science.sciencemag.org/cgi/content/full/science.abb3405/DC1

Supplementary Materials for

Crystal structure of SARS-CoV-2 main protease provides a basis for design of

improved α-ketoamide inhibitors

Linlin Zhang, Daizong Lin, Xinyuanyuan Sun, Ute Curth, Christian Drosten, Lucie Sauerhering, Stephan Becker, Katharina Rox, Rolf Hilgenfeld*

*Corresponding author. Email: rolf.hilgenfeld@uni-luebeck.de

Published 20 March 2020 on Science First Release DOI: 10.1126/science.abb3405

This PDF file includes: Materials and Methods Supplementary Text Scheme S1 Figs. S1 to S10 Tables S1 to S3 References

2

Materials & Methods

Recombinant protein production

A gene encoding SARS-CoV-2 Mpro (ORF1ab polyprotein residues 3264-3569, GenBank code:

MN908947.3) with Escherichia coli (E. coli) codon usage was synthesized by MWG Eurofins. The

synthesized gene was first amplified with the forward primer 5′-TCGGGGTTTCGCAAAAT-3′ and

the reverse primer 5′-CTGAAACGTGACACCGCTACA-3′. Subsequently, this PCR product was

employed as the template for the amplification of the target gene with primers (forward) 5′-

CGCGGATCCTCGGCAGTGCTGCAATCGGGGTTTCGCAAAAT-3′, and (reverse) 5′-

CCGCTCGAGTTAATGATGATGATGATGATGGGGTCCCTGAAACGTGACACCGCTACAC

T -3′ including the cleavage sites of restriction enzymes for cloning into the vector PGEX-6p-1 (GE

Healthcare). The amplified PCR product was digested with BamHI and XhoI and ligated into the

vector PGEX-6p-1 digested with the same restriction enzymes. At the N-terminus, the construct

designed for SARS-CoV-2 Mpro contains the Mpro cleavage-site (SAVLQ↓SGFRK; arrow indicates

the cleavage site) corresponding to the cleavage site between Nsp4 and Nsp5 in the polyprotein of

this virus. At the C-terminus, the construct codes for a modified PreScission cleavage site

(SGVTFQ↓GP; the six-residue sequence at the C-terminus of the SARS-CoV-2 Mpro was used as

P6-P1 for PreScission cleavage) connected to a His6-tag. An authentic N-terminus was generated

during gene expression by auto-cleavage of the Mpro itself, and the authentic C-terminus was

generated after the treatment with PreScission protease, similar to the approach described for SARS-

CoV Mpro in (20). The gene sequence of the Mpro was verified by sequencing at MWG Eurofins.

The sequence-verified SARS-CoV-2 Mpro construct was transformed into E. coli strain

BL21-Gold (DE3) (Novagen). Transformed clones were pre-cultured at 37°C in 50 mL 1 x YT

3

medium with ampicillin (100 μg/mL) for 3 h, and the incubated culture was inoculated into 4 L 1 x

YT medium supplied with 100 μg/mL ampicillin. 0.5 mM isopropyl-D-thiogalactoside (IPTG) was

added for induction of the overexpression of the Mpro gene at 37°C when the OD600 reached 0.8.

After 5 h, cells were harvested by centrifugation at 9954 x g, 4°C for 15 min. The pellets were

resuspended in 30 mL buffer A (20 mM Tris, 150 mM NaCl, pH 7.8; pH of all buffers was adjusted

at room temperature) and then lysed by sonication on ice. The lysate was clarified by

ultracentrifugation at 146,682 x g at 4°C for 1 h. The supernatant was loaded onto a HisTrap FF

column (GE Healthcare) equilibrated with buffer A. The HisTrap FF column was washed with 150

mL buffer A to remove unspecific binding proteins, followed by elution using buffer B (20 mM Tris,

150 mM NaCl, 500 mM imidazole, pH 7.8) with a linear gradient of imidazole ranging from 0 mM

to 500 mM, 20 column volumes. The fractions containing target protein were pooled and mixed

with PreScission protease at a molar ratio of 5:1 and dialyzed into buffer C (20 mM Tris, 150 mM

NaCl, 1 mM DTT, pH 7.8) at 4°C overnight, resulting in the target protein with authentic N- and C-

termini. The PreScission-treated Mpro was applied to connected GSTtrap FF (GE Healthcare) and

nickel columns to remove the GST-tagged PreScission protease, the His-tag, and protein with

uncleaved His-tag. The His-tag-free Mpro in the flow-through was subjected to buffer exchange with

buffer D (20 mM Tris, 1 mM DTT, pH 8.0) by using Amicon Ultra 15 centrifugal filters (10 kD,

Merck Millipore) at 2773 x g, and 4°C. The protein was loaded onto a HiTrap Q FF column (GE

Healthcare) equilibrated with buffer D for further purification. The column was eluted by buffer E

(20 mM Tris, 1 M NaCl, 1 mM DTT, pH 8.0) with a linear gradient ranging from 0 to 500 mM

NaCl (20 column volumes buffer). Fractions eluted from the Hitrap Q FF column containing the

target protein with high purity were pooled and subjected to buffer exchange (20 mM Tris, 150 mM

NaCl, 1 mM EDTA, 1 mM DTT, pH 7.8).

4

Cloning, gene expression, and protein purification of SARS-CoV Mpro was performed

according to (20) and (14).

Crystallization of the free SARS-CoV-2 Mpro

A freshly prepared protein solution at a concentration of 25 mg/mL was cleared by

centrifugation at 12,000 x g. Subsequently, a basic screen with the commercially available screening

kit PACT premierTM HT-96 (Molecular Dimensions) was performed by using a Gryphon LCP

crystallization robot (Art Robbins) employing the sitting-drop vapor-diffusion method at 18°C. 0.15

μL of protein solution and 0.15 μL of reservoir were mixed to equilibrate against 40 μL reservoir

solution. Crystals appeared overnight under several conditions, e.g. condition B5 (0.1 M MIB

(sodium malonate, imidazole, and boric acid in molar ratio 2:3:3), pH 8.0, 25% polyethylene glycol

(PEG) 1,500), condition D4 (0.1 M MMT (DL-malic acid, MES, and Tris base in molar ratio 1:2:2),

pH 7.0, 25% PEG 1,500), condition E9 (0.2 M potassium sodium tartrate tetrahydrate, 20% PEG

3,350), etc. Crystals were fished from the drops and cryo-protected by mother liquor plus varied

concentrations of glycerol (10%-20%). Subsequently, fished crystals were flash-cooled in liquid

nitrogen.

Crystallization of 13b in complex with SARS-CoV-2 Mpro

Freshly prepared protein (as described above) at a concentration of 25 mg/mL was mixed

with 13b (dissolved in 100% DMSO) at a molar ratio of 1:5. The mixture was incubated at 4°C

overnight. The next day, centrifugation was applied (12,000 x g) to remove the white precipitate.

Subsequently, the supernatant was subjected to crystallization screening using the same method as

5

described above for the crystallization of the free enzyme. A basic screen was applied by using three

commercially available kits: PEGRxTM 1 & 2 (Hampton Research), PACT premierTM HT-96

(Molecular Dimensions), and Morpheus HT-96 (Molecular Dimensions). Crystals appeared

overnight under conditions No. 45 (0.1 M bicine, pH 8.5, 20% PEG 10,000) of PEGRxTM 1 and No.

39 (10% PEG 200, 0.1 M bis-tris propane, pH 9.0, 18% PEG 8,000) of PEGRxTM 2, condition G9

(0.1 M Carboxylic acids (0.2 M sodium formate, 0.2 M ammonium acetate, 0.2 M sodium citrate

tribasic dihydrate, 0.2 M potassium sodium tartrate tetrahydrate, 0.2 M sodium oxamate), 0.1 M

buffer system 3 (1.0 M Tris, bicine, pH 8.5), pH 8.5, 30% precipitant mix 1 (20% v/v PEG 500

methyl ether, 10% PEG 20,000)) of Morpheus HT-96. Manual reproduction was performed by

mixing 0.5 μL of complex and 0.5 μL of reservoir, equilibrating against 40 μL of reservoir in a 96-

well plate under condition No. 45 of PEGRxTM 1 and No. 39 of PEGRxTM 2, No. G9 of Morpheus

HT-96, by using the sitting-drop vapor-diffusion method. Crystals appeared also overnight in the

manually reproduced drops. Crystals were fished from the reproduced condition-45 drop (cryo-

protectant: mother liquor plus 15% glycerol, and 5 mM 13b), the reproduced condition-39 drop

(cryo-protectant: mother liquor plus 5 mM 13b), and the original condition-G9 drop (cryo-

protectant: mother liquor plus 5 mM 13b). Subsequently, fished crystals were flash-cooled in liquid

nitrogen.

