1

The quarternary structure of DNA Polymerase ε from S. cerevisiae# Olga Chilkova1, Bengt-Harald Jonsson2 and Erik Johansson1* 1 Department of Medical Biochemistry and Biophysics Umeå University SE-901 87 UMEÅ Sweden 2 IFM/ Molecular Biotechnology Linköpings University SE-581 83 LINKÖPING Sweden Running Title: Quarternary structure of DNA polymerase ε Inquiries to: Erik Johansson TEL: +46-(0)90-7866638 FAX: +46-(0)90-7869795 E-mail: erik.johansson@medchem.umu.se

# This work was supported by the Swedish Cancer Society, Swedish Research Council, the Magnus Bergwalls stiftelse, and Kungliga vetenskapsakademiens stipendiefond. *Correspondence to this author.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

2

SUMMARY

DNA polymerase ε (Pol ε) from S. cerevisiae consists of four subunits (Pol2, Dpb2,

Dpb3, and Dpb4) and is essential for chromosomal DNA replication. Biochemical

characterizations of Pol ε have been cumbersome due to protease sensitivity and the

limited amounts of Pol ε in cells. We have developed a protocol for over-expression

and purification of Pol ε from S. cerevisiae. The native four-subunit complex was

purified to homogeneity by conventional chromatography. Pol ε was characterized

biochemically by sedimentation velocity experiments and gel filtration experiments.

The stoichiometry of the four subunits was estimated to be 1:1:1:1 from colloidal

Coomassie-stained gels. Based on the sedimentation coefficient (11.9 S) and the

Stokes radius (74.5 Å), a molecular mass for Pol ε of 371 kDa was calculated, in good

agreement with the calculated molecular mass of 379 kDa for a heterotetramer.

Furthermore, analytical equilibrium ultracentrifugation experiments support the

proposed heterotetrameric structure of Pol ε. Thus, both DNA polymerase δ and Pol ε

are purified as monomeric complexes, in agreement with accumulating evidence that

Pol δ and Pol ε are located on opposite strands of the eukaryotic replication fork.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

3

INTRODUCTION

Pioneering studies in the SV40 DNA replication system by several research groups

resulted in the reconstitution of the SV40 replication fork with mammalian proteins in

vitro (1). This system showed that DNA polymerase α is required for priming the

DNA since it is associated with primase activity. Only DNA polymerase δ (Pol δ) was

required to replicate both leading and lagging strand, leaving another essential

eukaryotic DNA polymerase, DNA polymerase ε (Pol ε), without a specific function.

However, there are several lines of evidence for the presence of Pol ε at the

eukaryotic replication fork. Evidence for a physical interaction came from cross-

linking experiments which showed that Pol ε is located at or near the replication fork

(2). Genetic experiments in S. cerevisiae have shown that Pol ε participates at the

replication fork. Cells grown in the presence of 6-hydroxylaminopurine showed a

strand specific mutation rate on the chromosome, depending on whether they carried

an exonuclease deficient Pol ε or Pol δ (3). It has also been shown that loss of the

exonuclease site in either Pol δ or Pol ε alters the mutation spectra of the sup-4 gene

when replicated on a plasmid (4). The altered mutational spectrum was again strand

specific. In addition, the overall mutation rate is increased about ten-fold in yeast

strains that carry a pol2 mutant that is lacking proofreading capability, suggesting that

Pol ε contributes to the bulk synthesis of newly replicated DNA (5). Evidence for a

direct role during the progression of the fork has emerged from in vitro replication

assays in Xenopus extracts in a cell-free system (6).

A very surprising result was obtained when the catalytic domain of Pol ε was deleted

in yeast (7). The catalytic domain was not essential. The essential property of the

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

4

enzyme was instead located at the C-terminus of the largest subunit(7;8). Cells that

were expressing only the C-terminus were viable, although they had growth problems.

However, later it was shown that cells were not viable when carrying a point mutation

in the conserved catalytic site of Pol ε (9). Although Pol ε is normally present at the

fork, in the absence of the catalytic domain, another DNA polymerase, presumably

Pol δ, can substitute its function.

