1  

   

 PATH40220: BSc. Biomedical Science Research Project

Cellular Sources and Glycosylated Variants of Leucine rich-α2 Glycoprotein

in Heart Failure

Denis O’ Dwyer

Stage 4 Biomedical Health and Life Science University College Dublin

Principle Investigator: Dr. John Baugh Senior Lecturer

School of Medicine & Medical Science Conway Institute

University College Dublin            

  2  

   A SIGNED COPY OF THIS FORM MUST ACCOMPANY ALL SUBMISSIONS FOR ASSESSMENT. STUDENTS SHOULD KEEP A COPY OF ALL WORK SUBMITTED.

Procedures for Submission and Late Submission

Ensure that you have checked the School’s procedures for the submission of assessments.

Note: There are penalties for the late submission of assessments. For further information please see the University’s Policy on Late Submission of Coursework, (http://www.ucd.ie/registry/academicsecretariat/pol.htm) Plagiarism: the unacknowledged inclusion of another person’s writings or ideas or works, in any formally presented work (including essays, examinations, projects, laboratory reports or presentations). The penalties associated with plagiarism designed to impose sanctions that reflect the seriousness of University’s commitment to academic integrity. Ensure that you have read the University’s Briefing for Students on Academic Integrity and Plagiarism and the UCD Plagiarism Statement, Plagiarism Policy and Procedures (http://www.ucd.ie/registry/academicsecretariat/pol.htm)      

 

Student  Name  

Student  Number  

Assessment  Title  

Module  Title   Module  Co-­‐ordinator  

Supervisor  

Date  Submitted   OFFICE  USE  ONLY  Date  Received  

OFFICE  USE  ONLY  

Grade/Mark  

Assessment Submission Form  

                                             Denis  O’  Dwyer    

                         11304411    

                                                                                                                                                 BSc.  Biomedical  Science  Research  Project    

                                                                                                                                                 PATH40220:  Research  Project  BSc.  BHLS    

                                                                     Prof.  William  Watson    

                                           Dr.  John  Baugh    

                             26/2/2015      

 

   

   

Declaration of Authorship I declare that all material in this assessment is my own work except where there is clear acknowledgement and appropriate reference to the work of others. Signed………………………………………………Date……………………………

  3  

 Summary  

   Heart failure (HF) is characterized by abnormalities in cardiac structure and function

resulting in a reduced oxygen supply to the body. Diastolic HF or HF with preserved

Ejection Fraction (HFpEF) is the primary concern of this thesis. HFpEF is identified

by excessive myocardial fibrosis of the interstitium leading to reduce filling volumes.

Leucine rich α2-Glycoprotein (LRG), recently shown by our lab to be upregulated in

patients with HF, suggests that it plays a role in the disease process. However, there is

scant data about LRG and its physiological role to date, which means further study is

needed on this potential novel biomarker.

The aim of this research was to identify cellular sources of LRG in disease relevant

cells and also to examine their secretion patterns. This was completed by testing both

inflammatory and structural cells present during HF for LRG.

Preliminary tests using qPCR showed low LRG mRNA expression in THP1 and

VHCF cells. But interestingly after western blot, protein expression was identified in

each cell type. Banding at different molecular weights suggests the idea of LRGs

post-translational modification (PTM). Untreated VHCF cells showed high levels of

LRG in their medium. Serum-starvation was seen to inhibit extracellular LRG levels

in THP1 cells. Differentiation of the THP1 cells into macrophage by PMA at varying

concentrations showed no change to LRG protein levels. Finally the deglycosylating

enzyme PNGase F successfully reduced the glycosylated variants of LRG in THP1

and HepG2 supernatant and lysates.

In conclusion, the data suggests that LRG is constitutively expressed and secreted in

tissue relevant cells concerning HF. The presence of serum seems necessary for the

extracellular secretion of LRG in fibroblasts and THP1 cells and finally LRG is

heavily glycosylated and consists of many different glycovariants.

  4  

Table of Contents

Introduction .................................................................................................................. 5 1.1 Heart Failure ........................................................................................................ 6 1.2 Pathophysiology of HF ........................................................................................ 7 1.3 Leucine rich α2-Glycoprotein ............................................................................... 9 1.4 LRG as a Possible Therapeutic .......................................................................... 10 1.5 Purpose of this study .......................................................................................... 13

Methods and Materials .............................................................................................. 14 2.1 Materials ............................................................................................................ 15 2.2 Cell culture ......................................................................................................... 15 2.3 PBMC isolation .................................................................................................. 16 2.4 Treatment of cells .............................................................................................. 16 2.5 Quantitative Polymerase Chain Reaction Method ............................................. 18 2.6 Western Blotting Methods ................................................................................. 19 2.7 Ethical Consideration ......................................................................................... 22

Results ......................................................................................................................... 23 3.1 Basal LRG expression and production in structural and inflammatory components .............................................................................................................. 24

3.1.1 LRG mRNA expression in THP1 and VHCF cells .................................... 24 3.1.2 LRG protein production in THP1, VHCF and PBMC cells ....................... 25

3.2 LRG expression in treated cardiac fibroblasts ................................................... 26 3.2.1 LRG mRNA expression in VHCFs after TGF-β treatment and serum starvation .............................................................................................................. 26 3.2.2 LRG protein expression and secretion patterns in cardiac fibroblast ......... 27

3.3 Expression and secretion patterns of LRG in human monocytes ...................... 28 3.3.1 Effects of serum on LRG protein expression in THP1 cells ....................... 28 3.3.2 LRG protein expression in macrophage like cells ...................................... 29

3.4 Confirmation of LRG within each supernatant and lysate tested. ..................... 31 3.4.1 Effect of the deglycosylating agent PNGase F on the LRG glycoprotein .. 31 3.4.2 Testing for evidence of non-specific binding to serum in media ................ 32

Discussion ................................................................................................................... 33 4.1 General Discussion ............................................................................................ 34 4.2 LRG expression and secretion patterns in cardiac fibroblasts ........................... 35 4.3 LRG expression and secretion patterns in monocytes/macrophages ................. 37 4.4 Glycosylated variants of LRG ........................................................................... 39 4.5 Future direction .................................................................................................. 40 4.6 Conclusion ......................................................................................................... 41

Acknowledgements .................................................................................................... 42

Bibliography ............................................................................................................... 43 Appendix ..................................................................................................................... 47

  5  

Chapter  1    

Introduction

                         

  6  

1.1 Heart Failure

Heart failure is a progressive disease characterized by major remodeling of cardiac

tissue with a reduced cardiac output (McMurray et al., 2012). Inadequate tissue

perfusion results in organ failure. 1-2% of the adult population suffers from HF but

the extent of the complication is most prominent in people over the age of 65 years

(McMurray and Pfeffer, 2005). With an aging population, the number of persons with

HF will continue to rise exponentially (fig. 1) (Owan and Redfield, 2005). Figueroa

and Peters (2006) acknowledge the fact that multiple studies have shown HF to be

associated with a 2-year mortality rate of between 45-50%. The European Society of

Cardiology (2013) suggests typical symptoms of HF, which include fatigue,

breathlessness and ankle swelling. At present, the gold standard for assessing and

diagnosing HF is two-dimensional transthoracic Doppler echocardiography (Oh et al.,

2006).

Figure 1. The increasing trend of HF in individuals over 65 years

(Owan and Redfield, 2005)

  7  

 

1.2 Pathophysiology of HF  The primary complication underlying HF is left ventricular dysfunction (Haydock and

Cowie, 2010). HF can be categorized into two different forms: Systolic HF and

Diastolic HF. Systolic dysfunction is characterised by a reduction in myocardial

contractility leading to a reduction in left ventricular ejection fraction (Chatterjee and

Massie, 2007). Diastolic Dysfunction is characterised by insufficient filling of the left

ventricle, which occurs due to the stiffness within the chambers walls (Baicu et al.,

2005). Increase in myocardial stiffness is primarily due hypertrophy and a fibrotic

response within the thickening myocardium (Rudolph et al., 2009). Diastolic HF or

HF with preserved ejection fraction (HFpEF) and its pathophysiology is the main

interest of this thesis.