Diffraction data collection, phase determination, model building, and refinement

All diffraction data sets were collected using synchrotron radiation of wavelength 0.9184 Å

at beamline BL14.2 of BESSY (Berlin, Germany), using a Pilatus3S 2M detector (Dectris) (21). The

data set of the free SARS-CoV-2 Mpro was collected from a crystal grown under condition No. D4

of the PACT premierTM HT-96 in the basic screen 96-well plate. Two data sets of the SARS-CoV-2

6

Mpro in complex with 13b were collected from the crystals grown under condition No. 39 of

PEGRxTM 2 (manual optimization) and No. G9 of Morpheus HT-96, respectively. XDSapp (22),

Pointless (23, 24), and Scala (23) (the latter two from the CCP4 suite (25)) were used for processing

the datasets. The diffraction dataset of the free SARS-CoV-2 Mpro was processed at a resolution of

1.75 Å, in space group C2 (Table S2). For the complex of SARS-CoV-2 Mpro with 13b, the dataset

collected from a condition-39 crystal was processed at a resolution of 1.95 Å and in space group C2

(Table S2), whereas the dataset collected from a condition-G9 crystal extended to a Bragg spacing

of 2.20 Å, in space group P212121 (Table S2). All three structures were determined by molecular

replacement with the crystal structure of the free enzyme of the SARS-CoV Mpro (PDB entry 2BX4

(7)) as search model, using the Molrep program (25, 26). Jligand from the CCP4 suite (25, 27) was

employed for the generation of the geometric restraints for 13b, and the inhibitor was built into the

Fo-Fc density by using the Coot software (28). Refinement of the three structures was performed

with Refmac5 (25, 29). Statistics of diffraction data processing and the model refinement are given

in Table S2.

Enzyme kinetics of SARS-CoV-2 and SARS-CoV Mpro

A fluorescent substrate harboring the cleavage site (indicated by the arrow, ↓) of SARS-

CoV-2 Mpro (Dabcyl-KTSAVLQ↓SGFRKM-E(Edans)-NH2; GL Biochem) and buffer composed of

20 mM Tris, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, pH 7.3 was used for the inhibition assay. In

the fluorescence resonance energy transfer (FRET)-based cleavage assay (14), the fluorescence

signal of the Edans generated due to the cleavage of the substrate by the Mpro was monitored at an

emission wavelength of 460 nm with excitation at 360 nm, using a Flx800 fluorescence

spectrophotometer (BioTek). Initially, 2.5 µL of the SARS-CoV-2 or SARS-CoV Mpro at the final

7

concentration of 2.0 µM was pipetted into a 96-well plate containing pre-pipetted 22.5 µL reaction

buffer. Afterwards, the reaction was initiated by addition of 25 µL of the substrate dissolved in the

reaction buffer to 50 μL final volume, at different final concentrations varied from 5 to 640 μM (5,

10, 20, 40, 80, 160, 320, 640 μM). A calibration curve was generated by measurement of varied

concentrations (from 0.15 to 20 μM) of free Edans in a final volume of 50 μL reaction buffer. Initial

velocities were determined from the linear section of the curve, and the corresponding relative

fluorescence units per unit of time (ΔRFU/s) was converted to the amount of the cleaved substrate

per unit of time (μM/s) by fitting to the calibration curve of free Edans.

Inner-filter effect corrections were applied for the kinetic measurements according to (30).

The fluorescence of the substrate (in RFU) dissolved in 50 μL final volume of reaction buffer at the

corresponding concentrations used for the kinetic assay was measured and defined as f (substrate).

Afterwards, 1 μL free Edans was added (final concentration: 5 μM) to each well, and the

fluorescence reading was taken as f (substrate + Edans). Simultaneously, a reference value (in RFU)

was measured with the same concentration of free Edans in 50 μL of reaction buffer, giving f

(reference). The inner-filter correction at each substrate concentration was calculated according to

the function:

corr% = (f (substrate + Edans) – f (substrate)) / f (reference) x 100%

The corrected initial velocity of the reaction was calculated as

V = Vo / (corr%).

Vo represents the initial velocity of each reaction.

8

As saturation could be achieved, kinetic constants (Vmax and Km) were derived by fitting the

corrected initial velocity to the Michaelis-Menten equation, V = Vmax × [S] / (Km + [S]) using

GraphPad Prism 6.0 software. kcat/Km was calculated according to the equation, kcat/Km = Vmax / ([E]

x Km). Triplicate experiments were performed for each data point, and the value was presented as

mean ± standard deviation (SD).

Analytical ultracentrifugation

Sedimentation velocity experiments were carried out in a Beckman Coulter ProteomeLab

XL-I analytical ultracentrifuge at 42,000 rpm and 20°C using an An-50 Ti rotor. Concentration

profiles were measured with the absorption scanning optics at 230 nm using 3 or 12 mm standard

double-sector centerpieces filled with 100 µL or 400 µL sample, respectively. SARS-CoV-2 or

SARS-CoV Mpro was examined in a concentration range of 0.23 to 18.1 µM in a buffer containing

20 mM Tris, 150 mM NaCl, pH 7.3. Since in the observed monomer-dimer equilibrium, the peak

positions did not change with loading concentration, the reaction is slow on the time scale of

centrifugation (31) and the samples were allowed to equilibrate after dilution for about 23 hours at

room temperature. For data analysis, a model for diffusion-deconvoluted differential sedimentation

coefficient distributions (continuous c(s) distributions) implemented in the program SEDFIT (32)

was used. Partial specific volumes, buffer density and viscosity were calculated from amino-acid

and buffer composition, respectively, by the program SEDNTERP (33) and were used to correct

experimental s-values to s20,w.

9

Calculation of pocket volumes and preparation of structural figures

Binding-site (pocket) volumes were calculated by using UCSF Chimera (34). Structural

figures were prepared by using PyMol (Schrödinger LLC).

Inhibitor synthesis

Compound 11r was synthesized according to (6).

Scheme S1: Synthesis pathway to compounds 13a, 13b, 14b

Reaction conditions: (a) NaNO2, H2SO4, H2O; (b) SOCl2, MeOH; (c) Tf2O, 2,6-lutidine, CH2Cl2;

(d) NaH, THF; (e) LiOH, MeOH, H2O; (f) HOBt, EDCI, CH2Cl2; (g) NaBH4, MeOH; (h) DMP,

NaHCO3, CH2Cl2; (i) isocyanide, AcOH, CH2Cl2; (j) LiOH, MeOH, H2O; (k) DMP, NaHCO3,

CH2Cl2; (l) 4M HCl, EA.

10

General procedure. Reagents were purchased from commercial sources and used without

purification. HSGF 254 (0.15 - 0.2 mm thickness) was used for analytical thin-layer

chromatography (TLC). All products were characterized by their NMR and MS spectra. 1H NMR

spectra were recorded on 300-MHz instruments. Chemical shifts are reported in parts per million

(ppm, δ) down-field from tetramethylsilane. Proton coupling patterns are described as singlet (s),

doublet (d), triplet (t), multiplet (m), and broad (br). Optical rotation was recorded by using a WZZ-

2S polarimeter (Shanghai Precision Instruments). Mass spectra were recorded using an ESI ion-trap

HCT Ultra (Bruker). HPLC spectra were recorded by an LC20A (Shimadzu Corporation) with

Shim-pack GIST C18 (5 µm, 4.6 x 150 mm) with three solvent systems (methanol/water,

methanol/0.1% HCOOH in water or methanol/0.1% ammonia in water). Purity was determined by

reversed-phase HPLC and was ≥95% for 13a, 13b and 14b.

Synthesis of compound 1

A solution of (R)-2-amino-3-cyclohexylpropanoic acid (7.74 mmol) or (R)-2-amino-3-

cyclopropylpropanoic acid in 2N H2SO4 (15 mL) was stirred at 0oC. Then, NaNO2 (5.34 g, 77.4

mmol) in H2O (6 mL) was added dropwise to the reaction. The mixture was stirred for 3 h at 0oC

and then allowed to warm to 20oC and stirred at 20oC for 16 h. The mixture was extracted with

MTBE (50 mL). The combined organic phase was dried over anhydrous Na2SO4 and concentrated

under vacuum to give compound 1 (as a colorless oil, 50-75% yield) without further purification.

11

Synthesis of compound 2

SOCl2 (0.8 mL, 11.34 mmol) was added dropwise to the solution of compound 1 (5.72 mmol)

in MeOH (20 mL) at 0oC. Then the mixture was stirred for 1.5 h at 20oC. The mixture was

evaporated in vacuum and purified by chromatography on silica gel (PE/EA = 1/1) to give

compound 2 (as colorless oil, 30-59 % yield).

Methyl (R)-3-cyclohexyl-2-hydroxypropanoate 2a:

1H NMR (300 MHz, CDCl3) δ 4.39-4.34 (m, 1H), 3.82 (s, 3H), 1.82-1.48 (m, 8H), 1.29-1.12 (m,

4H), 1.00-0.85 (m, 2H).