Pol ε consists of four subunits, Pol2p (256 kDa), Dpb2p (79 kDa), Dpb3p (23 kDa),

and Dpb4p (22 kDa) (10). The largest subunit, Pol2p, contains the catalytic site and

an essential putative zinc-finger domain at the C-terminus (9). The other three

subunits have an unknown function. There has been very limited biochemical

characterization of the 4-subunit enzyme, since it was first purified in 1990 (10). This

is in part due to the limited amount of enzyme in the cells, the tedious purification

protocol, and the sensitivity of the enzyme to proteolytic cleavage (10;11).

Several models of the structure of the eukaryotic replication fork have been proposed

(1;12-14). A common theme has been the coupled synthesis of the leading and

lagging strands in which the replicative DNA polymerase should form a dimer as has

been observed in E. coli (15;16). Earlier studies suggested the existence of a dimeric

Pol δ with two catalytic assemblies, and a model where a dimeric Pol δ would

replicate both leading and lagging strand was proposed (13;17). However, it has now

been demonstrated that Pol δ actually is a monomer in vitro, and that the previous

estimates of the molecular weight of Pol δ were misleading due to the elongated shape

of the enzyme (18). The initial analysis of the 4-subunit Pol ε included an estimate of

the molecular weight and the subunit stoichiometry (10). The molecular weight was

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

5

estimated to be 295 kDa from the hydrodynamic properties of the enzyme, and the

molar ratio of the four subunits was estimated at Pol2/Dpb2/Dpb3/Dpb4 =1:1:3:4.

This molar ratio predicted a molecular mass of 492 kDa, which was substantially

different from that determined experimentally. The authors concluded that the enzyme

was purified as a monomer with an elongated shape. Pol ε has also been proposed to

form a dimer based on yeast two-hybrid assays and gel filtration experiments using

Pol ε overproduced in a baculovirus system (9;19). In light of these contradictory

results we wished to clarify whether Pol ε exist as a monomer or a dimer when

overproduced in yeast. Therefore, we developed an over-expression system that

allowed us to purify native Pol ε from yeast, i.e. without tags. Our studies of the

assembly state of this enzyme show it to be a monomeric assembly of one each of the

four subunits.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

6

EXPERIMENTAL PROCEDURES

Strains - A protease deficient yeast strain was used for the over-expression of Pol ε.

PY116 (ura 3-52, trp 1∆, his 3-11, 15, pep 4-4, prb 1-1122 (prc1-407) (CANsens), leu

2-3, 112, nuc 1: LEU 2) was transformed with plasmids pJL1 and pJL6 (see below).

This strain for over-expression of Pol ε was called YEJ1. PJL1 contained the POL2

gene and pJL6 contained the DPB2, DPB3 and DPB4 genes under the control of the

GAL1-10 promoter. The plasmids carried a 2µ origin and either TRP1 or URA3 as

selective markers.

Plasmids – All plasmids were based on the pRS424GAL and pRS426GAL from the

pRS424-426GAL series of plasmids (a kind gift from P. Burgers). The POL2 gene

was amplified from the plasmid YCplac33 POL2 (20) with the following

oligonucleotides; POL2-1: 5´-

TTCTAGAGCGGCCGCATGATGTTTGGCAAGAAAAAAAACAACGG -3´;

POL2-2: 5´-

AACACGAGCTCTCATATGGTCAAATCAGCAATACAACTCAATAA -3´. The

resulting DNA fragment was digested with NotI and SacI, purified and ligated into

prs424GAL opened in NotI and SacI. The 500 nucleotides most approximate to NotI

and SacI were sequenced to make sure that no mutations were inserted by KlenTAQ

LA during the amplification of the insert. After this, the over-expression plasmid was

digested with PshAI and NgoMIV to remove most of the POL2 gene. The YCplac33

POL2 plasmid was also digested with PshAI and NgoMIV and the 6151 nt fragment

containing the POL2 gene was subcloned into the opened prs424GAL-POL2 plasmid.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

7

The resulting plasmid was named pJL1. DPB2, DPB3, and DPB4 were amplified

from W303 genomic DNA with the following oligonucleotides; DPB2-1: 5´-

TTCTAGGATCCATGTGTGAAATGTTTGGCTCTGGGA -3´; DPB2-2: 5´-

TTCTAGAGCGGCCGCAAACGGTAGGCCAAGTAAACTGCCC -3´; DPB3-1: 5´-

TTCTAGAGCGGCCGCTCAACCGTGTTGCAAAAAAAATGTCC -3´; DPB3-2:

5´- AACACGAGCTCGTAATTGTGGCACAGGCAAGCTG -3´; DPB4-1: 5´-

TTCTAGAGAATTCATGCCACCAAAAGGTTGGAGAAAAG -3´; DPB4-2: 5´-

AACACGTCGACATATTCAGTTGCTCTAATCGGAGC -3´. The amplified DPB2

gene was digested with BamHI and NotI, purified and ligated into the BamHI-NotI

sites of prs424GAL. The resulting plasmid was called pJL2. The amplified DPB3

gene was digested with NotI and SacI, purified and ligated into the NotI-SacI sites of

prs426GAL. This plasmid was called pJL3. The amplified DPB4 gene was digested

with EcoRI and SalI, purified and ligated into the EcoRI-SalI sites of prs426GAL.

This plasmid was called pJL4. Next, DPB2, DPB3 and DPB4 were sequenced to

confirm that no mutations had been inserted by the polymerase during the

amplification. This was followed by the digestion of pJL3 and pJL4 with BamHI and

SacI. The fragment from pJL3 that contained DPB3 was cloned into the BamHI-SacI

sites of the pJL4 plasmid. This plasmid was digested with SacI and blunt-ended with

Klenow. pJL2 was digested with SapI and HincII, over-hangs were filled in by

Klenow and DPB2 was ligated into the opened blunt-ended plasmid containing DPB3

and DPB4. The resulting plasmid, prs426GAL with DPB2, DPB3, and DPB4, was

called pJL6.

Cell growth - For Pol ε over-expression the YEJ1 strain was grown as previously

described in (21). Briefly, the YEJ1 strain was grown in 100 ml of Glycerol-lactate

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

8

media overnight. After 24 hours, the culture was aliquoted into six 6 liter flasks, each

containing 1.2 liter glycerol lactate media, and left vigorously shaking at 30 °C. After

another 24 hours 1.2 l of YPGL media was added to every flask. YPGL media

consists of 1% yeast extract, 2% bactopeptone, 3% glycerol, 2% lactic acid and 0.1%

glucose, pH 5.5-6. After 3-4 hours the protein expression was induced by adding solid

galactose to a final concentration of 2%. After another 6 hours the cells were

harvested by centrifugation for 5 min at 4 ˚C. The cells were resuspended in H2O and

frozen in liquid nitrogen.

Enzyme purification - All purification steps were carried out at 4 ˚C. The following

buffers were used. Buffer A: 150 mM Tris-Ac pH 7.8, 50 mM NaAc, 2 mM EDTA, 1

mM EGTA, 10 mM NaHSO3, 1 mM dithiothreitol, 5 µM pepstatin A, 5 µM

leupeptin, 0.3 mM p-phenylmethylsulfonyl fluoride, 5 mM benzamidine. Buffer B: 25

mM Hepes-NaOH pH 7.6, 10% glycerol, 1 mM EDTA, 0.5 mM EGTA, 0.005%

Nonidet P-40, 1 mM DTT, 5 µM pepstatin A, 5 µM leupeptin, 5 mM NaHSO3. The

concentration of sodium acetate is indicated as suffix, for example, buffer B100 =

buffer B with 100 mM NaAc. A beadbeater was used to open 60-70 g of cells in

Buffer A. Beating continued for 5 min with intervals of 1 min cooling every 30

seconds. The volume of the lysate from the beadbeater was measured and saturated

ammonium sulfate was added to a final concentration of 175 mM, followed by the

addition of 40 µl 10 % Polymin P per ml of extract. The lysate was incubated on ice

with occasional stirring for 15 min, followed by centrifugation at 18,000 rpm in a

Beckman JA25.5 rotor for 1 hour. The volume of the cleared lysate was measured and

0.28 g of solid ammonium sulfate was added per ml of extract. The ammonium sulfate

was dissolved for 45 min on a magnetic stirrer, followed by centrifugation at 18,000