Table 1. Different characteristics between HFpEF and HFrEF, showing the

imminent need for new therapies to treat DHF (Abbate et al., 2015). Randomised

controlled trials (RCT)

  8  

The majority of patients presenting with HFpEF are longstanding sufferers of

hypertension (Mandinov et al., 2000). Due to this prolonged insult, the body attempts

to repair the damaged cardiac tissue by aberrantly depositing excess extracellular

matrix proteins in a process known as tissue fibrosis (Krenning et al., 2010). Intrinsic

cardiac fibroblasts are activated by specific cytokines (eg. TGF-β), which causes their

differentiation into myofibroblasts and leads to an increased expression of collagen

type 1 (Fan et al., 2012). Monocytes are also intrinsically involved, infiltrating the

injured site (Glezeva and Baugh, 2014). Through their recruitment by a chemokine

gradient they initially differentiate into pro-inflammatory M1 macrophage, which

contribute to cardiac remodeling by increasing cardiac apoptotic events (Fernandez-

Velasco et al., 2014). Through specific cytokines (IL4, IL10), the cells differentiate to

M2 pro-fibrotic macrophage (Cho et al., 2014). These cells contribute to the

resolution and fibrosis seen in patients with HF (Fernandez-Velasco et al., 2014).

Possibly targeting the initial infiltration of monocytes or inhibiting the switch to a

pro-fibrotic phenotype may alleviate constrictive symptoms within the heart.

 

Pressure/Volume+overload+

Chemokine+induc5on+

M2+Macrophage+Monocyte+

M1+Macrophage+

LPS,+TNFCα+

IL10,+TGFCβ+

ECM Expression Collagen Deposition

Figure 2. Inflammatory and structural components contributing to the fibrotic

phenotype during HF.

!

  9  

1.3 Leucine rich α2-Glycoprotein

Leucine rich α2-Glycoprotein (LRG) is a highly conserved 132 amino acid protein,

consisting of 8 consensus repeats of leucine, proline or asparagine (Shirai et al.,

2009). Initially isolated as a trace element from human serum (Haupt and Baudner,

1977), it is approximately 45kDa in size and is heavily glycosylated, showing various

glycovarients after 2D-DIGE (Watson et al., 2011). It is thought to play an important

role in protein-protein interactions but its ultimate function is to date still unknown.

In 2011, Watson et al. published new experimental data from a study they completed

on HF patients. They found increased expression of LRG in the coronary sinus (CS)

serum of asymptomatic hypertensive patients. The group further analyzed this

understudied protein by testing its validity against the already recognized biomarker

of HF, B-type natriuretic peptide (BNP). LRG was shown to significantly correlate

with BNP in patients with left ventricular diastolic dysfunction and HF (Fig. 3A). The

levels of LRG were also significantly increased through various stages of the disease

independent of age, sex and renal function (Fig. 3B). Its potential as a novel

biomarker for HF was suggested.

A B

Figure 3A. Correlation of LRG levels with BNP, a recognized biomarker for HF

(Watson et al., 2011). Figure 3B. Increasing levels of LRG with disease progression

(Watson et al., 2011).

!

  10  

LRG has been shown previously to be involved in chronic inflammatory processes.

Patients suffering from acute appendicitis (Kentsis et al., 2012) and rheumatoid

arthritis (Ha et al., 2014) have shown an upregulation in serum levels of the

glycoprotein and LRG been suggested as a potential biomarker in each case. Shirai et

al., (2009) further demonstrated LRGs induction at a transcriptional level acting as an

acute phase protein when treating HepG2 cells with the pro-inflammatory cytokines

IL6 and TNFα. The same cytokines were also seen to correlate with LRG levels in CS

serum of asymptomatic, hypertensive patients (Watson et al., 2011). Little is known

about the exact function of LRG but these findings propose the idea it is extensively

involved in disease pathways and may be expressed as a protective response by the

body.

1.4 LRG as a Possible Therapeutic  An anti-fibrotic role of LRG has been suggested. A member of the Baugh group was

able to show by qPCR, a reduction of ASMA and collagen at a transcriptional level in

cardiac fibroblasts after treatment with LRG-rich media (Tea et al., Unpublished). An

induction of LRG through IL6 and TNF-α in fibroblasts was also seen to inhibit their

differentiation to myofibroblasts by TGF-β (Tea et al., Unpublished). With

statistically significant figures showing negligible mRNA collagen expression in LRG

induced media (fig. 4A), it suggests that the protein may act as a possible anti-fibrotic

agent. After immunohistochemistry (fig. 4B), the expression of LRG was seen within

atrial biopsies of dysfunctional hearts (Watson et al., 2011). Its presence suggests that

it is playing a functional role in the heart.

 

  11  

A paper published in Nature by Wang et al. (2013) suggested that LRG plays a role in

the promotion of new blood vessels through TGF-β signaling. LRG was initially

found to be constantly overexpressed in the microvasculature of retinal disease mouse

models (Wang et al., 2013). After proteomic analysis, human vitreous samples were

seen to have increased levels of both LRG and TGF-β (Wang et al., 2013) suggesting

that both molecules have coordinated expression. Previous work has seen active TGF-

β molecule form a tetrameric structure with the type I and type II TGF-β receptors in

endothelial cells (Lim and Zhu, 2006) causing the activation by phosphorylation of

either the ALK1 or ALK5 receptor subunits (Goumans et al., 2003). From the

incubation of LRG in specific conditioned media containing TGF-β, it was found that

the LRG only associates with ALK1 in the presence of the auxiliary protein endoglin.

This relays a signal through the TβRII onto the pro-angiogenic Smad 1/5/8 pathway.

With that said, in the absence of LRG and endoglin, a possible switch occurs with the

ALK5 unit activating the pro-fibrotic Smad 2/3 pathway which potentially drives

Ctrl.

TGF-β

LRG

LRG +

TGF-β

Figure 4A. A significant reduction in Collagen 1 mRNA levels in VHCF after LRG

induction with IL6 and TNF despite treatment with TGF-β (Tea et al., Unpublished).

Figure 4B. Right atrial biopsy from HF patient. Staining in brown shows presence

of LRG within the myocardial tissue (Watson et al., 2011).

A B

  12  

cardiac fibrosis. The active competition of endoglin and ALK5 for LRG suggests a

dynamic switch in deciding what will be the resulting phenotype in HFpEF. Reduced

endoglin expression has recently been shown to prevent cardiac fibrosis (Kapur et al.,

2012). This furthers the evidence of the imminent need for LRG to be present

allowing for vital vascular growth in disease settings.

A B

!Figure 5A. Signaling profile within a fibroblast through TGF-β, allowing for

expression of ECM proteins. Figure 5B. In the presence of LRG, endothelial cells

favour a pro-angiogenic state (Wang et al., 2013) !

  13  

1.5 Purpose of this study    Given  the  potential  role  of LRG in mediating the pro-fibrotic effects of TGF-β it is

likely that LRG may modulate HF disease pathogenesis. To date most work has

studied LRG as a liver-derived serum protein but there is immunohistochemistry

evidence that LRG is expressed within the heart (fig. 4B) (Watson et al., 2011).

The overall hypothesis of this project is that disease-relevant cells within the heart

express LRG.

In order to test this hypothesis the following aims were conducted:  

i) Measure LRG expression in human monocytes/macrophages, primary

human and mouse fibroblasts

ii) Assess secretion patterns of LRG in cells supernatant.

  14  

Chapter  2    

Methods and Materials

                           

  15  

2.1 Materials All reagents used and their respective product codes are outlined in Appendix 1.

2.2 Cell culture Cell lines used:

1. Ventricular Human Cardiac Fibroblasts (VHCF)

2. Murine Primary Cardiac Fibroblasts

3. Human Liver Hepatocellular Carcinoma (HepG2) cells

4. Human Monocytic (THP1) cells

Culturing of cells was carried out to the manufacturer’s specifications. Cultures were

grown in a 37°C humidified incubator containing 5% CO2 and 21% oxygen. Cells

were cultured in conditioned DMEM media containing 10% FCS, 1% L-Glutamine

and 1% Penicillin/Streptomycin. THP1s were cultured in RPMI also containing the

same concentrations of FCS, L-Glutamine and Penicillin/Streptomycin. In a number

of experiments, Serum-starved media was used (media without addition of 10% FCS).

