Akt) or JSH-23

(30μM, NF-κB Activation Inhibitor II) or SK1-I (Sphingosine Kinase Inhibitor) (EMD, La

Jolla, CA).

Cell viability assay. Cells (1×104) were seeded in 96-well plates and cultured for 24 h,

followed by exposure to various concentrations of SK1-I for 48 h. Subsequently, 20 μl of MTT

reagent (Genview, Houston, TX) dissolved in phosphate-buffered saline (PBS) (pH 7.4) at a

concentration of 5 mg/ml was added to each well and incubated for additional 4 h. The

MTT-formazan crystals formed were dissolved in 150 μl DMSO (Sangon Biotech, Shanghai,

China), and the absorbance was measured at 570 nm with a reference wavelength of 630 nm

using a microplate reader. Cell growth inhibition was determined using the following formula

according to a previously published method: growth inhibition (%) = (1-OD of treated

cells/OD of control cells) ×100% (1). The half maximal inhibitory concentration (IC50) was

calculated by the Bliss’s software and the data were analyzed by SPSS.

Measurement of S1P Levels in Cellular Assays. S1P levels were analyzed using a S1P

competitive ELISA kit (Echelon Biosciences, Salt Lake City, UT) according to the

manufacturer’s instructions. In brief, cells were serum starved for 24h and lysed in 400μL of

Lysis Buffer. Diluted cell lysate (1:10 in delipidized human sera) were analyzed with the

Echelon S1P ELISA with anti-S1P antibody, and the absorbance was measured at 450 nm

using a microplate reader.

4

Reference

1. Xie G, Zhu X, Li Q, et al. SZ-685C, a marine anthraquinone, is a potent inducer of apoptosis with anticancer activity by suppression of the Akt/FOXO pathway. Br J Pharmacol 2010; 159:689-97.

5

Supplementary Figure legends

Supplementary Figure 1. The expression of SPHK1 is elevated in NSCLC. (A)

Expression of SPHK1 mRNA in two normal human lung epithelial cells (NLECs) and cultured

NSCLC cell lines (A549, HLAMP, PAa, H-1299 and 95D). Expression levels were

normalized forβ-actin. Error bars represent standard deviations (SD) calculated from three

parallel experiments. (B) Real time-PCR analysis of SPHK1 expression in 8 primary NSCLC

(T) and lung adjacent non-cancerous tissues (ANT) paired from the same patient. β-actin was

used as a loading control. (C) Quantification of SPHK1 protein in each of the primary

NSCLC (T) and lung adjacent non-cancerous tissues (ANT) paired from the same patient by

Western blotting.

Supplementary Figure 2. Dysregulation of SPHK1 altered the apoptotic sensitivity of

NSCLC cells. (A) Left panel, A549-Vector, A549-SPHK1, A549-shRNA-Vector and

A549-SPHK1-shRNA cells (2x106) were injected s.c. in nude mice. When the mean tumor

volume reached 50 mm3, mice were injected i.p. with Docetaxel (10mg/kg) every 2 days for 21

days. Right panel, mean tumor weights. (B) Left panel, A549-vector cells (2x106) were

injected in the right oxter of 15 nude mice. When the mean tumor volume reached 50mm3,

mice were randomized into three groups (n= 5) and injected i.p. with vehicle (DMSO),

Docetaxel (10mg/kg) or SK1-I (50mg/kg) every 2 days for 17 days. Right panel, mean tumor

weights. (C) The cytotoxicity of SK1-I was examined in A549 and 95D NSCLC cells. MTT

assay indicated that the IC50 of SK1-I in A549 cells is 35.19 μM and in 95D cells, is 28.52

μM.

Supplementary Figure 3. (A) Vector- or SPHK1- or SPHK1RNAi-transduced A549 and

95D cells treated by Docetaxel (1nM, 5nM,10nM) or doxorubicin (0.1μM, 0.2μM, 0.4μM) for

6

24 h were counted for viable cells using trypan blue exclusion assay. Results are expressed as

percentages of total cells. (B) Quantification of TUNEL staining of vector- or

SPHK1-transduced A549 and 95D cells after doxorubicin treatment (0.2μM) for 24 hr.