Methyl (R)-3-cyclopropyl-2-hydroxypropanoate 2b:

1H NMR (300 MHz, CDCl3) δ 4.35 (dd, J1 = 9.0 Hz, J2 = 4.2 Hz, 1H), 3.80 (s, 3H), 1.81-1.72 (m,

2H), 0.92-0.68 (m, 1H), 0.50-0.43 (m, 2H), 0.15-0.05 (m, 2H).

Synthesis of compound 3

Compound 2 (5.32 mmol) was dissolved in DCM (10 mL) and cooled to 0oC. 2,6-lutidine (1.5

mL, 13.26 mmol) and Tf2O (3.3 g, 11.87 mmol) were added successively. The mixture was stirred

for 30 min at 0oC. The mixture was extracted with MTBE after washing with a mixture of brine and

1N HCl (3:1 v/v), then dried over anhydrous Na2SO4, and evaporated to give compound 3 (as a

brown oil, yield 82%) without further purification.

12

Synthesis of compound 5

Tert-butyl (2-oxo-1,2-dihydropyridin-3-yl)carbamate (379 mg, 1.8 mmol) was dissolved in

THF (15 mL). NaH (115 mg, 2.80 mmol, 60% in oil) was added at 0oC and then stirred for 30 min.

Then compound 3 (515 mg, 1.86 mmol) in THF (10 mL) was added. The mixture was stirred for 20

h at 25 oC. The mixture was evaporated in vacuum and purified by chromatography on silica gel (PE

to EA) to give compound 5 (56-60% yield) as light yellow solid.

Methyl (S)-2-(3-((tert-butoxycarbonyl)amino)-2-oxopyridin-1(2H)-yl)-3-cyclohexyl propanoate 5a:

1H NMR (300 MHz, DMSO-d6) δ 7.82-7.76 (m, 2H), 7.35 (dd, J1 = 7.5 Hz, J2 = 1.5 Hz, 1H), 6.30 (t,

J = 7.5 Hz, 1H), 5.35 (dd, J1 = 11.1 Hz, J2 = 4.5 Hz, 1H), 3.56 (s, 3H), 2.10-1.88 (m, 2H), 1.78-1.72

(m, 1H), 1.65-1.44 (m, 13H), 1.14-0.82 (m, 6H). ESI-MS (m/z): 379 [M + H]+.

Methyl (S)-2-(3-((tert-butoxycarbonyl)amino)-2-oxopyridin-1(2H)-yl)-3-cyclopropyl propanoate

5b:

1H NMR (300 MHz, DMSO-d6) δ 7.83-7.78 (m, 2H), 7.35 (dd, J1 = 7.2 Hz, J2 = 1.5 Hz, 1H), 6.30 (t,

J = 7.2 Hz, 1H), 5.36 (dd, J1 = 10.8 Hz, J2 = 4.5 Hz, 1H), 3.57 (s, 3H), 1.81-1.62 (m, 2H), 1.48 (s,

9H), 0.55-0.48 (m, 1H), 0.34-0.29 (m, 2H), 0.15-0.12 (m, 1H), 0.04-0.01 (m, 1H). ESI-MS (m/z):

337 [M + H]+.

Synthesis of compound 6

Compound 5 (1.65 mmol) was dissolved in MeOH (15 mL) and H2O (3 mL). LiOH.H2O (139

mg, 3.31 mmol) was added. The mixture was stirred at 20oC for 1 h. Then, the mixture was adjusted

to pH=6~7 with 1N HCl. Subsequently, the reaction was evaporated under vacuum and purified by

13

chromatography on silica gel (DCM/MeOH = 10/1) to give compound 6 (452 mg, 84% yield) as

light yellow solid.

(S)-2-(3-((tert-butoxycarbonyl)amino)-2-oxopyridin-1(2H)-yl)-3-cyclohexylpropanoic acid 6a:

1H NMR (300 MHz, DMSO-d6) δ 13.12 (s, 1H), 7.83-7.77 (m, 2H), 7.35 (dd, J1 = 7.2 Hz, J2 = 1.5

Hz, 1H), 6.30 (t, J = 7.2 Hz, 1H), 5.35 (dd, J1 = 10.8 Hz, J2 = 4.5 Hz, 1H), 2.10-1.92 (m, 2H), 1.78-

1.69 (m, 1H), 1.65-1.52 (m, 4H), 1.47 (s, 9H), 1.13-0.82 (m, 6H). ESI-MS (m/z): 365 [M + H]+.

(S)-2-(3-((tert-butoxycarbonyl)amino)-2-oxopyridin-1(2H)-yl)-3-cyclopropylpropanoic acid 6b:

1H NMR (300 MHz, DMSO-d6) δ 13.11(s, 1H), 7.81-7.77 (m, 2H), 7.36 (dd, J1 = 6.9 Hz, J2 = 1.5

Hz, 1H), 6.30 (t, J = 6.9 Hz, 1H), 5.35 (dd, J1 = 10.5 Hz, J2 = 4.5 Hz, 1H), 1.80-1.69 (m, 2H), 1.47

(s, 9H), 0.53-0.48 (m, 1H), 0.32-0.29 (m, 2H), 0.14-0.11 (m, 1H), 0.03-0.00 (m, 1H). [α]20D -22.4 (c

1.0 g/100 mL, MeOH), ESI-MS (m/z): 323 [M + H]+.

Synthesis of compound 7

Compound 7 was synthesized according to (35).

Synthesis of compound 8

HOBt (245 mg, 1.82 mmol) and EDCI (349 mg, 1.82 mmol) were added to the solution of

compound 6 (1.65 mmol) in DCM (20 mL). The mixture was stirred for 1 h at 0oC. Then compound

7, methyl (S)-2-amino-3-((S)-2-oxopyrrolidin-3-yl) propanoate (307 mg, 1.65 mmol), was added,

and the mixture was adjusted to pH = 9 with Et3N. The mixture was stirred at 0oC for 24 h. Then,

the reaction was concentrated and purified by chromatography on silica gel (DCM/MeOH=20/1) to

give compound 8 (59-67% yield) as light yellow solid.

14

Methyl (S)-2-((S)-2-(3-((tert-butoxycarbonyl)amino)-2-oxopyridin-1(2H)-yl)-3-cyclohexylpropan-

amido)-3-((S)-2-oxopyrrolidin-3-yl)propanoate 8a:

ESI-MS (m/z): 533 [M + H]+

Methyl (S)-2-((S)-2-(3-((tert-butoxycarbonyl)amino)-2-oxopyridin-1(2H)-yl)-3-cyclopropylpro-

panamido)-3-((S)-2-oxopyrrolidin-3-yl)propanoate 8b:

1H NMR (300 MHz, DMSO-d6) δ 9.00-8.92 (m, 1H), 7.81-7.77 (m, 2H), 7.37-7.34 (m, 1H), 6.30 (t,

J = 7.2 Hz, 1H), 5.77 (dd, J1 = 10.8 Hz, J2 = 4.5 Hz, 1H), 4.54-4.45 (m, 1H), 3.74 (s, 3H), 3.37-3.29

(m, 2H), 2.35-2.25 (m, 2H), 1.90-1.71 (m, 5H), 1.46 (s, 9H), 0.51-0.46 (m, 1H), 0.32-0.29 (m, 2H),

0.15-0.11 (m, 1H), 0.04-0.00 (m, 1H). ESI-MS (m/z): 491 [M + H]+.

Synthesis of compound 9

NaBH4 (200 mg, 5.3 mmol) was added to a solution of compound 8 (0.53 mmol) in MeOH (6

mL). The mixture was stirred at 25oC for 3 h. The reaction was concentrated and purified by

chromatography on silica gel (DCM/MeOH=10/1) to give compound 9 (49%, as off-white solid).

Tert-butyl (1-((S)-3-cyclohexyl-1-(((S)-1-hydroxy-3-((S)-2-oxopyrrolidin-3-yl)propanyl-2-)amino)

-1-oxopropan-2-yl)-2-oxo-1,2-dihydropyridin-3-yl)carbamate 9a:

ESI-MS (m/z): 505 [M + H]+.

Tert-butyl (1-((S)-3-cyclopropyl-1-(((S)-1-hydroxy-3-((S)-2-oxopyrrolidin-3-yl)propan-2-yl)ami-

no)-1-oxopropan-2-yl)-2-oxo-1,2-dihydropyridin-3-yl)carbamate 9b:

ESI-MS (m/z): 463 [M + H]+.

15

Synthesis of compound 10

Dess-Martin periodinane (116 mg, 0.27 mmol) and NaHCO3 (8 mg, 0.09 mmol) were added to

a solution of compound 9 (0.26 mmol) in DCM (15 mL). The mixture was stirred at 20oC for 1 h.

The reaction was concentrated and purified by chromatography on silica gel (DCM/MeOH=20/1) to

give compound 10 (83 - 90% yield) as off-white solid.

Tert-butyl (1-((S)-3-cyclohexyl-1-oxo-1-(((S)-1-oxo-3-((S)-2-oxopyrrolidin-3-yl)propan-2-yl)ami-

no)propan-2-yl)-2-oxo-1,2-dihydropyridin-3-yl)carbamate 10a:

ESI-MS (m/z): 503 [M + H]+.