At 65-70% confluency of HepG2 and VHCFs, media was removed from flasks and

washed with PBS. Trypsin-EDTA was then added to the flask and incubated at 37°C.

After cell detachment, the medium was neutralized and centrifuged for 5 minutes at

300Xg. Supernatant were discarded and pellets resuspended in fresh media. A cell

count was completed using a haemocytometer. Cells were then further passaged or

seeded onto a 6 well plate at 250,000 cells/cm3. All culturing took place under

laminar flow.

  16  

2.3 PBMC isolation   A human blood sample was obtained and peripheral Blood-mononuclear cells

(PBMC) were carefully isolated by density centrifugation as described from the

MACS isolation kit (Miltenyi Biotec, Germany) as shown in Fig. 6.

2.4 Treatment of cells  Serum-starved and TGF- β treated fibroblasts

VHCFs and murine cardiac fibroblasts were seeded and once confluent, cell were

either serum-starved or treated with a 10ng/µl TGF-β solution. These conditions were

present for 72hrs.

Figure 6: Density gradient of blood components after centrifugation

!!!

Figure 7: Seeding and treatment of VHCF cells !!!

  17  

THP1 cells response to changeable serum levels THP1 cells were seeded onto a 6 well plate with ~0.4 million cells in each well. Cells

in each well were treated with varying degrees of serum in RPMI medium and left for

72hrs (Table 2).

Effect of PMA on THP1 expression of LRG THP1 cells were seeded onto a 6 well plate with ~0.5 million cells in each well and

maintained in 10% RPMI. Each well was treated with different concentrations of

PMA and exposed for 24hrs (Table 3).

 

Table 2: Varying degrees of serum concentration in each well

Table 3: Concentration of PMA treatment on THP1 cells

  18  

Table 4: Final Mastermix (per sample) !

2.5 Quantitative Polymerase Chain Reaction (qPCR) Method The Promega ReliaPrep RNA Cell Kit was used and its protocol was followed for

RNA extraction and purification. BLTG buffer was applied to each well and the

lysate was collected. Isopropanol was added to each sample. These samples were

placed in spin column tubes and treated with RNA Cell kit solutions (RNA wash

solution, a DNase solution and a column wash solution). The RNA lysate was placed

in an eppendorf with 30µl of RNase free H2O and stored at -80°C.

RNA in each sample was quantified using a Nanodrop ND-2000 (Thermo Scientific),

The conversion of RNA to cDNA was carried out following the Invitrogen guidelines.

Briefly, Mastermix solutions and a superscript mix (appendix) were added to the

RNA samples. After a 1:10 dilution with dH2O, the cDNA was stored at -20°C.

To complete the qPCR preparation process, a final mastermix was made. The

following reagents were included:

Final Mastermix solution (Table 4) containing primers for Lrg1 (See appendix) was

added to the cDNA samples. Replicates (n=2) of each sample were carried out. B2M

was used as the housekeeper gene.

  19  

Table 5: Thermal profile of qPCR !

Table 6: Creation of Polyacrylamide gel for western blot !

The thermal profile (Table 5), the following thermal profile was used to allow for

appropriate amplification and Ct values were obtained from MX 3000p (Stratagene)

After completion, figures were given for each samples cycle threshold derived from

amplification plots. This allowed for fold changes to be formulated.

2.6 Western Blotting Methods Extraction of the protein contents carried out using a 100µl 1X RIPA buffer (see

appendix). Cell lysates were obtained and placed in 0.5ml eppendorfs. The samples

were stored in the -80°C freezer.

Protein samples were quantified using the bicinchoninic acid (BCA) assay kit.

Standards were prepared and diluted accordingly by RIPA PI. Absorbance values

were recorded at 562nm and the Softmax-pro software was used to find the unknown

protein concentrations. The manufacturers protocol was closely followed throughout.

10% polyacrylamide gel was made up using reagents mentioned in Table 6.

  20  

A loading dye was made from 2X laemmli buffer and BME in a 1:20 dilution and was

added in a 1:1 ratio to eluents of the quantified protein. Samples in their respective

eppendorfs were then exposed to 95oC on a heating block for 5 minutes to allow for

protein denaturation. SeeBlue Protein ladder is a pre-stained standard that was loaded

(10µl) into the first lane of each gel.

The gel was run for 15 minutes at 80mV to allow all the samples to be in a linear

arrangement at the bottom of the stacking layer. Voltage was increased to 120mV and

the samples were seen to take 45/60 minutes to run through the separating layer. A 1X

Running Buffer facilitated the running of the gel in a BioRad Minicell apparatus.

Proteins were transfered onto a Polyvinylidene Fluoride (PVDF) membrane, first

activated in 100% methanol for 30 seconds. A transfer sandwich was prepared (Fig.

8) and then placed in the electroblotting apparatus filled with 1X transfer buffer

containing 10% methanol, kept on ice. This was run at 110mV for 90 minutes.

Figure 8: Membrane sandwich at transfer phase to allow correct transfer

of proteins to PVDF membrane

  21  

Immediately after the transfer, the PVDF was blocked in 5ml of blocking buffer to

prevent non-specific binding. It was rotated for 60 minutes in a 50ml falcon. Exposure

to the primary antibody was then completed overnight in the 4°C cold room on a

rotator. The PVDF was washed with a TBS-Tween substrate 3X10 minutes after each

exposure to an antibody. The secondary antibody exposure was carried out for 60-90

minutes on the rotator and was followed by another wash step.

The membrane was finally rotated for 5 minutes in HRP substrate. In the dark room,

Fuji Medical X-ray film was placed over the PVDF and was developed to show

specific patterns of banding from the protein of interest.

Preparation for use of PNGase F deglycosylating agent

The PNGase F protocol was used to deglycosylate the protein lysates. Briefly, 1µl of

10X Glycoprotein Denaturing Buffer was added to the protein samples followed by

denatured on a 95oC heating block for 5 minutes. Samples were then centrifuged and

2µl of 10X G7 Reaction Buffer and 2µl of 10% NP-40 were added to the eppendorfs.

1µl of PNGase F was added to each eppendorf, followed by incubation at 37oC for

one hour. Deglycosylated samples were then loaded onto the gel.

Table 7: Functional dilution factors of antibodies !

  22  

Reprobing the membrane

10ml of a hot stripping buffer containing βME (see appendix) was placed into a

falcon tube with the membrane facing inwards. After 30 minutes incubation at 37°C,

the membrane was again washed in a 3X10 minute TBS-Tween wash. The membrane

was rotated in a GapDH primary antibody followed by a wash step. Goat anti-Mouse

is used as the secondary antibody. GapDH expression was developed on Fuji Medical

film following exposure to HRP substrate.

2.7 Ethical Consideration  The blood sample during the isolation of PBMC’s was acquired from an alternative

study, which had been previously approved by the HREC (Human Research Ethics

Committee) within UCD.

 

  23  

       

     

Chapter  3    

Results

                       

  24  

3.1 Basal LRG expression and production in structural and inflammatory

components

Initial  experimentation  was  to  identify  whether  disease-­‐relevant  cells  within  the  

heart  express  LRG.  qPCR  was  the  first  experimental  procedure  used  to  test  for  

cells  mRNA  expression.  This  was  followed  by  western  blot.  Data  on  the  cells  

protein  expression  was  thought  to  be  more  reliable  and  qualitative,  and  is  the  

reason  why  westerns  were  the  major  form  of  experimentation.  

 

3.1.1 LRG mRNA expression in THP1 and VHCF cells (n=1)

To investigate if LRG was present at a transcriptional level, a qPCR was carried out.

HepG2 cells were used as a positive control as LRG mRNA expression has previously

been shown to be abundantly expressed within them (Shirai et al., 2009). VHCFs

made up the structural component due to their known fibrotic action and a monocytic

cell type (THP1) was tested to form the inflammatory component.

Ct values are an expression of how many cycles had to be carried out before a

threshold fluorescent signal was detected. Ct values are inversely proportional to the

quantity of target transcript in the sample. A low Ct means that there is a relatively

high expression of the RNA within the cell. B2M was used as the housekeeper gene.

