Targeted MIP-3β plasmid nanoparticles induce dendritic cell maturation and

inhibit M2 macrophage polarisation to suppress cancer growth

Yihong He1,*, Manni Wang1,*, Xiaoling Li1,*, Ting Yu1,2*, Xiang Gao1,#

1Department of Neurosurgery and Institute of Neurosurgery, State Key Laboratory of

Biotherapy West China Hospital, West China Medical School, Sichuan University and

Collaborative Innovation Center for Biotherapy, Chengdu, 610041, PR China.

2Department of Pathology and Laboratory of Pathology, State Key Laboratory of

Biotherapy, West China Hospital, West China School of Medicine, Sichuan University

*These authors are considered equal first authors.

*These authors are considered equal first authors.#Correspondence: Xiang Gao

Tel +86 28 8542 2136

Fax +86 28 8550 2796

Email: xiangxianggao2008@163.com or xianggao@scu.edu.cn

Supplementary Methods

1. MTT assay

The cell viability of lymphocytes or 4T1 cells were measured by MTT assay. After

being seeded in 96-wells and demonstrating with corresponding treatments, each well

was added with 5 mg/ml MTT solution and incubated at a 37°C incubator with the

presence of 5% CO2 for 3 hours. Considering the non-adherent characteristics of

lymphocytes, the lymphocytes were then centrifuged at 3000 rpm for 10 minutes.

After discarding the supernatant, each well was added with 150 μl of DMSO

(Sigma-Aldrich, USA). Immediately, the plates were gently shaken for 10 minutes to

fully dissolve the formazan crystal. Finally, the absorbance values were measured by a

microplate reader (OPTImax, Molecular Dynamics) at 570 nm. Experiments were

repeated at least three times.

2. Wester Bloting

FR-negative 4T1 cells was obtained by the CRISPR-Cas9 technology. Western blot

analysis was conducted for the detection of the FR expression. The wild-type and

FR-negative 4T1 cells were harvested and washed in 4℃ pre-cooling PBS. Then the

cells were lysed on ice in RIPA buffer (Beyotime, China) containing protease inhibitor

cocktail (Biotool, China) for 30 minutes, and centrifuged at 12000 rpm for 15 minutes

at 4℃. The supernatants were collected as total protein of cells. The same amount of

total protein from each group was fractionated by a 12.5% SDS-PAGE (Baihe Science

& Technology Co., Ltd., Chengdu, China ). Then, the samples on the gel were

transferred to a nitrocellulose membrane (Merk Millipore, Germany), following by

incubated with primary antibodies. The membrane were reacted with IRDye 800CW

goat anti-mouse (LI-COR, USA). Finally, the membrane were visualized by Odyssey

CLx Infrared imaging system (LI-COR, USA).

3. Isolation of primary mouse lymphocytes

(1) Euthanize experimental mouse (4-6 weeks old) by cervical dislocation. Dip the

entire mouse into 70% ethanol for 5 minutes.

(2) Remove the spleen aseptically through an abdominal incision, and place it in a

sterile petridishes containing ice-cold RPMI 1640 medium.

(3) The single-cell suspensions of lymphocytes were prepared by gently disrupting

the spleen on a sterile mesh (BD Cell strainer, 70 m).

(4) Transfer the cell suspension to a 15 ml BD tube and wash the cell strainer mesh

with the lymphocyte separation medium (Dakewe, China) to collect the

remaining cells.

(5) Add 1 ml of RPMI 1640 medium into this tube, and spin down at 800 g for 30

minutes at 4°C. Collect the suspension from middle layer in a new tube add 10 ml

of antibiotic-free/ serum-free RPMI 1640 medium. Spin down at 300 g for 10

minutes at 4°C.

(6) The red blood cells (RBCs) obtained were lysed by using the ACK

(ammonium-chloride-potassium) lysis buffer (10 ml) for 5 minutes and then

washed with RPMI 1640 medium at 1500 rpm for 5 minutes at 4°C.

(7) Plant the cells obtained above in corresponding plates and the Brefeldin A (BFA)

were added into the culture medium 6 hours before the use of lymphocytes.

4. Isolation of primary mouse bone marrow DCs (BMDCs)

(1) Euthanize mouse (4–6 weeks old) by cervical dislocation. Dip the entire mouse

into 70% ethanol for 5 minutes. Cut the hind leg just above the pelvic/hip joint by

using sharp and sterile dissecting scissors and remove the extra tissue and

muscles by rubbing with KimwipesTM, ensuring that the bones remains intact.

Soak the intact femur and fibula into 70% ethanol for 5-10 seconds to sterilize

their exteriors. Transfer the bones to antibiotic-free/serum-free medium in a

sterile petridish for rinsing off ethanol. Cut both ends of bones carefully with

scissors to expose the interior marrow shaft. Flush the contents of bone marrow

with antibiotic-free/serum-free medium (ice-cold) by using a 1 ml syringe. Flush

2-3 times until the bones become completely white and collect the contents into a

sterile centrifuge tube.