Tert-butyl (1-((S)-3-cyclopropyl-1-oxo-1-(((S)-1-oxo-3-((S)-2-oxopyrrolidin-3-yl)-propan-2-yl)

amino)propan-2-yl)-2-oxo-1,2-dihydropyridin-3-yl)carbamate 10b:

1H NMR (300 MHz, DMSO-d6) δ 9.40 (d, J = 7.8 Hz, 1H), 8.97 (dd, J1 = 14.1 Hz, J2 = 7.2 Hz,

1H), 7.79-7.73 (m, 2H), 7.35-7.32 (m, 1H), 6.30 (t, J = 7.5 Hz, 1H), 5.69-5.62 (m, 1H), 4.48-4.42

(m, 1H), 3.20-3.10 (m, 2H), 2.32-2.15 (m, 2H), 1.88-1.66 (m, 5H), 1.46 (s, 9H), 0.55-0.47 (s, 1H),

0.36-0.29 (m, 2H), 0.14-0.11 (m, 1H), 0.04-0.00 (m, 1H). ESI-MS (m/z): 461 [M + H]+.

Synthesis of compound 11 (general method)

Acetic acid (26 mg, 0.44 mmol) and isocyanide (0.22 mmol) were added to the solution of

compound 10 (0.22 mmol) in DCM (15 mL). The mixture was stirred at 20oC for 24 h. The reaction

was concentrated and purified by chromatography on silica gel (DCM/MeOH=20/1) to give

compound 11 (57-65% yield) as off-white solid.

16

Synthesis of compound 12 (general method)

Compound 11 (0.13 mmol) was dissolved in MeOH (15 mL) and H2O (3 mL). LiOH.H2O (11

mg, 0.26 mmol) was added. The mixture was stirred at 20oC for 20 min. The mixture was adjusted

to pH=6~7 with 1N HCl. The reaction was concentrated and purified by chromatography on silica

gel (DCM/MeOH=10/1) to give compound 12 (90-95% yield) as off-white solid.

Synthesis of compound 13 (general method)

Compound 12 (0.115 mmol) was dissolved in DCM (15 mL). Dess-Martin periodinane (58 mg,

0.14 mmol) and NaHCO3 (4 mg, 0.05 mmol) were added. The mixture was stirred at 25oC for 1 h.

The reaction was concentrated and purified by chromatography on silica gel (DCM/MeOH=10/1) to

give compound 13 (69-80% yield) as off-white solid.

Tert-butyl (1-((S)-3-cyclohexyl-1-(((S)-4-(cyclopropylamino)-3,4-dioxo-1-((S)-2-oxopyrrolidin-3-

yl)butan-2-yl)amino)-1-oxopropan-2-yl)-2-oxo-1,2-dihydropyridin-3-yl)carbamate 13a:

1H NMR (300 MHz, CDCl3) δ 8.78-8.50 (m, 1H), 8.01-7.92 (m, 1H), 7.65 (d, J = 7.5 Hz, 1H),

7.10-6.90 (m, 2H), 6.35-6.14 (m, 2H), 5.85-5.75 (m, 1H), 5.25-5.10 (m, 1H), 3.24-3.13 (m, 2H),

2.75-2.71 (m, 1H), 2.49-2.20 (m, 1H), 2.10-1.81 (m, 3H) 1.80-1.52 (m, 7H), 1.50-1.46 (m, 10H),

1.25-1.01 (m, 4H), 1.00-0.73 (m, 4H), 0.56-0.51 (m, 2H). 13C NMR (300 MHz, DMSO-d6) δ 196.35,

178.43, 170.14, 162.35, 157.01, 152.67, 128.85, 128.35, 120.49, 105.46, 80.60, 54.66, 52.98, 39.91,

38.35, 34.06, 33.32, 31.85, 31.52, 28.37, 27.62, 26.39, 26.11, 25.89, 22.95, 5.87. [α]20D -36.4 (c 0.5

g/100 mL, MeOH), ESI-MS (m/z): 586 [M + H]+.

Tert-butyl (1-((S)-1-(((S)-4-(benzylamino)-3,4-dioxo-1-((S)-2-oxopyrrolidin-3-yl)-butan-2-yl)ami-

no)-3-cyclopropyl-1-oxopropan-2-yl)-2-oxo-1,2-dihydropyridin-3-yl)carbamate 13b:

17

1H NMR (300 MHz, DMSO-d6) δ 9.25 (d, J = 5.4 Hz, 1H), 9.00 (dd, J1 = 14.1 Hz, J2 = 7.2 Hz,

1H), 7.79-7.69 (m, 3H), 7.35-7.22 (m, 5H), 6.30-6.24 (m, 1H), 5.69-5.61 (m, 1H), 4.97 (s, br, 1H),

4.29 (s, 2H), 3.17-3.09 (m, 2H), 2.30-2.15 (m, 2H), 1.91-1.62 (m, 5H), 1.46 (s, 9H), 0.52-0.47 (m,

1H), 0.33-0.29 (m, 2H), 0.14-0.09 (m, 1H), 0.02- -0.01 (m, 1H). 13C NMR (300 MHz, DMSO-d6) δ

196.68, 178.45, 169.90, 161.22, 157.24, 152.67, 138.95, 129.24, 128.76, 128.58, 127.80, 127.44,

120.41, 105.37, 80.59, 58.30, 53.24, 42.52, 39.89, 38.28, 35.01, 31.61, 28.38, 27.58, 7.96, 4.90, 4.05.

[α]20D -30.8 (c 0.5 g/100 mL, MeOH). ESI-MS (m/z): 594 [M + H]+.

Synthesis of (S)-3-((S)-2-(3-amino-2-oxopyridin-1(2H)-yl)-3-cyclopropylpropan-amido)-N-benzyl-

2-oxo-4-((S)-2-oxopyrrolidin-3-yl)butanamide 14b

Compound 13b (0.11 mmol) was added to the solution 4N HCl/EA (30 mL). The mixture was

stirred at 25oC for 1 h. Then, the solvent was removed under reduced pressure, and to the residue,

ether (2 mL) was added while stirring. The white solid was precipitated. The mixture was filtered

and the filter cake was washed with diethyl ether (1 mL) to afford compound 14b as off-white solid

(54% yield).

1H NMR (300 MHz, DMSO-d6) δ 9.25 (d, J = 5.4 Hz, 1H), 9.06 (dd, J1 = 14.1 Hz, J2 = 7.2 Hz,

1H), 7.73-7.59 (m, 2H), 7.34-7.21 (m, 5H), 6.30 (t, J = 7.5 Hz, 1H), 5.75-5.64 (m, 1H), 5.00 (s, br,

1H), 4.30 (s, 2H), 3.17-3.09 (m, 2H), 2.26-2.12 (m, 2H), 1.99-1.63 (m, 5H), 0.51-0.46 (m, 1H),

0.34-0.30 (m, 2H), 0.15-0.13 (m, 1H), 0.02- -0.02 (m, 1H). 13C NMR (300 MHz, DMSO-d6) δ

196.59, 178.42, 169.87, 161.13, 158.23, 140.97, 138.95, 133.42, 128.78, 128.64, 127.82, 127.46,

104.93, 57.95, 53.23, 42.54, 40.52, 38.33, 36.18, 31.62, 27.62, 8.05, 5.00, 3.94. ESI-MS (m/z): 494

[M + H]+.

18

Diastereomeric purity

Fig. S1: Stereocenters of compound 13b

Compound 7 was synthesized according to the literature (35) and should have the S configuration at

both stereocenters, as it has been shown that the asymmetric dianionic cyanomethylation of N-Boc

L-(+)-glutamic acid dimethyl ester is highly stereospecific (35). We observed partial racemization

of compound 8 at the P2 a-carbon, which may occur upon step d or step f (see Scheme S1).

However, our target, the S-diastereomer of 8, is the main product and can be separated from the R-

diastereomer by chromatography on silica gel (DCM/MeOH = 40/1), (TLC rf: R-isomer 0.40, S-

isomer 0.38 on silica gel, DCM/MeOH=20/1). The following conditions of steps g, h, i, j, k are mild

and are unlikely to lead to racemization at P1 and P2. Furthermore, the diastereomers can be

monitored by TLC during the reaction, and we just collected the main components of the mixture

during flash chromatography purification, thereby also reducing the risk of impurity of the final

target. Notably, we obtained two diastereomers of compounds 11 and 12, which were easily

separated by flash chromatography on silica gel (TLC, compound 12, isomer 1: 0.58, isomer 2: 0.35,

DCM/MeOH = 10/1, ratio 1 to 1). We tried the oxidation of the two isomers independently, and

19

found that they finally led to the same compounds 13a,b. The structure of 13b is confirmed by the

crystal structure of its complex with the SARS-CoV-2 Mpro.