The fold change was the difference between the housekeeper and the sample of

interest. This shows the variation in expression between the 2 genes. The sub control

values normalises the figures with the actual control and allows for the fold change to

be extrapolated as seen under the heading fold change.

  25  

Table 8: Basal LRG mRNA expression in VHCF, HepG2s & THP1 cells with Cts, ΔCts

and fold change. B2M used as a housekeeper gene."!!

HepG2 (CTRL) VHCF THP10.00

0.25

0.50

0.75

1.00

LRG Gene mRNA Expression

Rel

ativ

e m

RN

A F

old

Cha

nge

Figure 9: Basal LRG mRNA fold change between HepG2, VHCF and THP1 cells. !

As expected, high expression of LRG was identified in HepG2 cells. Expression was

detectable in THP1 and VHCF cells but much lower than the control sample (fig. 9).

3.1.2 LRG protein production in THP1, VHCF and PBMC cells (n=2).  The cell lysates of PBMC, THP1 and VHCF samples were loaded onto a

polyacrylamide gel. HepG2 was also loaded acting as a positive control with its

protein expression of LRG seen previously in the lab (Tea et al., Unpublished). A

serum-starved HepG2 supernatant sample was also loaded. Historically, the lab had

shown an induction of LRG production and secretion after culturing HepG2s in 0%

DMEM medium.

  26  

LRG was seen to be present in the cell types. The HepG2 control showed 3 variable

bands with a strong signal at ~45kDa (fig. 10). The HepG2 supernatant gave an

extremely strong signal with a concentrated region at ~55kDa. Banding was also seen

at the same weight for PBMC, VHCF and THP1 lysate with the THP1 sample also

having a concentrated LRG expression at ~45kDa.

3.2 LRG expression in treated cardiac fibroblasts  

3.2.1 LRG mRNA expression in VHCFs after TGF-β treatment and starvation

(n=1)

qPCR was again the method of preliminary testing for LRG expression in fibroblasts.

Low fold changes were recorded in each VHCF sample when compared against the

positive control. A slight increase in mRNA expression was seen in the serum-starved

sample, but due to the relatively low levels, nothing could be concluded.

Figure 10: Basal LRG protein expression in HepG2 (supernatant and Lysate),

PBMC, VHCF and THP1 cells. GapDH used as the loading control.

  27  

Table 9: VHCF mRNA expression after treatment with TGF-β and serum

starvation showing Cts, ΔCts and Fold change. B2M used as a housekeeper gene."!!

               

3.2.2 LRG protein expression and secretion patterns in cardiac fibroblast (n=2)

After VHCFs were treated with TGF-β and/or serum-starved accordingly over a 72-

hour period, their supernatants and lysates were loaded for blotting. HepG2 lysate was

the positive control. Extensive levels of LRG were seen to be present in the non-

treated and TGF-β treated supernatants (fig. 11). Serum-starvation caused cells to

have a noticeably less LRG protein expression in their supernatant. Although levels of

LRG were seen in the lysates of the serum-starved samples. The identification of

variable banding patterns was seen again between supernatants and lysates with

values above and below 50kDa.

Figure 11: Effect of TGF-β and serum starvation (SS) on LRG protein expression and

secretion in VHCF. Cells treated accordingly. Supernatants (sup) and lysates (lys) loaded.

GapDH used as the loading control. Blot is representative of an n=2.

  28  

A sample of murine cardiac fibroblasts was also run on a gel. Clear levels of LRG

protein expression were seen above and below the 50kDa molecular weight mark (fig.

12). Heavy bands for LRG were observed in the lysates of the non-treated and TGF-β

treated cells. In the absence of serum, banding of the lysates reduced to a size of

~50kDa.

3.3 Expression and secretion patterns of LRG in human monocytes

3.3.1 Effects of serum on LRG protein expression in THP1 cells (n=3)

To examine if monocytes produce and secrete LRG, THP1 cells were treated with

varying concentrations of FCS for 48 hours prior to analysis with western blot (Fig

13). HepG2 supernatant and lysate, again used as the positive control, showed the

variable migration pattern of the suspected LRG protein. LRG was absent from the

GapDH control

37kDa

Figure 12: Effect of TGF-β and serum starvation (SS) on LRG protein expression

in murine primary cardiac fibroblast lysates. GapDH used as loading control. Blot

is representative of an n=2.

!

  29  

supernatant of the THP1 cells treated with a FCS concentration below 5%. The

antibody gave an extremely strong signal for LRG within each lysate at ~45kDa. The

blotchy appearance of the bands is an unclear indication of protein size or type.  

 

3.3.2 LRG protein expression in macrophage like cells (n=2)  After differentiation of THP1 cells to a macrophage like phenotype using the phorbol

ester PMA (fig. 14), LRG protein levels in the lysastes were reduced. Variable

banding patterns can again be seen between supernatants and lysates showing

expression of LRG (fig. 15). . Blotchy patterns were observed for each supernatant

loaded, regardless of what PMA concentration was used. It was suspected that non-

specific binding was occurring or multiple different glycovariants of LRG exist.

Figure 13: Effect of a FCS concentration response on THP1 cells LRG protein

expression and secretion. Cells exposed to varying degrees of serum. Both

supernatants (sup) and lysates (lys) loaded. GapDH used as a loading

control. Blot is representative of an n=3. !

  30  

 

Figure 15: Effect of a PMA dose response on THP1 cells showing LRG protein

expression and secretion patterns. Both supernatants (sup) and lysates (lys)

loaded. GapDH used as loading control. Blot is representative of an n=2. !

Figure 14A: THP1 cells in culture before treatment with PMA. They present with

a clear circular morphology in clusters. Figure 14B: THP1 cells differentiation

into a macrophage like phenotype. The cells adhere to the flask and are spindly in

appearance. !

A B

  31  

3.4 Confirmation of LRG within each supernatant and lysate tested.

3.4.1 Effect of the deglycosylating agent PNGase F on the LRG glycoprotein

(n=2)

PNGase F, an enzyme that cleaves N-linked glycans, was utilised to determine

whether the varied MW banding patterns in the different samples was due to

glycovariation of LRG or non-specific antibody binding. Treatment of supernatants

and lysates of THP1 and HepG2 cells reduced the detected LRG band size suggesting

that the varied molecular weight was at least in part due to glycosylation (Fig 16). The

LRG bands in enzyme treated lysates were brought down to a banding level MW of

~35kDa and the supernatant bands were decreased to a MW of ~38kDa. The enzyme

treated THP1 supernatant did not completely deglycosylate but a small amount of a

lower MW species of LRG appeared at ~38kDa. Nevertheless the experiment

confirmed the presence of LRG in each cell type tested and that the protein consists of

multiple glycovariants.

Figure 16: Application of the deglycosylating agent PNGase F on HepG2 and THP1

supernatant (sup) and lysates (lys) to identify LRG. GapDH used as a loading

control. Blot is representative of an n=2. !

  32  

3.4.2 Testing for evidence of non-specific binding to serum in media (n=1)  After observing bands previously in media with serum present, there was a suggestion

that the antibody being used was binding non-specifically to a component in FCS. A

sample of neat FCS along with the DMEM and RPMI media were ran on a blot to test

this. A PNGase F treated and non-treated human serum sample was loaded to confirm

the binding capabilities of the Abcam antibody to LRG. The absence of bands seen in

the FCS positive media implied non-specific binding was not occurring (fig. 17). The

presence of LRG was seen as expected within the human serum sample with

successful deglycosylation when treated with PNGase F.

Figure 17:Negative identification of non-specific binding occurring

due to presence of FCS in media. LRG within a human serum sample

successfully deglycosylated by PNGase F. !

  33  

     

Chapter  4    

Discussion

         

             

  34  

4.1 General Discussion HFpEF is emerging as a major health concern with rapidly increasing prevalence

driven by the ageing population and increased incidence of hypertension, diabetes,

and obesity. Despite this increase in prevalence there is still much to learn about

disease pathogenesis and there is a need for the development of therapeutic and

diagnostic strategies to treat the condition. The present recognized biomarker BNP is

somewhat useful in identifying patients suffering from HF but unfortunately it is

extremely variable between individuals and levels fluctuate depending on patient

characteristics; age, sex and renal function (O'Hanlon et al., 2007). Echocardiography

confirms diagnosis but in most cases, the disease has progressed to a late stage where

considerable remodeling of the myocardium and extensive fibrosis of the interstitium

means that intervention is challenging. There is currently no therapeutics that can

reverse or delay disease progression.