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

9

rpm in a Beckman JA25.5 rotor for 1 hour. The ammonium sulfate precipitate was

resuspended in buffer B50 and frozen. The next day, the frozen extract was thawed and

dialyzed against 1000 ml of buffer B100 for 3 hours, and thereafter centrifuged for 30

min. The cleared lysate was loaded onto a 20 ml phosphocellulose column

equilibrated in B200. The column was washed with B200 and eluted with B750. Fractions

with protein were loaded onto a MonoQ column eluted with a 20 ml linear gradient

from B800 to B1200. After dialysis against 500 ml of buffer B100, peak fractions from

MonoQ were loaded onto a MonoS column equilibrated in B100 and eluted with a 20

ml linear gradient from B100 to B500. Finally, the MonoS peak fraction was passed

over a Superose6 gel filtration column as described below. The protein concentration

in various fractions throughout the purification was determined by the method of

Bradford (22) with BSA as a standard.

Gel filtration analysis - A Superose 6 gel filtration column was equilibrated at 4 °C in

Buffer C. Buffer C: 25 mM Hepes pH 7.6, 10% glycerol, 1 mM EDTA, 0.005%

Nonidet P-40, 400 mM NaAc, 5 mM dithiothreitol, 5 mM NaHSO3, 2 µM leupeptin, 2

µM pepstatin A. The column was calibrated by injection of proteins with a known

Stokes radius. The Stokes radii of the standard proteins were plotted against their

elution volumes. The standard proteins used were: carbonic anhydrase (Ve = 18.07

ml), bovine serum albumin (Ve = 16.68 ml), catalase (Ve = 15.92 ml), ferritin (Ve =

14.82 ml), E. coli β-galactosidase (Ve = 14.45 ml), and thyroglobulin (Ve = 12.65 ml).

0.2-20 µg Pol ε from the MonoS peak fraction was passed over the equilibrated

superose6 column. Fractions were analyzed by SDS-PAGE and the polymerase

activity was measured. The specific activity of purified Pol ε was determined to be

25-40000 U/mg protein, as defined by Hamatake et.al. (10).

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

10

Glycerol Gradient Centrifugation — 0.2-20 µg of Pol ε from the MonoS peak fraction

together with 0.5 µg of bovine liver catalase (Sigma) as an internal control, in a total

volume of 100 µl, were layered on top of a 4 ml 15–30% linear gradient of glycerol in

buffer C. The samples were spun for 16 h at 40,000 rpm in a Beckman SW60 rotor at

1°C. Fractions were collected from the bottom of the tube, and aliquots were analyzed

by SDS-PAGE, DNA polymerase assays or Western-blot analysis with Dpb4p

antibodies. The rabbit Dpb4p polyclonal antibodies were raised against Dpb4p that

was over-expressed and purified from E.coli. Aliquots of each fraction were also

removed for spectrophotometric assay of catalase activity (23). Whole cell extracts

from wild-type yeast were prepared as previously described, and cleared lysate was

loaded onto the 15-30% glycerol gradient in buffer C400. The density of glycerol

gradient fractions was measured refractometerically. Standard proteins with known

sedimentation coefficients were used to calibrate the gradients: carbonic anhydrase

(2.8 S), bovine serum albumin (4.3 S), aldolase (8.9 S), catalase (11.3 S) and ferritin

(17.6 S).

Polymerase assays - For DNA polymerase assays an oligo(dT)16 primed poly(dA)300

template was used (24). A typical reaction (50 µl) contained 20 mM Tris-HCl pH 7.5,

4% glycerol, 0.1 mg/ml bovine serum albumin, 5 mM dithiothreitol, 8 mM MgAc2, 80

µM each dATP, dCTP, and dGTP, 20 µM [3H]dTTP (400-600 cpm/pmol), 0.01 U

poly(dA)⋅oligo(dT), 1 mM spermidine and enzyme. Reactions were assembled on ice

and incubated for 30 sec to 5 min at 30 °C. The reactions were stopped by the

addition of 150 µl stop solution (50 mM sodium pyrophosphate, 25 mM EDTA and

50 µg/ml salmon sperm DNA). The insoluble material was precipitated by adding 1.5

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

11

ml of 10% trichloroacetic acid, followed by a 30 min incubation on ice. The insoluble

material was filtered on GF/C filters, washed 4x2 ml with 1 M HCl in 0.05 M sodium

pyrophosphate, rinsed with ethanol, dried, and counted by liquid scintillation. One

unit of enzyme activity incorporates 1 nmol of total nucleotide / hour (10).