1H and 13C NMR spectra

Fig. S2: 1H NMR spectrum of 13a

20

Fig. S3: 13C NMR spectrum of 13a

������������������������������������������������������

�� �����

��

�����

����

�����

�����

����

���

�����

����

�����

�����

����

�����

����

�����

����

������

������

�����

����

�����

�����

������

�����

����

������

�������������� �������

21

Fig. S4: 1H NMR spectrum of 13b

22

Fig. S5: 13C NMR spectrum of 13b

������������������������������������������������������

�� �����

����

����

���

���

���

�����

�����

���

����

�����

�����

����

����

�����

������

�����

����

����

����

������

�����

�����

�����

������

������

����

�����

�������������� �������

23

Fig. S6: 1H NMR spectrum of 14b

24

Fig. S7: 13C NMR spectrum of 14b

Determination of inhibition of SARS-CoV-2 Mpro by 11r, 13a, and 13b

The same reaction buffer, substrate, and monitor equipment were employed as described in the

paragraph on enzyme kinetics of SARS-CoV-2 and SARS-CoV Mpro (see above). Stock solutions of

the compounds were prepared with 100% DMSO. For the determination of the IC50, 0.5 µM of

SARS-CoV-2 Mpro was incubated with 11r, 13a, or 13b at various concentrations from 0 to 100 μM

in reaction buffer at 37oC for 10 min. Afterwards, the FRET substrate at a final concentration of 20

μM was added to each well at a final total volume of 50 μL to initiate the reaction. The GraphPad

Prism 6.0 software (GraphPad) was used for the calculation of the IC50 values. Measurements of

inhibitory activities of the compounds were performed in triplicate and are presented as the mean ±

SD.

������������������������������������������������������

�� �����

����

����

���

����

�����

����

����

�����

�����

�����

����

������

�����

����

�����

���

������

�����

�����

�����

������

����

����

������

������������� �� �����

25

SARS-CoV-2 infection experiments

Experiments with SARS-CoV-2 were performed under biosafety level 3 (BSL-3) conditions at the

Institute of Virology, Philipps-University of Marburg, Germany. Calu-3 cells were infected with

SARS-CoV-2 at a multiplicity of infection (MOI) of 0.05 diluted in DMEM/F12 without FCS at

37°C for 1 h. Cells were washed with DMEM/F12 with 10% FCS and supplemented with 13b or

14b in different concentrations. For solvent control, cells were only treated with DMSO. 24 h after

infection (p.i.), cells were lysed and quantitative PCR was performed (based on a protocol published

in (36)). For that, 5 µg of total RNA were analyzed with the QIAGEN OneStep RT-PCR Kit

according to the manufacturer’s instructions. Two independent biological replicates, each with two

technical replicates, were performed.

Determination of absorption - distribution - metabolism - excretion (ADME) properties of

compounds 13a and 13b

Plasma protein binding. Plasma protein binding was assessed using the rapid equilibrium device

(RED) system from ThermoFisher. Compounds were dissolved in DMSO. Naproxene served as

control as it shows high plasma protein binding. Compounds were diluted in murine plasma (from

CD-1 mice, pooled) to a final concentration of 100 µM. Dialysis buffer and plasma samples were

added to the respective chambers according the manufacturer’s protocol. The RED plate was sealed

with a tape and incubated at 37°C for 2 hours at 800 rpm on an Eppendorf MixMate® vortex-mixer.

Then samples were withdrawn from the respective chambers. To 25 µL of each dialysis sample,

25 µL of plasma and to 25 µL of plasma sample, 25 µL of dialysis buffer was added. Then 150 µL

ice-cold extraction solvent (acetonitrile/H2O (90:10) containing 12.5 ng/mL caffeine as internal

26

standard) was added. Samples were incubated for 30 min on ice. Then samples were centrifuged at

4°C at 2270 x g for 10 min. Supernatants were transferred to Greiner V-bottom 96-well plates and

sealed with a tape. The percentage of bound compound was calculated as follows:

(1) % free = (concentration buffer chamber / concentration plasma chamber) x 100%

% bound = 100% - % free.

Plasma stability. 13a or 13b dissolved in DMSO was added to mouse plasma (pH 7.4, 37°C) to

yield a final concentration of 25 µM. In addition, procaine and procainamide (dissolved in DMSO)

were added to mouse plasma (pH 7.4, 37°C) to yield a final concentration of 250 µM. Procaine

served as positive control as it is unstable in mouse plasma. Procainamide served as negative control

as it is stable in mouse plasma. The samples were incubated for 0 min, 15 min, 30 min, 60 min, 90

min, and 120 min at 37°C. At each time point, 7.5 µL of the respective sample was extracted with

22.5 µL methanol containing an internal standard for 5 min at 2000 rpm on a MixMate® vortex

mixer (Eppendorf). Then samples were centrifuged for 2 min at 15.870 x g and the supernatants

were transferred to HPLC-glass vials. 100 ng/mL glipizide was used as internal standard for HPLC-

MS. Peak areas of each compound and of the internal standard were analyzed using the MultiQuant

3.0 software (AB Sciex). Peak areas of the respective compound were normalized to the internal

standard peak area and to the respective peak areas at time point 0 min: (C/D)/(A/B) with A: peak

area of the compound at time point 0 min, B: peak area of the internal standard at time point 0 min,

C: peak area of the compound at the respective time point, D: peak area of the internal standard at

the respective time point. Every experiment was repeated independently at least three times.

Microsomal stability. S9 liver microsomes (mouse and human, ThermoFisher) were thawed slowly

on ice. 20 mg/mL of microsomes, 2 µL of a 100 µM solution of 13a or 13b and 183 µL of 100 mM

27

phosphate buffer were incubated for 5 min at 37°C in a water bath. Reactions were initiated using

10 µL of 20 mM NADPH. Samples were incubated in three replicates at 37°C under gentle agitation

at 150 rpm. At 0, 15, 30, and 60 min, reactions were terminated by the addition of 200 µL

acetonitrile. Samples were vortexed and centrifuged at 2270 x g for 10 min at 4°C. The supernatants

were transferred to 96-well Greiner V-bottom plates, sealed and analyzed according to the section

HPLC-MS analysis below. Peak areas of the respective time point of 13a or 13b were normalized to

the peak area at time point 0 min.

Solubility assays. First, a calibration curve was prepared with 13a ranging from 2.5 to 500 µM. For

determination of kinetic solubility, 0.5 mmol of 13a was added to a 96-well plate in triplicates.

100 µL buffer of pH 7.4 was added to every replicate of 13a. Samples were incubated at room

temperature. At 15 min and 4 h, 10 µL were taken from every well and transferred to a new 96-well

plate. Then 190 µL acetonitrile containing 12.5 ng/mL glipizide as internal standard was added. For

thermodynamic solubility, 0.5 mmol of 13a were added to a glass vial. Buffer of pH 7.4 was added

and samples were incubated at 20°C for 24, 48, and 72 h under agitation (120 rpm). At the

respective time points, 10 µL of every replicate were taken and transferred to a new 96-well plate.

190 µL acetonitrile containing 12.5 ng/mL glipizide as internal standard was added. All samples

were centrifuged for 10 min at 12°C and 2270 x g, supernatants were transferred to a new Greiner

96-well V-bottom plate. All samples were analyzed according to the section HPLC-MS analysis

below.

HPLC-MS analysis. Samples were analyzed using an Agilent 1290 Infinity II HPLC system

coupled to an AB Sciex QTrap 6500plus mass spectrometer. LC conditions were as follows: column:

28

Agilent Zorbax Eclipse Plus C18, 50x2.1 mm, 1.8 µm; temperature: 30°C; injection volume: 5 µL

for plasma, 10 µL for urine, lung and BALF; 10 µL for samples from plasma stability, metabolic

stability, plasma protein binding, and solubility assays; flow rate: 700 µL/min; solvent A: water +

0.1 % formic acid; solvent B: 95% acetonitrile/5% H2O + 0.1% formic acid; gradient: 99% A at 0

min, 99% A until 0.1 min, 99% - 0% A from 0.1 min to 5.5 min, 0% A until 6.0 min, 0% - 99 % A

from 6.0 min to 6.4 min, 99 % A until 6.5 min. Mass transitions for controls and 13a as well as 13b

are given in Table S1.