After the identification of LRG’s upregulation in patients suffering from HF and

subsequently showing it to be a stronger diagnostic than BNP (Watson et al., 2011),

its use as a clinical biomarker was suggested. Wang et al., (2013) identified a possible

functional role of LRG through TGF-β signaling in endothelial cells. LRG, in the

presence of endoglin, was seen to cause a switch in Smad signaling from a pro-

fibrotic phenotype to promote neovascularization. This suggested that LRG was

potentially playing a modulatory role and inhibiting the pro-fibrotic response.

Immunostaining within our lab has shown LRG’s presence within cardiac tissue

sections (fig. 4B) (Watson et al., 2011). It is hypothesized that LRG production within

the heart is a protective mechanism that inhibits TGF-β-induced fibroblast activation.

  35  

The purpose of this study was to identify the specific cells responsible for the

production and secretion of LRG. By determining the cellular sources of the

glycoprotein, a better understanding of its role in a failing heart can be formed.

4.2 LRG expression and secretion patterns in cardiac fibroblasts  One of the major hallmarks of HF is chronic fibrosis. The secretion of fibrillar

collagen by TGF-β activated tissue-resident fibroblasts causes ventricular stiffness,

which drives diastolic dysfunction. Given the potential role of LRG in modulating

TGF-β signaling initial experiments were conducted to assess fibroblast expression of

LRG. Low levels of LRG mRNA were detectable by qPCR, with an approximately 50

fold lower expression than in the positive control (HepG2s). Rather than continuing

with PCR, a Western Blot approach was used to determine whether these relatively

low levels of LRG transcript were being translated into detectable protein. Initial

analysis of VHCF lysates revealed a protein band for LRG at ~55kDa. This was a

higher MW than expected, raising concerns as to whether this really was LRG or

perhaps non-specific binding of the antibody. After repeating the experiment and

showing basal “heavy” LRG expression in VHCF cells, a comparison was then made

with other cell supernatants and lysates.

VHCF cells were treated with TGF-β and/or serum-starved. Their differentiation into

activated myofibroblasts, the major cell type causing in ECM deposition, was

achieved by treatment with TGF-β (Fan et al., 2012). Serum-starvation was studied as

it had been previously shown to cause increased LRG protein production in HepG2

cells (Tea et al., Unpublished). An exploratory qPCR was completed on the treated

and non-treated cells. The results again showed relatively low LRG expression in

each cell sample. Serum-starvation did cause an increase in LRG transcription but this

was inconclusive due to lack of repeats and possible technical errors.

  36  

A western blot of the same experiment was carried out to look at the protein

expression and secretion patterns of the fibroblasts. A considerable level of LRG

protein was seen at ~55kDa in the non-treated and TGF-β treated VHCF supernatants.

This proposes that LRG is being secreted from cardiac fibroblasts in abundance with

the suggestion that the cytokine TGF-β is causing an induction. The lysates only

showed banding for the TGF-β and serum-starved samples. Nothing was detectable

for the non-treated lysate. This seems to infer that is necessary for the secretion of

LRG. Without, LRG is possibly in a native or immature form and cannot be expelled

from the cell.

Murine cardiac fibroblasts were kindly donated within the group and after treatment

and testing, they gave similar results. The non-treated and TGF-β treated lysates

showed strong banding patterns at ~55kDa and serum-starvation causing a reduction

to ~50kDa. The amount of LRG present again seemed to suggest that serum

starvation inhibits the production of LRG. This conclusion is speculative due to the

experiment only an n=2.

Serum is vital for mitotic division of cells but also to supply appropriate nutrients to

allow for their growth and survival (Brunner et al., 2010). When absent, the cells are

unable to multiply efficiently, as observed under a light microscope, thus leading also

to a possible reduction in protein production.

VHCF cells culturing in a 2cm3 well for 72 hours become extremely confluent. Their

dense meshwork may be compared to the remodeling, which occurs in the interstitial

spaces during HF. Speculative evidence suggests that due to their high confluency,

the cells react accordingly by secreting LRG in an attempt to modulate the aggressive

  37  

proliferation of cells. When fibroblast division is inhibited due to serum starvation it

is perhaps not necessary for the cells to secrete active LRG forms.

4.3 LRG expression and secretion patterns in monocytes/macrophages  HFpEF is in 60-80% of cases brought about by a hypertensive insult (Owan and

Redfield, 2005). The body attempts to respond accordingly due to the pressure

overload by initially increasing the number of activated inflammatory cells in the

heart. Previously LRG expression was found to increase early in inflammatory

responses through granulocytic differentiation (O'Donnell et al., 2002). Monocytes in

particular are key of early inflammation through their release of pro-inflammatory

cytokines such as MCP1 and TNF-α (Fernandez-Velasco et al., 2014). Their

differentiation to macrophages once inside the vessel wall is an attempt to resolve the

underlying complication. Unfortunately due to sustained injury, uncontrolled

inflammation is the result with constantly activated macrophage promoting aberrant

tissue remodeling (Glezeva and Baugh, 2014). These cells inherent role during the

pathophysiology of HFpEF means their experimentation for the presence of LRG may

be beneficial.

THP1, a human monocytic cell line was the main cell type tested. Peripberal blood

mononuclear cells (PBMCs), a primary cell type, which includes approximately 30%

monocytes, was another inflammatory subtype briefly tested for basal expression of

LRG. An initial qPCR showed evidence of LRG at the mRNA level in THP1s.

Western blotting of its protein lysate showed a strong banding pattern for LRG at

~45kDa with heavier banding patterns also seen at ~55kDa. The variable banding

patterns seen from the blot suggested possible non-specific binding of the antibody

but with the HepG2 control lysate also showing variable banding patterns,

glycovariants of the protein was speculated. Most interesting to note was the fact that

  38  

THP1’s seemed to have a larger expression than the HepG2s under visual observation

of the bands. The PBMC lysate seemed to have low LRG protein expression with a

weak band seen again at ~55kDa.

A serum concentration response was next prepared in an attempt to identify if serum

is truly necessary for the production/secretion of heavier LRG forms. This was

confirmed after western blotting of supernatants and lysates with heavy forms of LRG

only present in the 5% and 10% serum treated cells samples at ~55kDa. The absence

of serum from each medium did not inhibit LRG’s intracellular production with large

signals seen in each lysate.

Macrophages are in many respects a dynamic cell type, promoting either a pro-

fibrotic or pro-inflammatory phenotype (Glezeva and Baugh, 2014). The

differentiation of THP1 cells to macrophage was completed through the phorbol ester

PMA at different concentrations. Identification of a visible induction of LRG after

differentiation was postulated but the results returned negative. There was a

noticeable reduction in protein levels after PMA treatment in the lysates. Speculative

evidence suggests that the cells were differentiated into a M2 type macrophage that

are known to promote cardiac repair and mediate pro-fibrotic responses (Fernandez-

Velasco et al., 2014). The supernatants showed some extremely strange banding

patterns in each sample. This may be artifact due to overloading of the wells. It is

possible that there may have been too much protein in each sample retarding the

migration.

       

  39  

4.4 Glycosylated variants of LRG  It was suggested that the variable banding pattern initially seen between the HepG2

supernatant and lysate was due to extensive glycosylation of the LRG structure. This

suggestion is supported by a previous study, which showed an increase in LRG

glycosylation in pancreatic cancer (Patwa et al., 2006). The secretion patterns of

cardiac fibroblasts and monocytes/macrophage had the same heavy banding

arrangement. There was concern that the Abcam LRG antibody was binding non-

specifically to serum present in the media. An experiment was set up to test this by

using the deglycosylating agent PNGase F in an attempt to reduce the molecular

weight observed previously.