Sedimentation equilibrium experiments - The analytical ultracentrifugation

experiments were carried out at 10 °C in a Beckman XL-A/XL-I analytical

ultracentrifuge, equipped with an An50Ti rotor using six sector centerpieces.

Sedimentation equilibrium experiments on Pol ε were analyzed in Buffer D (as Buffer

C but with 5 mM 2-mercaptoethanol instead of dithiothreitol) at three different initial

protein concentrations, 2.1 µM, 0.28 µM and 0.14 µM. Absorbance at 280 nm was

measured as a function of radial position for three rotor speeds, ranging from 4000 to

7500 rpm. Equilibrium at each rotor speed was reached after 20 hours. At that time,

five scans were averaged for each sample at each rotor speed. The sedimentation

properties of Pol ε were analyzed by using the self association model in the Beckman

software package.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

12

RESULTS

We chose to over-express Pol ε in S. cerevisiae for several reasons. Earlier attempts to

over-express Pol ε in a baculovirus-system experienced several problems (19;25). Not

only was the largest subunit of 256 kDa expressed at low levels, but in addition Pol2p

was cleaved by a protease and the proteolytic fragment copurified with the

holoenzyme. Finally the purified protein was tagged and this could affect the

properties of the enzyme. We chose to over-express Pol ε in S. cerevisiae without any

tags added, similar to earlier over-expression studies of Pol δ from S. cerevisiae (18).

The POL2 gene was subcloned into one plasmid and DPB2, DPB3, and DPB4 were

subcloned into the second plasmid. All genes were cloned under the control of the

galactose-inducible GAL1-10 promoter (21). This protocol proved successful and

allowed us to purify 400 µg of Pol ε from as little as 70 g of cells. The complex was

purified by successive phosphocellulose, MonoQ, and MonoS chromatography, and

the enzyme was finally purified to homogeneity by gel filtration column (Fig 1) or by

glycerol gradient centrifugation.

Our over-expressed Pol ε was purified as a four-subunit complex with all subunits co-

migrating through a glycerol gradient and co-eluting from a Superose6 column (Fig

2B and Fig 3B). The peak fractions from the gel filtration column and the glycerol

gradient were analyzed by 10% SDS-PAGE, the stained gels were scanned and the

intensity of the protein bands was quantified. The molar ratio of the four subunits was

estimated to be 1.00:1.12:1.07:1.06 (Pol2p:Dpb2p:Dpb3p:Dpb4p) (Fig 4). In contrast,

we found that the apparent molar ratio of the four subunits was approximately 1:1:3:4,

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

13

when the SDS-PAGE was silver-stained (data not shown). Earlier estimates of the

subunit stoichiometry have been based solely on silver-staining, and it appears that

the amounts of Dpb3p and Dbp4p may have been overestimated due to the silver-

staining (10;19).

The sedimentation coefficient for Pol ε was determined to be 11.9 S (Fig 2). Using an

antibody to Dpb4p we measured the sedimentation coefficient of Pol ε, when a crude

extract from a wild-type strain was separated over the same glycerol gradient. The

sedimentation of Pol ε in a crude extract was similar to that of the purified Pol ε (data

not shown).

Pol ε was analyzed on a Superose6 gel filtration column (Fig 3). The enzyme was

injected over the column in the concentration range between 5 nM and 0.5 µM (as

monomer) and the elution volume was 13.8 ml over the entire concentration range.

The Stokes radius was determined to be 74.5 Å from the standard curve. The

measured Stokes radius and the sedimentation coefficient allowed us to estimate the

Mr, according to Siegel and Monty (26). Our calculated Mr of 371 kDa suggests that

Pol ε is purified as a monomer of a Pol2:Dpb2:Dpb3:Dpb4 complex with the molar

ratio of 1:1:1:1 in the concentration range studied (Table I). The frictional coefficient

f/fo of Pol ε is 1.56, suggesting a moderately elongated shape of the enzyme.