Table S1. Mass transitions of compounds

Q1 mass Q3 mass Time [msec] DP [volts] CE [volts] CXP

[volts] Naproxene 231.106 185.1 50 80 19 10

231.106 170.2 50 80 33 12 Caffeine 195.024 138.0 30 80 25 14

195.024 110.0 30 80 31 18 13a 608.228 508.2 30 1 39 28

608.228 313.1 30 1 53 34 13b 594.156 305.1 30 31 19 18

594.156 249.0 30 31 35 12 Glipizide 444.027 318.9 30 -200 -38 -12

444.027 170.0 30 -200 -38 -12 Procaine 235.744 163.0 30 80 21 18

235.744 120.0 30 80 39 12 Procainamide 236.773 100.0 30 80 21 12

236.773 120.0 30 80 31 14

Determination of pharmacokinetic properties

Mice. For pharmacokinetic experiments, outbred male CD-1 mice (Charles River), 4 weeks old,

were used. The animal studies were conducted in accordance with the recommendations of the

European Community (Directive 86/609/EEC, 24 November 1986). All animal procedures were

performed in strict accordance with the German regulations of the Society for Laboratory Animal

Science (GV-SOLAS) and the European Health Law of the Federation of Laboratory Animal

29

Science Associations (FELASA). Animals were excluded from further analysis if sacrifice was

necessary according to the human endpoints established by the ethical board. All experiments were

approved by the ethical board of the Niedersächsisches Landesamt für Verbraucherschutz und

Lebensmittelsicherheit, Oldenburg, Germany (LAVES; permit nos. 33.19-42502-04-15/1857 and

33.19-42502-04-18/2892).

Pharmacokinetic (PK) study. 13a was dissolved in olive oil and water containing lecithin (40 mg

lecithin dissolved in 800 µL of water). 13b was dissolved in DMSO, Kolliphor EL®, Tween 80 ®,

sodium citrate and water. Mice were administered 13a subcutaneously (s.c.) at 20 mg/kg and 13b at

3 mg/kg sc. For 13a: About 20 μL of whole blood was collected serially from the lateral tail vein at

time points 0.25, 0.5, 1, 2, 4, and 8 h post administration. After 24 h, mice were sacrificed and blood

was collected from the heart. For 13b: Mice were sacrificed and blood was collected from the heart

at time points 0.25, 0.5, 1, 2, 4, 8, and 24 h post administration. Whole blood was collected into

Eppendorf tubes coated with 0.5 M EDTA and immediately spun down at 15,870 x g for 10 min at

4°C. The plasma was transferred into a new Eppendorf tube and then stored at −80°C until analysis.

For 13b: Lungs were aseptically removed at each time point, homogenized and compound levels

were analyzed using HPLC-MS/MS.

PK sample preparation and analysis. First, a calibration curve was prepared by spiking different

concentrations of 13a or 13b into mouse plasma, mouse urine, murine broncheo-alveolar lavage

fluid (BALF), or homogenized lung from CD-1 mice. Caffeine was used as an internal standard. In

addition, quality control samples (QCs) were prepared for 13a and 13b, respectively, in plasma,

urine, BALF, and homogenized lung. The following extraction procedures were used: 7.5 µL of a

30

plasma sample or 10 µL of a urine sample (calibration samples, QCs or PK samples) was extracted

with 25 µL of acetonitrile containing 12.5 ng/mL of caffeine as internal standard for 5 min at

2000 rpm on an Eppendorf MixMate® vortex mixer; 50 µL of a lung sample (concentration

adjusted to 50 mg/mL, calibration samples, QCs or PK samples) was extracted with 50 µL of

acetonitrile containing 12.5 ng/mL caffeine as internal standard for 5 min at 2000 rpm on an

Eppendorf MixMate® vortex mixer. BALF samples were prepared as follows: 300 µL methanol

were added to 200 µL of a BALF sample (calibration samples, QCs or PK samples) and samples

were evaporated to dryness in an Eppendorf concentrator. Then, 80 µL of water were added to every

dry sample and incubated for 10 min at 2000 rpm on an Eppendorf MixMate® vortex mixer. Then,

20 µL of acetonitrile containing 125 ng/mL caffeine were added and samples incubated for another

5 min at 2000 rpm on an Eppendorf MixMate® vortex mixer. Then samples were spun down at

15,870 x g for 10 min. Supernatants were transferred to standard HPLC-glass vials as described in

the section HPLC-MS analysis above. Peaks of PK samples were quantified using the calibration

curve. The accuracy of the calibration curve was determined using QCs independently prepared on

different days. PK parameters were determined using a non-compartmental analysis with PKSolver

(37).

31

Supplementary Results

1. Amino-acid sequence alignment of SARS-CoV-2 and SARS-CoV main proteases

Fig. S8: Sequence alignment of the main proteases of SARS-CoV-2 and SARS-CoV.

Identical residues are indicated by red background. Residues 285 and 286 (see text) are highlighted

by asterisks. Secondary structure as found in the crystal structure of SARS-CoV-2 Mpro is indicated

above the amino-acid sequences. a = a-helix, b = b-strand, h - 310-helix, TT = turn.

32

Fig. S9: As in Fig. 2 of the main text, but with the two atoms prevented from interacting (pyridone

amide N and Gln189) indicated by spheres (blue for the amide nitrogen, red for Gln189 side-chain

oxygen).

2. Analysis of the oligomerization behavior of SARS-CoV-2 and SARS-CoV Mpro by analytical

ultracentrifugation

In order to examine the oligomerization behavior of SARS-CoV-2 Mpro, the protein was

analyzed at concentrations of 0.23, 0.45, 0.60, 0.91, 1.00, 1.81, 2.50, 3.62, 4.53, 5.00, 7.50, 10.0,

12.5, and 18.1 µM in sedimentation velocity experiments in an analytical ultracentrifuge. It can be

clearly seen that a monomer-dimer equilibrium is observed, whereupon the monomer sediments at

s20, w = 2.9 S and the dimer at s20,w = 4.5 S (Fig. S10a); similar results were obtained for SARS-CoV

Mpro (Fig. S10b). For SARS-CoV Mpro, a monomer-dimer equilibrium has been found previously by

analytical ultracentrifugation (38). Since the peak positions in the c(s) distributions do not change

33

with protein concentration, the equilibrium is slow on the time scale of sedimentation (31).

Therefore, the samples were incubated for ~23 hours at room temperature after dilution before they

were subjected to sedimentation analysis.

To determine the dissociation constant (Kd) of the dimerization reaction, binding isotherms

for SARS-CoV-2 Mpro and SARS-CoV Mpro were constructed by calculation of signal-averaged s-

values (sw) by integration of the c(s) distributions in the range where monomers and dimers are

observed (Fig. S10c). The binding isotherms, however, cannot be fitted with a monomer-dimer

model, since the transitions are too steep and the dimer did not dissociate completely at low

concentrations. This may be due to the fact that even after 23 hours of incubation at room

temperature, equilibrium was not reached, and to interference with higher oligomers as observed in

the c(s) distributions in Figs. S10a and S10b. However, no significant difference between the

binding isotherms of SARS-CoV-2 Mpro and SARS-CoV Mpro could be observed. From the

transition range of the binding isotherms, an apparent Kd of about 2.5 µM can be estimated for both

proteins.

For the kinetic measurements of enzymatic activity, concentrations of 2.0 µM SARS-CoV-2

Mpro were applied. Since these concentrations are in a range where both monomer and dimer are

populated and it is known that only the dimer is catalytically active (9), we determined the

percentages of dimers at both concentrations. To this end, we subjected triplicates of samples with

the respective concentrations directly after dilution to sedimentation velocity analysis and obtained

21% ± 4.2% and 38% ± 5.7% of dimer at 1.0 µM and 2.0 µM, respectively (Fig. S10d). Similar

34

results, namely 28% ± 8.8% of dimer at 1.0 µM and 42% ± 2.8% at 2 µM, were obtained for SARS-

CoV-Mpro (Fig. S10e).

Fig. S10: Sedimentation velocity analysis of the monomer-dimer equilibrium of SARS-CoV-2

Mpro and SARS-CoV Mpro. Selected c(s) distributions of SARS-CoV-2 Mpro (a) or SARS-CoV

Mpro (b) measured in a concentration range of 0.23 to 18.1 µM were normalized to the same area for

better comparability. It can be clearly seen that equilibrium shifts with increasing protein

concentration from almost exclusively monomer (s20,w = 2.9 S) to almost exclusively dimer (s20,w =

35

4.5 S). As the peak positions do not change with protein concentration, the equilibrium is slow on

the time scale of sedimentation (31). Therefore, data were collected after ~23 hours of incubation at

room temperature. (c) By integration of c(s) distributions such as shown in panels a and b in the

range where monomers and dimers were observed, signal-averaged s-values sw were calculated and

plotted as a function of concentration to obtain binding isotherms for SARS-CoV-2 Mpro (red) and

SARS-CoV Mpro (blue). (d) In order to determine the percentage of dimers present during kinetic

measurements, samples at concentrations of 1.0 µM or 2.0 µM SARS-CoV-2 Mpro, respectively,

were subjected to sedimentation velocity analysis directly after dilution. Samples were run in

triplicates and integration of the c(s) distributions obtained 21% ± 4.2% dimer at 1.0 µM and 38% ±

5.7% at 2 µM. (e) Same procedure as in panel d but using SARS-CoV Mpro, obtained 28% ± 8.8%

dimer at 1.0 µM and 42% ± 2.8% at 2 µM. Graphical representation of c(s) distributions, calculation

of sw-values and determination of the percentage of dimers were performed with the program

GUSSI (39).