The enzyme was successful in reducing the MW for the suspected LRG glycovariants

in THP1 and HepG2 supernatant and lysates. Suggestive incomplete deglycosylation

occurred for both supernatants reducing to a size of ~37kDa in comparison to the

lysates which was reduced further to ~35kDa. LRG consists of 4 N-linked and 1 O-

linked glycan bonds (Nextprot.org, 2015). PNGase F has the limited ability to cleave

only N-glycans from glycoproteins meaning that the last O-glycan bond possibly

remains in supernatants (as seen in the banding patterns of the supernatants). This

furthers the suggestion that the post-translational modification (PTM) is necessary for

the cells ability to secrete LRG. After 2D-DIGE, differential expression of LRG in

asymptomatic hypertensive patients was seen for the two heaviest spots (Watson et

al., 2011). The presence of this large glycosylated form of LRG proposes the idea that

it has a physiological function in a dysfunctional heart.

The absence of bands for RPMI, DMEM and neat FCS after being loaded onto a blot

confirmed that non-specific binding to the serum was not occurring and this acted as

an appropriate control.

  40  

4.5 Future direction  After observing the protein expression of LRG in both cardiac fibroblasts and THP1

cells, what’s causing its induction needed elucidation. THP1 and PBMC cells

previously treated with various inflammatory products in lysates and their

supernatants were run on a blot (appendix 6). In both cell types, each factor seemed to

cause an induction of intracellular LRG, which offers the idea that LRG is extensively

involved during the inflammatory stage of diastolic dysfunction. LPS and TNF-α

were seen to cause an increase in heavy secreted forms of LRG in THP1 cells. This is

possibly due to their ability to differentiate the monocytes to a M1 type macrophage

(Fernandez-Velasco et al., 2014). Speculation that the heavier form of LRG as the

most functionally active means that the future uses of both factors may be beneficial.

TGF-β also needs to be further tested to elucidate the exact combinatorial signaling

profile that occurs between it and LRG in switching to an anti-fibrotic phenotype.

Attempted optimization of the LRG antibody used by the London group in the Wang

et al,. (2013) study was unsuccessful. No conclusive result was given and it was

thought that an incorrect dilution factor might have been used. Further testing with

this antibody is needed to confirm the true presence of LRG.

After successful identification of what causes the induction and secretion of the heavy

LRG form, its isolation is necessary and then to treat heart tissue sections. If after

treatment, collagen production is inhibited in fibroblasts/myofibroblasts, this will

further add to the existing evidence suggesting that LRG is acting as an anti-fibrotic.

The switch to Smad 1/5/8 signaling can be established in disease relevant cells using a

luciferase reporter vector (Zhang, 2009).

  41  

4.6 Conclusion  The results acquired suggest that LRG production may be stimulated during early

heart dysfunction by a local source within the heart. Acknowledging that LRG is

extensively expressed in liver cells, it seems more plausible that cells elicit their

actions directly at the site of injury. For the first time cardiac fibroblasts were shown

to secrete LRG in abundance from the cell. There is a suggestion that their

differentiation to myofibroblats through TGF-β causes an even larger secretion

pattern but this needs to be tested further and quantified by densitometry.

After establishing that THP1 cells also produce and secrete LRG, it was supposed that

the inflammatory response during HFpEF is vital in preventing a pro-fibrotic

response. Although the macrophage tested did not show an increase in LRG, it is still

hypothesized that these cells are the major component in determining the fate of the

heart.

The dominant finding from this study was the recognition of LRG as being an

extremely glycosylated protein, that’s expression varies depending on its

environment. As already mentioned, future testing on LRG and its variant forms

needs to be completed in order to establish whether the proteins expression is a

protective response during the pathophysiology of HFpEF.

Restricted word count: 5990

  42  

Acknowledgements  I would like to take this opportunity to sincerely thank my Principal investigator, Dr.

John Baugh for his continual support and guidance throughout my project. His

unending patience and good humour meant approaching him about any issue I had

was no problem. I would also like to kindly thank his strong team, including Dr. Chris

Watson, Dr Nadia Glezeva, Adam Russell-Hallinan, James O’Reilly and Roisin

Neary. A special mention to Eugene McNamara for his fantastic supervision and help

throughout my thesis. I gratefully acknowledge the Irish Health Research Board for

their financial support in allowing me to complete my project. I thank the Conway

Institute for allowing me to complete my study within their lab and the use of their

equipment. Kind regards to Dr. Anna Alucino and Dr. Eoin Cummins for their

donation of the THP1 cells. Finally a massive thank you to my family for their

unending love and encouragement throughout my study at UCD. None of this would

have been possible without you.

  43  

Bibliography

           

  44  

ABBATE,  A.,  ARENA,  R.,  ABOUZAKI,  N.,  VAN  TASSELL,  B.  W.,  CANADA,  J.,  SHAH,  

K.,  BIONDI-­‐ZOCCAI,  G.  &  VOELKEL,  N.  F.  2015.  Heart  failure  with  preserved  ejection  fraction:  Refocusing  on  diastole.  Int  J  Cardiol,  179c,  430-­‐440.  

BAICU,  C.  F.,  ZILE,  M.  R.,  AURIGEMMA,  G.  P.  &  GAASCH,  W.  H.  2005.  Left  ventricular  systolic  performance,  function,  and  contractility  in  patients  with  diastolic  heart  failure.  Circulation,  111,  2306-­‐12.  

BRUNNER,  D.,  FRANK,  J.,  APPL,  H.,  SCHOFFL,  H.,  PFALLER,  W.  &  GSTRAUNTHALER,  G.  2010.  Serum-­‐free  cell  culture:  the  serum-­‐free  media  interactive  online  database.  Altex,  27,  53-­‐62.  

CHATTERJEE,  K.  &  MASSIE,  B.  2007.  Systolic  and  diastolic  heart  failure:  differences  and  similarities.  J  Card  Fail,  13,  569-­‐76.  

CHO,  D.-­‐I.,  KIM,  M.  R.,  JEONG,  H.-­‐Y.,  JEONG,  H.  C.,  JEONG,  M.  H.,  YOON,  S.  H.,  KIM,  Y.  S.  &  AHN,  Y.  2014.  Mesenchymal  stem  cells  reciprocally  regulate  the  M1/M2  balance  in  mouse  bone  marrow-­‐derived  macrophages.  Experimental  &  molecular  medicine,  46,  e70.  

FAN,  D.,  TAKAWALE,  A.,  LEE,  J.  &  KASSIRI,  Z.  2012.  Cardiac  fibroblasts,  fibrosis  and  extracellular  matrix  remodeling  in  heart  disease.  Fibrogenesis  Tissue  Repair,  5,  15.  

FERNANDEZ-­‐VELASCO,  M.,  GONZALEZ-­‐RAMOS,  S.  &  BOSCA,  L.  2014.  Involvement  of  monocytes/macrophages  as  key  factors  in  the  development  and  progression  of  cardiovascular  diseases.  Biochem  J,  458,  187-­‐93.  

FIGUEROA,  M.  S.  &  PETERS,  J.  I.  2006.  Congestive  heart  failure:  Diagnosis,  pathophysiology,  therapy,  and  implications  for  respiratory  care.  Respir  Care,  51,  403-­‐12.  

GLEZEVA,  N.  &  BAUGH,  J.  A.  2014.  Role  of  inflammation  in  the  pathogenesis  of  heart  failure  with  preserved  ejection  fraction  and  its  potential  as  a  therapeutic  target.  Heart  Fail  Rev,  19,  681-­‐94.  

GOUMANS,  M.  J.,  LEBRIN,  F.  &  VALDIMARSDOTTIR,  G.  2003.  Controlling  the  angiogenic  switch:  a  balance  between  two  distinct  TGF-­‐b  receptor  signaling  pathways.  Trends  Cardiovasc  Med,  13,  301-­‐7.  

HA,  Y.  J.,  KANG,  E.  J.,  LEE,  S.  W.,  LEE,  S.  K.  &  PARK,  Y.  B.  2014.  Usefulness  of  serum  leucine-­‐rich  alpha-­‐2  glycoprotein  as  a  disease  activity  biomarker  in  patients  with  rheumatoid  arthritis.  29,  1199-­‐204.  