Sedimentation equilibrium experiment. To obtain a more precise molecular mass

independent of the shape of the enzyme, we carried out sedimentation equilibrium

ultracentrifugation. Three different starting concentrations of Pol ε ranging from 0.14

µM to 2.1 µM were analyzed at four different speeds until equilibrium was reached.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

14

The molecular weight of Pol ε was determined to be 366 kDa under these conditions.

A comparison with the predicted distribution of a monomeric versus a dimeric

assembly clearly showed that Pol ε was present as a monomer in the solution under all

conditions investigated (Fig 5).

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

15

DISCUSSION

We have presented a method to over-express and purify Pol ε to homogeneity from S.

cerevisiae. The yield and purity of the enzyme will allow us to perform a careful

characterization of the enzyme. We have initiated this study by determining the

molecular weight and subunit stoichiometry of the enzyme. These are essential

parameters for further studies of the enzyme. From these studies and recent studies of

Pol δ we can conclude that, at least under the conditions studied, both enzymes are

monomeric multi-subunit assemblies with each subunit occurring once.

An attractive model of the replication fork describes how there should be coupling of

leading and lagging strand synthesis. This is a model that has emerged from studies in

E. coli (15;16). It is very likely that a similar mechanism is present at the eukaryotic

replication fork. Initial experiments with Pol δ suggested that Pol δ was a dimeric

enzyme (17;27). A model was proposed in which Pol δ formed a dimeric unit with

two catalytic domains. In this model Pol δ would replicate both leading and lagging

strand in a coordinated manner (13). This model has recently been questioned and it

has been shown that Pol δ is a monomer with one catalytic site (18;28). Meanwhile,

Pol ε was also suggested to be dimeric (19). The evidence for a dimeric enzyme

originated from yeast two-hybrid assays and gel filtration experiments (9;19). Yeast

two-hybrid assays, particularly with yeast genes, can be misleading because false

positives can result from a bridging interaction through a third yeast protein, as for

instance was observed with the third subunit of Pol δ. Pol32 appeared to interact with

itself in a two-hybrid analysis, but this interaction was actually mediated by PCNA

(18;29). A second line of evidence for a dimeric Pol ε was based upon gel filtration

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

16

experiments (19). The calculated molecular weight of the protein was based upon the

assumption that Pol ε was globular. We have measured both the sedimentation

coefficient and the Stokes radius of Pol ε and from those data calculated the frictional

coefficient to be 1.56 (Table I), indicating that the complex is slightly elongated. As a

consequence, the molecular weight will be overestimated when determined by gel-

filtration only (19). The calculated molecular weight of 371 kDa from both gel

filtration and density centrifugation measurements agrees well with the theoretical

molecular weight of a four subunit complex with the subunit stoichiometry of 1:1:1:1

(Table I). Finally, the sedimentation equilibrium experiments confirmed the results of

our other studies where Pol ε was found to exist as a monomer in solution (Fig 5 and

Table I). Thus, our results clearly support a model of Pol ε as a monomer of a

(Pol2:Dpb2:Dpb3:Dpb4) heterotetrameric complex.

The role of Pol ε and Pol δ at the eukaryotic replication fork is still not known with

certainty. Genetic experiments in S. cerevisiae have shown that there is an asymmetry

present at the replication fork (30). The current hypothesis that the coupled synthesis

of the leading and lagging strand involves both Pol ε and Pol δ agrees with our

observations that both Pol δ and Pol ε are monomeric assemblies. Pol δ has been

suggested to replicate the lagging strand, based on a genetic interaction with the flap

endonuclease (RAD27) (31). Pol ε has been suggested to replicate the leading strand,

based on experiments in cell free Xenopus extracts (6). However, the fact that both

Pol δ and Pol ε are purified as monomers in solution does not exclude the possibility

that they dimerize in the presence of a template. The yeast two-hybrid result

indicating that Dpb2p may interact with itself may suggest that Pol ε could be present

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

17

as a dimer in vivo (19). More experiments are required in order to determine which

strands Pol ε and Pol δ do replicate.

We are now in a position to study the various activities of Pol ε using a well-defined

source of the enzyme. These studies may help us understand the role of Pol ε during

DNA replication and DNA repair.