(2) Centrifuge the cell suspension at 1500 rpm for 3 minutes. Resuspend the cells

with 10 ml RBC lysis buffer. Incubate the lysis reaction for 5 minutes and spin

down at 1500 rpm for 5 minutes at 4°C. Resuspending the cells gently with DC

culture medium (RPMI 1640 containing 10% FBS, with the addition of 20 ng/ml

GM-CSF, 2.5 mM β-mercaptoethanol and 1 mM sodium pyruvate). Count the

total number of cell suspension and make the final cell density of 5 × 106 cells per

10 ml medium.

(3) Add 10 ml of cell suspension into each petridish. Incubate the cultures at 37°C,

5% CO2 and 95% humidity in a CO2 incubator further for another 3 days.

(4) Replenishing of culture with 10 ml fresh DCs culture medium into each petridish

with BMDCs (Day 4), to make the total volume in each petridish is 20 ml.

(5) Harvest primary BMDCs from each petridish by collecting non-adherent cells by

gently pipeting them with culture medium. Centrifuging the cell suspension and

resuspending the cell pellet in culture medium (RPMI 1640 + 10% FBS + 20 mM

penicillin/streptomycin) for subsequent use.

5. Isolation of primary mouse peritoneal macrophages

(1) Euthanize the mouse (4-6 weeks old) by cervical dislocation. Position the entire

mouse into 70% ethanol for 5 minutes for disinfection.

(2) Clean the skin of abdomen with sterile normal saline (NS).

(3) Insert the needle through peritoneal wall along with the left sides of mouse, and

inject 5 ml of cold sterile NS into the peritoneal cavity using a beveled end of a

20G needle. Gently massage the peritoneum for 2-3 minutes to dislodge any

attached cells into the NS solution.

(4) Separate the abdominal skin manually to expose the intact peritoneal wall, and

use the same syringe and needle to aspirate fluid from peritoneum slowly.

(5) Deposit the collected cell suspension in tubes kept on ice after carefully removing

the needle from the syringe.

(6) Spin the collected cell suspension at 4℃, 1000 rpm for 10 minutes, discard the

supernatant.

(7) Resuspend cell pellet in DMEM medium (10% FBS + 20 mM

penicillin/streptomycin) to achieve the final cell density of 5 × 106 cells/petridish.

(8) Incubate in 37°C, 5% CO2 incubator for 3 hours. Wash petridish with DMEM

medium to wash off non-adherent cells. Then, the adherent macropages can be

used for following experiments.

6. Construction of M-FOLR1 knock-out cell lines (FR-negative 4T1 cells)

SgRNAs of M-FOLR1-targeting CRISPR/Cas9 vector were designed and constructed

by an online CRISPR design tool (http://crispr.mit.edu). The vector Lenti-crisprV2

was digested by BsmBI. Then two pairs of annealed oligos were ligated to the

prepared vector and the oligo-vector (SgRNA-Lenti-crisprV2) was generated. To

transfect of 293T cells, Lenti-crisprV2, psPAX2 and pMD2.G were used by 10μg, 5μg

and 7.5 μg in the 100mm dish with lipo2000. After 72 hours, supernate was collected

with target cells cultured in. To get the single clone cell, puromycin (0.5 μg/ml) was

used for 2 days and cells left were selected by limited dilution method. Target cells

were collected and reseeded in 6-well, then a part of cells were collected for Western

blot test. SgRNA sequence used in this protocol were as follows:

M-FOLR1-ologo1CACCGGACAATTTACACGACCAGGTAAACACCTGGTCGTGTAAATTGTCC

M-FOLR1-oligo2CACCGAGTTCGGGGAACACTCATAAAACTATGAGTGTTCCCCGAACTC

M-FOLR1-oligo3CACCGCCAGTTGAACCGGTACAGGTAAACACCTGTACCGGTTCAACTGGC

Supplementary Figure 1. Synthesis and structural identification of

FA-PEG-PCL. (A) 1H-NMR and (B) FTIR were performed to study the chemical

structure of the obtained polymers. (C) UV-VIS absorption spectroscopy of the

samples was recorded to identify whether the polymers were correctly connected or

not.

Supplementary Figure 2. Synthesis and structural identification of MPEG-PLA.

1H-NMR and FTIR were performed to study the chemical structure of obtained

MPEG-PLA.