Numbers of cells were counted from 10 random fields. **, P < 0.01. (C) Quantification of

Annexin V+/PI- positive vector- or SPHK1RNAi-transduced A549 and 95D cells after

doxorubicin treatment (0.2μM) for 6 hr. Numbers of cells were counted from 10 random

fields. **, P < 0.01. (D) Western analysis of proteolytic cleavage of pro-caspase-3 and PARP

in vector- or SPHK1- or SPHK1RNAi-transduced A549 and 95D cells after doxorubicin

treatment (0.2μM) for 24 hr. α-tubulin was used as a loading control. Data was obtained from

three independent experiments with similar results.

Supplementary Figure 4. Real-time PCR analysis of the expression of NF-κB-targets,

including Bcl-xL, c-IAP1, c-IAP2, TRAF1 and A2O in vector- or SPHK1- or SPHK1

RNAi-transduced A549 and 95D cells. Expression ofβ-actin was used as a control of gene

expression.

Supplementary Figure 5. The cellular S1P level was examined in SPHK transduced cells

and SPHK1 knockdown cells. Data was obtained from three independent experiments with

similar results. *, P < 0.05.

7

Supplementary Table

Supplementary Table S1. Clinicopathologic characteristics of patient samples and expression

of SPHK1 in NSCLC

No. (%)

Gender

Male 164 (75.2)

Female 54 (24.8)

Clinical Stage

I 71 (32.6)

II 47 (21.6)

III 78 (35.8)

IV 22 (10.1)

T classification

I 24 (11.0)

II 125 (57.3)

III 51 (23.4)

IV 18 (8.3)

N classification

0 105 (48.2)

1 41 (18.8)

2 68 (31.2)

3 4 (1.8)

Distant metastasis

No 196 (89.9)

Yes 22 (10.1)

Vital status (at follow-up)

Alive 114 (52.8)

Death due to lung cancer cause 104 (47.2)

Expression of SPHK1

Negative 19 (8.7)

Positive 199 (91.3)

Low expression 98 (45.0)

High expression 120 (55.0)

8

Supplementary Table S2. Correlation between the clinical pathologic features and

expressions of SPHK1

Characteristics SPHK1

P-value

Low or None High

Gender Male 73 91

0.819

Female 25 29

Pathology

Squamous cell carcinoma 37 45

0.286

Adenocarcinoma 38 53

Adenosquamous carcinoma 20 22

Other NSCLC 3 0

Clinical Stage

I 40 31

0.019 II 19 28

III 33 45

IV 6 16

T classification

I 11 13

0.022 II 66 59

III 17 34

IV 4 14

N classification

N0 58 47

0.010 N1 18 23

N2 21 47

N3 1 3

Distant metastasis No 93 103

0.027

Yes 5 17

9

Supplementary Table S3. Univariate and multivariate analysis of different prognostic

parameters in patients with lung cancer by Cox-regression analysis

Univariate analysis Multivariate analysis

No.

patients P SE HR

95%

confidence

interval

P SE HR

95%

confidence

interval

T classification

I 24

II 125 0.048 0.468 2.526 1.010-6.319 0.004 0.477 3.950 1.549-10.068

III 51 0.001 0.483 4.904 1.904-12.633 0.000 0.487 5.745 2.214-14.909

IV 18 0.003 0.533 4.895 1.721-13.918 0.05 0.537 4.533 1.583-12.984

N classification

N0 105

N1 41 0.328 0.276 1.310 0.762-2.251 0.478 0.277 1.218 0.707-2.097

N2 68 0.000 0.225 2.802 1.803-4.355 0.000 0.231 2.656 1.688-4.181

N3 4 0.201 0.731 2.546 0.608-10.662 0.499 0.748 1.658 0.382-7.186

Distant

metastasis

No 196

Yes 22 0.236 0.321 1.463 0.7779-2.745 0.611 0.332 0.845 0.441-1.618

SPHK1

Low 98

High 120 0.000 0.221 3.533 2.290-5.451 0.000 0.241 3.570 2.226-5.728

10

Supplementary Table S4 Categorical variable Codings

Categorical Variable Codingsb,c,d,e

Frequency (1) (2) (3)

Ta

1 24 0 0 0

2 125 1 0 0

3 51 0 1 0

4 18 0 0 1

Na

0 105 0 0 0

1 41 1 0 0

2 68 0 1 0

3 4 0 0 1

Ma 0 196 0

1 22 1

SPHK1a 1 98 0

2 120 1

a. Indicator Parameter Coding; b. Category variable: t; c. Category variable: n; d. Category variable: m;

e. Category variable: SPHK1