ACKNOWLEDGEMENTS

We thank P. Burgers for comments on the manuscript and providing the prs421-

424GAL plasmids and pY116 strain.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

18

Reference List

1. Waga, S. and Stillman, B. (1998) Annu.Rev.Biochem. 67, 721-751

2. Aparicio, O. M., Weinstein, D. M., and Bell, S. P. (1997) Cell 91, 59-69

3. Shcherbakova, P. V. and Pavlov, Y. I. (1996) Genetics 142, 717-726

4. Karthikeyan, R., Vonarx, E. J., Straffon, A. F. L., Simon, M., Faye, G., and Kunz, B. A. (2000) Journal of Molecular Biology 299, 405-419

5. Morrison, A. and Sugino, A. (1994) Mol.Gen.Genet. 242, 289-296

6. Waga, S., Masuda, T., Takisawa, H., and Sugino, A. (2001) PNAS 98, 4978-4983

7. Kesti, T., Flick, K., Keranen, S., Syvaoja, J. E., and Wittenberg, C. (1999) Mol.Cell 3, 679-685

8. Navas, T. A., Zhou, Z., and Elledge, S. J. (1995) Cell 80, 29-39

9. Dua, R., Levy, D. L., and Campbell, J. L. (1999) J.Biol.Chem. 274, 22283-22288

10. Hamatake, R. K., Hasegawa, H., Clark, A. B., Bebenek, K., Kunkel, T. A., and Sugino, A. (1990) J.Biol.Chem. 265, 4072-4083

11. Liu, W. and Linn, S. (2000) Nucleic Acids Res. 28, 4180-4188

12. Falaschi, A. (2000) Trends Genet. 16, 88-92

13. Burgers, P. M. (1998) Chromosoma 107, 218-227

14. Kawasaki, Y. and Sugino, A. (2001) Mol.Cells 12, 277-285

15. Glover, B. P. and McHenry, C. S. (2001) Cell 105, 925-934

16. Yuzhakov, A., Turner, J., and O'Donnell, M. (1996) Cell 86, 877-886

17. Burgers, P. M. and Gerik, K. J. (1998) J.Biol.Chem. 273, 19756-19762

18. Johansson, E., Majka, J., and Burgers, P. M. (2001) J.Biol.Chem. 276, 43824-43828

19. Dua, R., Edwards, S., Levy, D. L., and Campbell, J. L. (2000) J.Biol.Chem. 275, 28816-28825

20. Araki, H., Ropp, P. A., Johnson, A. L., Johnston, L. H., Morrison, A., and Sugino, A. (1992) EMBO J. 11, 733-740

21. Burgers, P. M. (1999) Methods 18, 349-355

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

19

22. Bradford, M. M. (1976) Anal.Biochem. 72, 248-254

23. Chance, B. and Herbert, D. (1950) Biochem.J. 46, 402-414

24. Burgers, P. M. (1995) Methods Enzymol. 262, 49-62

25. Dua, R., Levy, D. L., Li, C. M., Snow, P. M., and Campbell, J. L. (2002) J.Biol.Chem. 277, 7889-7896

26. Siegel, L. M. and Monty, K. J. (1966) Biochim.Biophys.Acta 112, 346-362

27. Zuo, S., Bermudez, V., Zhang, G., Kelman, Z., and Hurwitz, J. (2000) J.Biol.Chem. 275, 5153-5162

28. Bermudez, V. P., MacNeill, S. A., Tappin, I., and Hurwitz, J. (2002) J.Biol.Chem. 277, 36853-36862

29. Gerik, K. J., Li, X., Pautz, A., and Burgers, P. M. (1998) J.Biol.Chem. 273, 19747-19755

30. Pavlov, Y. I., Newlon, C. S., and Kunkel, T. A. (2002) Mol.Cell 10, 207-213

31. Jin, Y. H., Obert, R., Burgers, P. M., Kunkel, T. A., Resnick, M. A., and Gordenin, D. A. (2001) Proc.Natl.Acad.Sci.U.S.A 98, 5122-5127

FOOTNOTES

1The abbreviations used are: Pol ε, DNA polymerase ε; Pol δ, DNA polymerase δ; PCNA, proliferating cell nuclear antigen.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

20

LEGENDS TO FIGURES

Fig 1. Over-expressed Pol ε was purified to homogeneity. 1 µg of Pol ε from the

Superose6 column was loaded on a 4-20% linear gradient SDS-polyacrylamide gel.