HAUPT,  H.  &  BAUDNER,  S.  1977.  [Isolation  and  characterization  of  an  unknown,  leucine-­‐rich  3.1-­‐S-­‐alpha2-­‐glycoprotein  from  human  serum  (author's  transl)].  Hoppe  Seylers  Z  Physiol  Chem,  358,  639-­‐46.  

HAYDOCK,  P.  M.  &  COWIE,  M.  R.  2010.  Heart  failure:  classification  and  pathophysiology.  Medicine,  38,  467-­‐472.  

KAPUR,  N.  K.,  WILSON,  S.,  YUNIS,  A.  A.,  QIAO,  X.,  MACKEY,  E.,  PARUCHURI,  V.,  BAKER,  C.,  ARONOVITZ,  M.  J.,  KARUMANCHI,  S.  A.,  LETARTE,  M.,  KASS,  D.  A.,  MENDELSOHN,  M.  E.  &  KARAS,  R.  H.  2012.  Reduced  endoglin  activity  limits  cardiac  fibrosis  and  improves  survival  in  heart  failure.  Circulation,  125,  2728-­‐38.  

KENTSIS,  A.,  AHMED,  S.,  KUREK,  K.,  BRENNAN,  E.,  BRADWIN,  G.,  STEEN,  H.  &  BACHUR,  R.  2012.  Detection  and  diagnostic  value  of  urine  leucine-­‐rich  

  45  

alpha-­‐2-­‐glycoprotein  in  children  with  suspected  acute  appendicitis.  Ann  Emerg  Med,  60,  78-­‐83.e1.  

KRENNING,  G.,  ZEISBERG,  E.  M.  &  KALLURI,  R.  2010.  The  Origin  of  Fibroblasts  and  Mechanism  of  Cardiac  Fibrosis.  Journal  of  cellular  physiology,  225,  631-­‐637.  

LIM,  H.  &  ZHU,  Y.  Z.  2006.  Role  of  transforming  growth  factor-­‐beta  in  the  progression  of  heart  failure.  Cell  Mol  Life  Sci,  63,  2584-­‐96.  

MANDINOV,  L.,  EBERLI,  F.  R.,  SEILER,  C.  &  HESS,  O.  M.  2000.  Diastolic  heart  failure.  

MCMURRAY,  J.  J.,  ADAMOPOULOS,  S.,  ANKER,  S.  D.,  AURICCHIO,  A.,  BOHM,  M.,  DICKSTEIN,  K.,  FALK,  V.,  FILIPPATOS,  G.,  FONSECA,  C.,  GOMEZ-­‐SANCHEZ,  M.  A.,  JAARSMA,  T.,  KOBER,  L.,  LIP,  G.  Y.,  MAGGIONI,  A.  P.,  PARKHOMENKO,  A.,  PIESKE,  B.  M.,  POPESCU,  B.  A.,  RONNEVIK,  P.  K.,  RUTTEN,  F.  H.,  SCHWITTER,  J.,  SEFEROVIC,  P.,  STEPINSKA,  J.,  TRINDADE,  P.  T.,  VOORS,  A.  A.,  ZANNAD,  F.,  ZEIHER,  A.,  BAX,  J.  J.,  BAUMGARTNER,  H.,  CECONI,  C.,  DEAN,  V.,  DEATON,  C.,  FAGARD,  R.,  FUNCK-­‐BRENTANO,  C.,  HASDAI,  D.,  HOES,  A.,  KIRCHHOF,  P.,  KNUUTI,  J.,  KOLH,  P.,  MCDONAGH,  T.,  MOULIN,  C.,  POPESCU,  B.  A.,  REINER,  Z.,  SECHTEM,  U.,  SIRNES,  P.  A.,  TENDERA,  M.,  TORBICKI,  A.,  VAHANIAN,  A.,  WINDECKER,  S.,  MCDONAGH,  T.,  SECHTEM,  U.,  BONET,  L.  A.,  AVRAAMIDES,  P.,  BEN  LAMIN,  H.  A.,  BRIGNOLE,  M.,  COCA,  A.,  COWBURN,  P.,  DARGIE,  H.,  ELLIOTT,  P.,  FLACHSKAMPF,  F.  A.,  GUIDA,  G.  F.,  HARDMAN,  S.,  IUNG,  B.,  MERKELY,  B.,  MUELLER,  C.,  NANAS,  J.  N.,  NIELSEN,  O.  W.,  ORN,  S.,  PARISSIS,  J.  T.  &  PONIKOWSKI,  P.  2012.  ESC  guidelines  for  the  diagnosis  and  treatment  of  acute  and  chronic  heart  failure  2012:  The  Task  Force  for  the  Diagnosis  and  Treatment  of  Acute  and  Chronic  Heart  Failure  2012  of  the  European  Society  of  Cardiology.  Developed  in  collaboration  with  the  Heart  Failure  Association  (HFA)  of  the  ESC.  Eur  J  Heart  Fail,  14,  803-­‐69.  

MCMURRAY,  J.  J.  &  PFEFFER,  M.  A.  2005.  Heart  failure.  Lancet,  365,  1877-­‐89.  NEXTPROT.ORG, (2015). LRG1 - Leucine-rich alpha-2-glycoprotein - human

protein (Proteomics). [online] Available at: http://www.nextprot.org/db/entry/NX_P02750/proteomics [Accessed 2 Feb. 2015]

O'DONNELL,  L.  C.,  DRUHAN,  L.  J.  &  AVALOS,  B.  R.  2002.  Molecular  characterization  and  expression  analysis  of  leucine-­‐rich  alpha2-­‐glycoprotein,  a  novel  marker  of  granulocytic  differentiation.  J  Leukoc  Biol,  72,  478-­‐85.  

O'HANLON,  R.,  O'SHEA,  P.,  LEDWIDGE,  M.,  O'LOUGHLIN,  C.,  LANGE,  S.,  CONLON,  C.,  PHELAN,  D.,  CUNNINGHAM,  S.  &  MCDONALD,  K.  2007.  The  biologic  variability  of  B-­‐type  natriuretic  peptide  and  N-­‐terminal  pro-­‐B-­‐type  natriuretic  peptide  in  stable  heart  failure  patients.  J  Card  Fail,  13,  50-­‐5.  

OH,  J.  K.,  HATLE,  L.,  TAJIK,  A.  J.  &  LITTLE,  W.  C.  2006.  Diastolic  heart  failure  can  be  diagnosed  by  comprehensive  two-­‐dimensional  and  Doppler  echocardiography.  J  Am  Coll  Cardiol,  47,  500-­‐6.  

OWAN,  T.  E.  &  REDFIELD,  M.  M.  2005.  Epidemiology  of  diastolic  heart  failure.  Prog  Cardiovasc  Dis,  47,  320-­‐32.  

PATWA,  T.  H.,  ZHAO,  J.,  ANDERSON,  M.  A.,  SIMEONE,  D.  M.  &  LUBMAN,  D.  M.  2006.  Screening  of  glycosylation  patterns  in  serum  using  natural  glycoprotein  microarrays  and  multi-­‐lectin  fluorescence  detection.  Anal  Chem,  78,  6411-­‐21.  

RUDOLPH,  A.,  ABDEL-­‐ATY,  H.,  BOHL,  S.,  BOYÉ,  P.,  ZAGROSEK,  A.,  DIETZ,  R.  &  SCHULZ-­‐MENGER,  J.  2009.  Noninvasive  Detection  of  Fibrosis  Applying  Contrast-­‐Enhanced  Cardiac  Magnetic  Resonance  in  Different  Forms  of  

  46  

Left  Ventricular  Hypertrophy:  Relation  to  Remodeling.  Journal  of  the  American  College  of  Cardiology,  53,  284-­‐291.  

SHIRAI,  R.,  HIRANO,  F.,  OHKURA,  N.,  IKEDA,  K.  &  INOUE,  S.  2009.  Up-­‐regulation  of  the  expression  of  leucine-­‐rich  α2-­‐glycoprotein  in  hepatocytes  by  the  mediators  of  acute-­‐phase  response.  Biochemical  and  Biophysical  Research  Communications,  382,  776-­‐779.  