Supplementary Figure 3. Interaction modes between FA-PEG-PCL copolymer

and DOTAP revealed by Langevin dynamics simulation in water. (A) Initial

conformation of FA-PEG-PCL copolymer complexed with DOTAP. Conformations

(B), (C), (D), (E), and (F) correspond to snapshots of complex collected at 100, 200,

300, 400, and 500 ps, respectively. Copolymer FA-PEG-PCL is represented by a thin

line. DOTAP is depicted by a thick line, and its carbon atoms are coloured green. Two

terminal heavy atoms in the FA-PEG-PCL copolymer are highlighted using the “ball”

style.

Supplementary Figure 4. Transport tracing test. Fluorescence immunostaining of

4T1 cells, photographed by laser scanning confocal microscopy. (A) Fluorescence

images of 4T1 stained with YOYO-1, Lyso-tracker, and Hoechst after 0.5, 1, and 3

hours. (B) Three-dimensional structure of 4T1 cells dyed after 3 hours. The analysis

of fluorescence intensity indicates that the YOYO-1-stained MIP-3β had been

transported into the nuclei of 4T1 cells.

Supplementary Figure 5. FR-Negative 4T1 cells attenuated the transfection

efficancy of FDMCA. (A) Western Blot of FR in 4T1 cells; (B) and (C) Transfection

of DMCA and FDMCA in FR-negative 4T1 cells, detecting by flow cytometry (n =

3).

Supplementary Figure 6. The transfection of MIP-3β had no obvious effect on

the cell activity of 4T1 cells. 4T1 cell were transfected with GS, FDMCA,

FDMCA-pVax or FDMCA-MIP-3β, and the cell activity after 24 hours (A), 48 hours

(B) and 72 hours (C) of transfection were measured by MTT assay.

Supplementary Figure 7. Measurement of T-cell activation in vitro. After being

transfected with GS, FDMCA, FDMCA-pVax, DMCA-pMIP-3β and

FDMCA-pMIP-3β for 72 hours, the supernatants of 4T1 cells were collected and used

to stimulate T lymphocytes from spleen of mice. (A) Subsets of CD8+CD69+ cells; (B)

Subsets of CD4+CD69+ cells. They were analysed by flow cytometry. Results

indicated the stimulation of secreted MIP-3β protein from the supernatants could

induce the activation of T cells.

Supplementary Figure 8. Maturation phenomenon of DCs in vitro. After being

transfected with GS, FDMCA, FDMCA-pVax, DMCA-pMIP-3β, or

FDMCA-pMIP-3β for 72 hours, the supernatants of 4T1 cells were harvested and then

added into the culture system of bone marrow derived DCs. After being stimulated for

24 hours, DCs were stained with CD11c MHCII A), CD86 B), and CD80 C), and

analyzed by flow cytometry. Results showed the stimulation of secreted MIP-3β

protein from the supernatants could induce the maturation of DCs.

Supplementary Figure 9. Polarisation phenomenon of macrophages in vitro. After

being transfected with GS, FDMCA, FDMCA-pVax, DMCA-pMIP-3β, or

FDMCA-pMIP-3β for 72 hours, the supernatants of 4T1 cells were harvested and then

added into the culture medium of peritoneal derived macrophage cells. After the 24

hours stimulation of supernatants, macrophages were collected and stained with CD45,

CD206, F4/80, and CD11b, and then analyzed by flow cytometry. Results indicated

the stimulation of secreted MIP-3β protein from the supernatants could inhibit the

polarisation into M2 phenotypes of macrophages.

Supplementary Figure 10. Cell activity test. (A) After being transfected with GS,

FDMCA, FDMCA-pVax, DMCA-MIP-3β, or FDMCA-MIP-3β, the supernatants of

4T1 cells from each group were collected and used to stimulate lymphocytes. The cell

activity of lymphocytes were measured by MTT after 24 hours stimulation. (B) 4T1

cells were treated with the supernatant of lymphocytes, which had been treated with

the supernatant of GS, FDMCA, FDMCA-pVax, DMCA-MIP-3β, or

FDMCA-MIP-3β from 4T1 cells in vitro for 24 hours. After 24 hours treatment, the

cell viability of 4T1 cells was measured by MTT.

Supplementary Figure 11. Measurement of IFN-γ and TNF-α by ELISA. After

being transfected with GS, FDMCA, FDMCA-pVax, DMCA-MIP-3β, or

FDMA-MIP-3β, the supernatants of 4T1 cells were collected and used to stimulate

lymphocytes and macrophages for 24 hours. The secretions of IFN-γ and TNF-α in

the supernatants from lymphocytes (A) and macrophages (B) were measured by

ELISA.

Supplementary Figure 12. Gene expression in vivo. To identify whether the pDNA

delivered by DMCA or FDMCA could be expressed in vivo, the pDNA was tagged

with a luciferase reporter, and areas of luciferase activity were identified. Mice treated

with DMCA-pLuc or FDMCA-pLuc were injected intraperitoneally with D-Luciferin.