The proteins were visualized by colloidal Coomassie-staining.

Fig 2. Glycerol gradient centrifugation A. Gradient calibration was carried out with

ferritin (data point 1, 17.6 S), catalase (data point 2, 11.3 S), aldolase (data point 3,

8.9 S), bovine serum albumin (data point 4, 4.3 S), and carbonic anhydrase (data

point 5, 2.8 S). The sedimentation positions of the complexes are as indicated. The

estimated sedimentation coefficient of Pol ε was 11.88 S +0.84 S. The sedimentation

coefficient of Pol ε was measured over a concentration range from 5 nM to 0.5 µM

(as monomer), with no observed shift in S value. B. Fractions containing Pol ε were

analyzed on a 10% SDS-PAGE and visualized with colloidal Coomassie-staining.

Catalase was added as an internal standard before loading the sample and the catalase

activity was measured in a colorimetric assay. The peak fraction containing catalase

activity has been indicated with catalase. The contrast of the shown gel was enhanced

to visualize Dpb3 and Dpb4.

Fig 3. Gelfiltration. A. The calibration of the Superose6 column was carried out with

thyroglobulin (data point 1, 85 Å), β-galactosidase (data point 2, 69 Å), ferritin (data

point 3, 61 Å), catalase (data point 4, 52.2 Å) bovine serum albumin (data point 4,

35.5 Å), and carbonic anhydrase (data point 5, 23.9 Å). The elution volumes of the

complexes are as indicated. Pol ε eluted at 13.8 ml and the Stokes radius was

estimated to be 74.5 Å +2.4 Å. B. Fractions containing Pol ε were analyzed on a 10%

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

21

SDS-PAGE and visualized with colloidal Coomassie-staining. The contrast of the

shown gel was enhanced to visualize Dpb3 and Dpb4.

Fig 4. Subunit stoichiometry of Pol ε. Peak fractions from the Superose6 column were

separated on a 10% SDS-PAGE and stained with colloidal Coomassie. The gel was

digitized with a CanonFB1210U scanner and the lanes were scanned and quantified

using NIH Image software. The molar ratio of the subunits was

Pol2p:Dpb2p:Dpb3p:Dpb4p = 1:1.12:1.07:1.06.

Fig 5. Sedimentation equilibrium experiment. Pol ε with a starting concentration of

2.1 µM was centrifuged at three consecutive speeds, beginning with 4000 rpm. The

theoretical curves for the monomeric and dimeric species are calculated based upon

the polypeptide sequence.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

22

Table I. Molecular weight of DNA polymerase ε. Mr values in kDa and Stokes radii in Å. Theoretical Mr values were calculated from the polypeptide sequences; Mr and f/fo from S and Å was obtained from (26); Mr from equilibrium sedimentation centrifugation was calculated with the Beckman software package. Indicated errors in the calculated Mr reflect measurement errors only. See text for details. Theoretical Mr for S value Stokes Mr from f/f0 Mr from monomer dimer radius S and Å equil. sed. Pol ε 379 758 11.88 +0.84 74.5 +2.4 371 +38 1.56 366 +7

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

Pol2p Dpb2p Dpb3p Dpb4p

Fig4R

elat

ive

Inte

nsity

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

Abs

orba

nce

(280

nm

)

Radius (mm)

Fig 5

6.3 6.4 6.5 6.6

1.0

1.5

2.5

0.5

2.0

0.5

2.0

3.0

6.3 6.4 6.5 6.6

1.0

1.5

2.5

3.5

3.5

6.3 6.4 6.5 6.6

0.5

1.0

1.5

2.0

2.5

3.0

Monomer

Dimer

7500 rpm

5500 rpm

4000 rpm

Monomer

Dimer

Monomer

Dimer

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

Olga Chilkova, Bengt-Harald Jonsson and Erik JohanssonALIGN="BASELINE" ALT="epsilon "> from S. cerevisiae

The quarternary structure of DNA polymerase <IMG SRC="/math/epsilon.gif"

published online February 5, 2003J. Biol. Chem. 

  10.1074/jbc.M211818200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from