WANG,  X.,  ABRAHAM,  S.,  MCKENZIE,  J.  A.,  JEFFS,  N.,  SWIRE,  M.,  TRIPATHI,  V.  B.,  LUHMANN,  U.  F.,  LANGE,  C.  A.,  ZHAI,  Z.,  ARTHUR,  H.  M.,  BAINBRIDGE,  J.  W.,  MOSS,  S.  E.  &  GREENWOOD,  J.  2013.  LRG1  promotes  angiogenesis  by  modulating  endothelial  TGF-­‐beta  signalling.  Nature,  499,  306-­‐11.  

WATSON,  C.  J.,  LEDWIDGE,  M.  T.,  PHELAN,  D.,  COLLIER,  P.,  BYRNE,  J.  C.,  DUNN,  M.  J.,  MCDONALD,  K.  M.  &  BAUGH,  J.  A.  2011.  Proteomic  analysis  of  coronary  sinus  serum  reveals  leucine-­‐rich  alpha2-­‐glycoprotein  as  a  novel  biomarker  of  ventricular  dysfunction  and  heart  failure.  Circ  Heart  Fail,  4,  188-­‐97.  

ZHANG,  Y.  E.  2009.  Non-­‐Smad  pathways  in  TGF-­‐[beta]  signaling.  Cell  Res,  19,  128-­‐139.  

   

  47  

   

Appendix

                                               

  48  

 Appendix  1  Materials  

Material Company Code 10% NP-40 Millipore #B2704S 100% Methanol Sigma-Aldrich #24229-25L-R 10X G7 Reaction Buffer Millipore #B3704S BME EMD millipore #M6250 Bovine Serum Albumin (BSA)

Sigma-Aldrich #BPE9701-100

Chemiluminescent HRP Substrate

NEB #P90720

Dimethyl Sulfoxide (DMSO) Dulbeccos Modified Eagle Medium (DMEM)

Promo Kine #BE12-614F

Foetal Calf Serum (FCS) Relaprep RNA #10270-106 GapDH primary Ab Sigma-Aldrich #MAB374 Glycoprotein Denaturing Buffer

Millipore #B1704S

HRP Substrate SuperSignal West Pico Chemiluminescent Substrate

NEB #WBKL50500

Human Liver Hepatocellular Carcinoma Cells

ATCC #HB-8065

L-Glutamine Santa Cruz Biotechnologies

#25030

Lamelli Buffer Bio-Rad #161-0737 Penicillin/Streptomycin Sigma-Aldrich #1514 Phorbol 12-myristate 13-acetate (PMA)

Fisher Scientific #P8139

Phosphate Buffered Saline (PBS)

Lonza #17-513F

PNGase F NEB #P0704S Polyvinylidine Fluoride (PVDF) Membrane

NEB #IPVH00010

Quantitative polymerase chain reaction (qPCR)

Gibco #Z6012

Random Primers Invitrogen #18064 SeeBlue Plus2 Pre-stained Standard Protein Ladder

Promokine #LC5925

Superscript II Reverse Transcriptase (SIIRT)

Invitrogen #906161

Tetramethylethylenediamine Cell signalling technologies

T9281

THP1 cells Worthington #TIB-202 Transforming Growth Factor β (TGFβ)

Promokine #C-63503

Trypsin Sigma-Aldrich #25200-056 Ventricular Human Cardiac Fibroblasts (VHCFs)

ScienCell HCF-AV #6310

β-2-Mercaptoethanol (βME) Gibco #M6250-100ML

  49  

 Appendix  2  List of Abbreviations  

% Percentage °C Degree Celsius ~ Approximately AMPS Ammonium Persulfate ASMA Alpha Smooth Muscle Actin βME Beta-2-Mercaptoethanol B2M Beta-2 microglobulin BSA Bovine Serum Albumin CAD Coronary Artery Disease Ct Cycle Threshold DNA Deoxyribonucleic Acid DHF Diastolic Heart Failure DMEM Dulbeccos Modified Eagle Medium EC Endothelial Cells ECM Extracellular Matrix FCS Foetal Calf Serum GS Glucose Solution GapDH Glyceraldehyde-3-Phosphate Dehydrogenase g Grams  G G-force  HRP Horseradish Peroxidase  HepG2 Human Liver Hepatocellular Carcinoma Interleukin

  50  

HFpEF Heart Failure with Preserved Ejection Fraction  IL Interleukin    kDa Kilodaltons    LPS Lipopolysaccharide  LVDD Left Ventricular Diastolic Dysfunction    LRG Leucine rich α2-Glycoprotein MCP Monocyte Chemoattractant Protein  mRNA Messenger Ribonucleic Acid MM Mastermix  µg Micrograms  µl Microlitres  ml Millilitres  mM Millimolar  mV Millivolts  M Molar    ng Nanograms  PBMC Peripheral Blood Mononuclear Cells  % Percentage  PBS Phosphate Buffered Saline  PMA Phorbol 12-myristate 13-acetate  PTM Post-­‐translational  Modification    PVDF Polyvinylidine Fluoride    qPCR Quantitative Polymerase Reaction   RCT Randomised controlled trials  RIPA Radioimmunoprecipitation

  51  

   Appendix 3  

Reagents Quantity (per sample) Yellow Core Buffer 24µl MnCl2 3µl Dnase I 3µl

DNase solution mix

Reagents Amounts 100ng Random Primers 1µl dNTP mix 1µl RNA Samples 10µl

Mastermix 1 (per sample)

Reagents Amounts First strand buffer 4µl 0.1M DTT 2µl RNase out 1µl

RPMI Roswell Park Memorial Institute Media n Sample Number SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel

Electrophoresis s Seconds SS Serum Starvation THP1 Human monocytic cell SIIRT Superscript II Reverse Transcriptase SHF Systolic Heart Failure TEMED Tetramethylethylenediamine TGF-β Transforming Growth Factor Beta TBS Tris-Buffered Saline TNF-α Tumor Necrosis Factor Alpha VHCF Ventricular Human Cardiac Fibroblasts 2D-DIGE Two Dimensional Fluorescence Difference Gel

Electrophoresis

  52  

Mastermix 2 (per sample)

Gene   Forward  Sequence   Reverse  Sequence  GapDH   5'  -­‐  ACAGTCAGCCGCATCTTCTT  -­‐  

3'  5'  -­‐  ACGACCAAATCCGTTGACTC  -­‐  3'  

LRG1   5'  -­‐  CAGACAGCGACCAAAAAGC  -­‐  3'  

5'  -­‐  AGGTGGTTGACAGGAGATGG  -­‐  3'  

LRG and GapDH primer sequences Appendix 4  

   

qPCR  Amplification  Plot    

 

 qPCR  dissociation  curve  

  53  

Appendix 5

Recipies

PAGE Transfer Protein Detection 10X running buffer 20X TBS 1X Stripping Buffer

30.2g of 25mM Tris base 30.3g 0.5M Tris Base in 500ml dH2O 3.78g TrisBase in 500 ml dH2O

188g of 250mM Glycine SDS 0.4% 2.0g pH6.8 10.0g 2.0% SDS pH 2.0 10g of 0.1% SDS Add 72µL of BME 1X running buffer 1X TBS-T (0.1% Tween) Blocking Buffer

900ml dH2O 50ml 20X TBS 950ml dH2O 2.5g of skim milk powder 100ml of 10 x running buffer 1ml Tween 50 ml TBS-tween

500µL of Goat Serum

1X Separating Buffer 10X Transfer Buffer 90.8g of 1.5M Tris Base in 500ml of dH2O 144g of 192mM Glycine 2.0g of 0.4% SDS pH6.8 30g of 24.7mM Tris Base Make up to 1L with dH2O 1X Stacking Buffer 1X Transfer Buffer

30.3g of 0.5M Tris Base in 500ml of dH2O 800 ml dH2O

2.0g of 0.4% SDS pH6.8 100 ml of 10X transfer buffer

100 ml Methanol

1X RIPA Buffer Loading Dye TGF-β (0.5ng/µ l solution) 1:10 dilution of 10X RIPA 950µl of Lamellae Buffer 1µl of TGF-β 1X protease inhibitor cocktail tablet 50µl of β-ME 99µl of 0% DMEM medium

  54  

Appendix 6

Supplementary Western Blots

A

B

  55