36

3. Supplementary Tables

Table S2. Diffraction data and model refinement statistics

Protein / Ligand Mpro free enzyme

Mpro + 13b (monoclinic

form)

Mpro + 13b (orthorhombic

form) PDB entry 6Y2E 6Y2F 6Y2G Data collection statistics X-ray source BESSY 14.2 BESSY 14.2 BESSY 14.2 Wavelength [Å] 0.9184 0.9184 0.9184 Vm [Å3/Da] 2.01 2.75 2.67 Solvent content [%] 38.8 55.3 54.0 Space group C2 C2 P212121

Unit cell dimensions [Å] a = 114.98, b = 53.76, c = 44.77

a = 98.08, b = 80.93, c = 51.66

a = 68.57, b = 101.60, c = 103.70

Unit cell dimensions [º] α = γ = 90, β = 101.24

α = γ = 90, β = 114.84 α = β = γ = 90

Resolution range a [Å] 48.53 - 1.75 (1.84 - 1.75)

43.37 - 1.95 (2.06 - 1.95)

41.39 - 2.20 (2.32 - 2.20)

Number of observations 185,991 (27,913)

182,301 (27,374) 492,459 (64,837)

Number of unique reflections 27,173 (3,926) 26,757 (3,919) 37,519 (5356)

Completeness [％] 100.0 (100.0) 100.0 (100.0) 100.0 (100.0) Mean I/σ(I) 15.0 (2.1) 15.5 (2.2) 13.1 (2.1) Multiplicity 6.8 (7.1) 6.8 (7.0) 13.1 (12.1) Rmerge b [%] 0.082 (0.967) 0.076 (0.826) 0.170 (1.388) Rpim c [%] 0.034 (0.387) 0.032 (0.335) 0.048 (0.414) CC1/2 d 0.999 (0.747) 0.999 (0.809) 0.998 (0.662) Wilson B-factor [Å2] 23 31 35 Refinement statistics Number of unique reflections used for refinement

27,173 (3,926) 26,757 (3,919) 37,519 (5,356)

Rcryst e /Rfree f [%] 17.12/22.24 17.79/21.91 18.62/24.73 r.m.s.d. in bond lengths [Å] 0.009 0.010 0.010

37

r.m.s.d. in bond angles [°] 1.6 1.7 1.8 Clashscore g 2 3 4 Average B-factor for protein atoms [Å2] 27 39 44

Average B-factor for ligand atoms [Å2] N/A 47 49

Average B-factor for water molecules [Å2] 37 47 44

Number of protein atoms 2373 2342 4675 Number of ligand atoms N/A 43 86 Number of water molecules 313 177 313

Ramachandran plot Preferred regions [%] 96.37 94.32 93.83 Allowed regions [%] 3.30 5.35 6.17 Outlier regions [%] 0.33 0.33 0

a The highest resolution shell is shown in parantheses.

b R!"#$" = ∑ ∑ |𝐼%(ℎ𝑘𝑙) − 𝐼(̅ℎ𝑘𝑙)|&%'()*+ ∑ ∑ 𝐼%(ℎ𝑘𝑙)&

%'()*+⁄

cR,-! = ∑ .1/(𝑛 − 1))*+ ∑ |𝐼%(ℎ𝑘𝑙) − 𝐼(̅ℎ𝑘𝑙)|&%'( ∑ ∑ 𝐼%(ℎ𝑘𝑙)&

%'()*+2 (40)

d CC1/2 is the correlation coefficient determined by two random half data sets (41)

eR.#/01 = ∑ |𝐹2(ℎ𝑘𝑙) − 𝐹3(ℎ𝑘𝑙)|)*+ ∑ |𝐹2(ℎ𝑘𝑙)|)*+⁄

f Rfree was calculated for a test set of reflections (5%) omitted from the refinement.

g Clashscore is defined as the number of clashes calculated for the model per 1000 atoms (including

hydrogens) of the model. Hydrogens were added by MolProbity (42)

38

Table S3. Pharmacokinetic parameters of 13a and 13b after subcutaneous administration (20 mg/kg and 3 mg/kg, resp.)

13a 20 mg/kg sc 13b 3 mg/kg sc t1/2 [h] 1.0 ± 0.1 1.8 ± 0.5 Tmax [h] 0.4 ± 0.1 0.7 ± 0.3 Cmax [ng/mL] 334.5 ± 109.2 126.2 ± 31.0 AUC0-t [ng/mL*h] 551.2 ± 67.7 306.6 ± 80.4 MRT [h] 1.6 ± 0.2 2.7 ± 0.8 Vz/F [L/kg] 48.6 ± 7.7 20.4 ± 5.4 Cl/F [mL/kg/min] 565.6 ± 61.0 131.6 ± 26.0

t1/2: half-life, Tmax: time point at which maximal concentration is reached, Cmax: maximal

concentration, AUC0-t: area under the cure from time point 0 until t, MRT: mean residence time, Vz:

volume of distribution, Cl: clearance, F: fraction/bioavailability

References

1. P. Zhou, X.-L. Yang, X.-G. Wang, B. Hu, L. Zhang, W. Zhang, H.-R. Si, Y. Zhu, B. Li, C.-L. Huang, H.-D. Chen, J. Chen, Y. Luo, H. Guo, R.-D. Jiang, M.-Q. Liu, Y. Chen, X.-R. Shen, X. Wang, X.-S. Zheng, K. Zhao, Q.-J. Chen, F. Deng, L.-L. Liu, B. Yan, F.-X. Zhan, Y.-Y. Wang, G.-F. Xiao, Z.-L. Shi, A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579, 270–273 (2020). doi:10.1038/s41586-020-2012-7 Medline

2. F. Wu, S. Zhao, B. Yu, Y.-M. Chen, W. Wang, Z.-G. Song, Y. Hu, Z.-W. Tao, J.-H. Tian, Y.-Y. Pei, M.-L. Yuan, Y.-L. Zhang, F.-H. Dai, Y. Liu, Q.-M. Wang, J.-J. Zheng, L. Xu, E. C. Holmes, Y.-Z. Zhang, A new coronavirus associated with human respiratory disease in China. Nature 579, 265–269 (2020). doi:10.1038/s41586-020-2008-3 Medline

3. A. E. Gorbalenya, S. C. Baker, R. S. Baric, R. J. de Groot, C. Drosten, A. A. Gulyaeva, B. L. Haagmans, C. Lauber, A. M. Leontovich, B. W. Neuman, D. Penzar, S. Perlman, L. L. M. Poon, D. Samborskiy, I. A. Sidorov, I. Sola, J. Ziebuhr, Severe acute respiratory syndrome-related coronavirus: The species and its viruses – a statement of the Coronavirus Study Group. Nat. Microbiol. (2020). 10.1038/s41564-020-0695-z

4. K. Anand, J. Ziebuhr, P. Wadhwani, J. R. Mesters, R. Hilgenfeld, Coronavirus main proteinase (3CLpro) structure: Basis for design of anti-SARS drugs. Science 300, 1763–1767 (2003). doi:10.1126/science.1085658 Medline

5. R. Hilgenfeld, From SARS to MERS: Crystallographic studies on coronaviral proteases enable antiviral drug design. FEBS J. 281, 4085–4096 (2014). doi:10.1111/febs.12936 Medline

6. L. Zhang, D. Lin, Y. Kusov, Y. Nian, Q. Ma, J. Wang, A. von Brunn, P. Leyssen, K. Lanko, J. Neyts, A. de Wilde, E. J. Snijder, H. Liu, R. Hilgenfeld, α-Ketoamides as broad-spectrum inhibitors of coronavirus and enterovirus replication: Structure-based design, synthesis, and activity assessment. J. Med. Chem. acs.jmedchem.9b01828 (2020). doi:10.1021/acs.jmedchem.9b01828 Medline

7. J. Tan, K. H. G. Verschueren, K. Anand, J. Shen, M. Yang, Y. Xu, Z. Rao, J. Bigalke, B. Heisen, J. R. Mesters, K. Chen, X. Shen, H. Jiang, R. Hilgenfeld, pH-dependent conformational flexibility of the SARS-CoV main proteinase (Mpro) dimer: Molecular dynamics simulations and multiple X-ray structure analyses. J. Mol. Biol. 354, 25–40 (2005). doi:10.1016/j.jmb.2005.09.012 Medline

8. J. Shi, J. Song, The catalysis of the SARS 3C-like protease is under extensive regulation by its extra domain. FEBS J. 273, 1035–1045 (2006). doi:10.1111/j.1742-4658.2006.05130.x Medline

9. K. Anand, G. J. Palm, J. R. Mesters, S. G. Siddell, J. Ziebuhr, R. Hilgenfeld, Structure of coronavirus main proteinase reveals combination of a chymotrypsin fold with an extra

alpha-helical domain. EMBO J. 21, 3213–3224 (2002). doi:10.1093/emboj/cdf327 Medline