The bioluminescence imaging demonstrated robust fluorescence signals in mice

treated with FDMCA-pDNA, suggesting that pDNA delivered by FDMCA could be

successfully expressed. (A) Bio-imaging in vivo; (B) Fluorescence brightness in

tumors of different groups. *p < 0.05.

Supplementary Figure 13. Effects of FDMCA-pMIP-3β on pulmonary metastasis

model of breast cancer. Lungs were dissected after treatment of mice with

pulmonary metastasis with GS, FDMCA, FDMCA-pVax, DMCA-pMIP-3β or

FDMCA-pMIP-3β. (A) Body weight of different groups; (B) Representative photos of

lungs in each treatment group; (C) Number of pulmonary nodules; (D) Weight of

lungs; (E) Images of H&E staining. Pulmonary nodules and weight of

DMCA-pMIP-3β group were decreased when compared with other group and H&E

staining of FDMCA-pMIP-3β group showed fewest pulmonary lesions.

FDMCA-pMIP-3β decreased pulmonary metastasis of mice with breast cancer. Mean

± SEM, n = 6.

Supplementary Figure 14. Activation of CD4+ T-lymphocytes in vivo.

Lymphocytes were collected from the spleen of mice that were administered with the

treatment of GS, FDMCA, FDMCA-pVax, DMCA-pMIP-3β, or FDMCA-pMIP-3β.

The activation of CD4+ T-lymphocytes was measured by staining with CD4, CD69,

and INF-γ, and analysed by flow cytometry. In the group of mice treated with

DMCA-pMIP-3β or FDMCA-pMIP-3β, the percentage of IFN-γ-positive CD4+ T

cells was increased. (A) T-lymphocytes were stained with CD4 and CD69; (B)

T-lymphocytes were stained with CD4 and INF-γ.

Supplementary Figure 15. Activation of CD8+ T-lymphocytes in vivo. Treatment

with FDMCA-pMIP-3β inducing activation of CD8+ T-lymphocytes in vivo.

Lymphocytes were collected from the spleen of mice that were administered with GS,

FDMCA, FDMCA-pVax, DMCA-pMIP-3β, or FDMCA-pMIP-3β. CD8+

T-lymphocytes were stained with CD8, CD69, and INF-γ to assess their activation by

flow cytometry. In the groups of mice treated with DMCA-pMIP-3β and

FDMCA-pMIP-3β showed improved percentages of CD69-positive and

IFN-γ-positive cells, which indicated the expression of pMIP-3β could promote the

activation of CD8+ T-lymphocytes. (A) T-lymphocytes stained with CD8 and CD69;

(B) T-lymphocytes stained with CD8 and INF-γ.

Supplementary Figure 16. Anti-tumor mechanism of FDMCA-pMIP-3β. Effect of

FDMCA-pMIP-3β on tumor proliferation, angiogenesis, and apoptosis. (A) CD31

staining was applied in tumor tissue sections of different groups to analyse tumor

angiogenesis; (B) PCNA staining was performed in tumor tissue sections of different

groups to visualise tumor proliferation; (C) TUNEL staining was conducted in tumor

tissue sections of different groups to study tumor apoptosis. Mean ± SEM, n = 5; *p <

0.05, **p < 0.01.

Supplementary Figure 17. Serum biochemical analysis. Serum biochemical

analysis was used to investigate the safety of GS, FDMCA, FDMCA-pVax,

DMCA-pMIP-3β, and FDMCA-pMIP-3β in mice. We have measured the following

items: (A) ALB (albumin), ALP (alkaline phosphatase), ALT (glutamic-pyruvic

transaminase), AST (aspartate aminotransferase) and BUN (blood urea nitrogen); (B)

CHOL (cholesterol), CK (creatine kinase), CREA (creatinine), GLU (glucose) and

HDL (high density lipoprotein-cholesterol); (C) LDH (lactate dehydrogenase), LDL

(low density lipoprotein-cholesterol), TBIL (total bilirubin), TG (Triglyceride) and TP

(total protein); (D) XAMY (amylase) and UA (uric acid). Results showed no

significant difference has been observed in these indexes of different groups, which

demonstrated that our target treatment of FDMCA-pMIP-3β is relatively safe in vivo.

Supplementary Figure 18. Blood routine examination. Blood routine examination

of treated Balb/c mice, including (A) HGB, (B) PLT, (C) RBC and (D) WBC items.

Blood was obtained from mice treated with GS, FDMCA, FDMCA-pVax,

DMCA-MIP-3β, or FDMCA-MIP-3β by removing the eyeball. The quantities of HGB,

PLT, RBC, and WBC showed no obvious change, and all were in a normal range

among the five groups. Hence, the delivery of FDMCA-MIP-3β nanoparticles

exhibited no obvious haematologic toxicity. HGB: haemoglobin; PLT: platelet; RBC:

red blood cell; WBC: white blood cell.