10. L. Lim, J. Shi, Y. Mu, J. Song, Dynamically-driven enhancement of the catalytic machinery of the SARS 3C-like protease by the S284-T285-I286/A mutations on the extra domain. PLOS ONE 9, e101941 (2014). doi:10.1371/journal.pone.0101941 Medline

11. N. A. Kratochwil, W. Huber, F. Müller, M. Kansy, P. R. Gerber, Predicting plasma protein binding of drugs: A new approach. Biochem. Pharmacol. 64, 1355–1374 (2002). doi:10.1016/S0006-2952(02)01074-2 Medline

12. H. Yang, M. Yang, Y. Ding, Y. Liu, Z. Lou, Z. Zhou, L. Sun, L. Mo, S. Ye, H. Pang, G. F. Gao, K. Anand, M. Bartlam, R. Hilgenfeld, Z. Rao, The crystal structures of severe acute respiratory syndrome virus main protease and its complex with an inhibitor. Proc. Natl. Acad. Sci. U.S.A. 100, 13190–13195 (2003). doi:10.1073/pnas.1835675100 Medline

13. H. Chen, P. Wei, C. Huang, L. Tan, Y. Liu, L. Lai, Only one protomer is active in the dimer of SARS 3C-like proteinase. J. Biol. Chem. 281, 13894–13898 (2006). doi:10.1074/jbc.M510745200 Medline

14. L. Zhu, S. George, M. F. Schmidt, S. I. Al-Gharabli, J. Rademann, R. Hilgenfeld, Peptide aldehyde inhibitors challenge the substrate specificity of the SARS-coronavirus main protease. Antiviral Res. 92, 204–212 (2011). doi:10.1016/j.antiviral.2011.08.001 Medline

15. J. Tan, S. George, Y. Kusov, M. Perbandt, S. Anemüller, J. R. Mesters, H. Norder, B. Coutard, C. Lacroix, P. Leyssen, J. Neyts, R. Hilgenfeld, 3C protease of enterovirus 68: Structure-based design of Michael acceptor inhibitors and their broad-spectrum antiviral effects against picornaviruses. J. Virol. 87, 4339–4351 (2013). doi:10.1128/JVI.01123-12 Medline

16. P. S. Dragovich, R. Zhou, D. J. Skalitzky, S. A. Fuhrman, A. K. Patick, C. E. Ford, J. W. Meador 3rd, S. T. Worland, Solid-phase synthesis of irreversible human rhinovirus 3C protease inhibitors. Part 1: Optimization of tripeptides incorporating N-terminal amides. Bioorg. Med. Chem. 7, 589–598 (1999). doi:10.1016/S0968-0896(99)00005-X Medline

17. L. Zhang, D. Lin, R. Hilgenfeld, Crystal structure of the complex resulting from the reaction between the SARS-CoV main protease and tert-butyl (1-((S)-3-cyclohexyl-1-(((S)-4-(cyclopropylamino)-3,4-dioxo-1-((S)-2-oxopyrrolidin-3-yl)butan-2-yl) amino)-1-oxopropan-2-yl)-2-oxo-1,2-dihydropyridin-3-yl)carbamate, PDB ID 6Y7M (2020). doi:10.2210/pdb6Y7M/pdb

18. L. Zhu, R. Hilgenfeld, Crystal structure of SARS coronavirus main protease complexed with an alpha, beta-unsaturated ethyl ester inhibitor SG85, PDB ID 3TNT (2012). doi:10.2210/pdb3TNT/pdb

19. Y. Kusov, J. Tan, E. Alvarez, L. Enjuanes, R. Hilgenfeld, A G-quadruplex-binding macrodomain within the “SARS-unique domain” is essential for the activity of the

SARS-coronavirus replication-transcription complex. Virology 484, 313–322 (2015). doi:10.1016/j.virol.2015.06.016 Medline

20. X. Xue, H. Yang, W. Shen, Q. Zhao, J. Li, K. Yang, C. Chen, Y. Jin, M. Bartlam, Z. Rao, Production of authentic SARS-CoV Mpro with enhanced activity: Application as a novel tag-cleavage endopeptidase for protein overproduction. J. Mol. Biol. 366, 965–975 (2007). doi:10.1016/j.jmb.2006.11.073 Medline

21. U. Mueller, N. Darowski, M. R. Fuchs, R. Förster, M. Hellmig, K. S. Paithankar, S. Pühringer, M. Steffien, G. Zocher, M. S. Weiss, Facilities for macromolecular crystallography at the Helmholtz-Zentrum Berlin. J. Synchrotron Radiat. 19, 442–449 (2012). doi:10.1107/S0909049512006395 Medline

22. M. Krug, M. S. Weiss, U. Heinemann, U. Mueller, XDSAPP: A graphical user interface for the convenient processing of diffraction data using XDS. J. Appl. Crystallogr. 45, 568–572 (2012). doi:10.1107/S0021889812011715

23. P. Evans, Scaling and assessment of data quality. Acta Crystallogr. D 62, 72–82 (2006). doi:10.1107/S0907444905036693 Medline

24. P. R. Evans, An introduction to data reduction: Space-group determination, scaling and intensity statistics. Acta Crystallogr. D 67, 282–292 (2011). doi:10.1107/S090744491003982X Medline

25. M. D. Winn, C. C. Ballard, K. D. Cowtan, E. J. Dodson, P. Emsley, P. R. Evans, R. M. Keegan, E. B. Krissinel, A. G. Leslie, A. McCoy, S. J. McNicholas, G. N. Murshudov, N. S. Pannu, E. A. Potterton, H. R. Powell, R. J. Read, A. Vagin, K. S. Wilson, Overview of the CCP4 suite and current developments. Acta Crystallogr. D 67, 235–242 (2011). doi:10.1107/S0907444910045749 Medline

26. A. Vagin, A. Teplyakov, Molecular replacement with MOLREP. Acta Crystallogr. D 66, 22–25 (2010). doi:10.1107/S0907444909042589 Medline

27. A. A. Lebedev, P. Young, M. N. Isupov, O. V. Moroz, A. A. Vagin, G. N. Murshudov, JLigand: A graphical tool for the CCP4 template-restraint library. Acta Crystallogr. D 68, 431–440 (2012). doi:10.1107/S090744491200251X Medline

28. P. Emsley, B. Lohkamp, W. G. Scott, K. Cowtan, Features and development of Coot. Acta Crystallogr. D 66, 486–501 (2010). doi:10.1107/S0907444910007493 Medline

29. G. N. Murshudov, P. Skubák, A. A. Lebedev, N. S. Pannu, R. A. Steiner, R. A. Nicholls, M. D. Winn, F. Long, A. A. Vagin, REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr. D 67, 355–367 (2011). doi:10.1107/S0907444911001314 Medline

30. Y. Liu, W. Kati, C. M. Chen, R. Tripathi, A. Molla, W. Kohlbrenner, Use of a fluorescence plate reader for measuring kinetic parameters with inner filter effect correction. Anal. Biochem. 267, 331–335 (1999). doi:10.1006/abio.1998.3014 Medline

31. P. H. Brown, A. Balbo, P. Schuck, Characterizing protein-protein interactions by sedimentation velocity analytical ultracentrifugation. Curr. Protoc. Immunol. Chapter 18, Unit 18.15 (2008).

32. P. Schuck, Size-distribution analysis of macromolecules by sedimentation velocity ultracentrifugation and lamm equation modeling. Biophys. J. 78, 1606–1619 (2000). doi:10.1016/S0006-3495(00)76713-0 Medline

33. M. T. Laue, B. D. Shah, T. M. Rigdeway, S. L. Pelletier, in Analytical Ultracentrifugation in Biochemistry and Polymer Science, S. Harding, A. Rowe, J. Horton, Eds. (Royal Society of Chemistry, 1992), pp. 90–125.

34. E. F. Pettersen, T. D. Goddard, C. C. Huang, G. S. Couch, D. M. Greenblatt, E. C. Meng, T. E. Ferrin, UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612 (2004). doi:10.1002/jcc.20084 Medline

35. Q. Tian, N. K. Nayyar, S. Babu, L. Chen, J. Tao, S. Lee, A. Tibbetts, T. Moran, J. Liou, M. Guo, T. P. Kennedy, An efficient synthesis of a key intermediate for the preparation of the rhinovirus protease inhibitor AG7088 via asymmetric dianionic cyanomethylation of N-Boc-L-(+)-glutamic acid dimethyl ester. Tetrahedron Lett. 42, 6807–6809 (2001). doi:10.1016/S0040-4039(01)01416-2

36. V. M. Corman, O. Landt, M. Kaiser, R. Molenkamp, A. Meijer, D. K. W. Chu, T. Bleicker, S. Brünink, J. Schneider, M. L. Schmidt, D. G. J. C. Mulders, B. L. Haagmans, B. van der Veer, S. van den Brink, L. Wijsman, G. Goderski, J. L. Romette, J. Ellis, M. Zambon, M. Peiris, H. Goossens, C. Reusken, M. P. G. Koopmans, C. Drosten, Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill. 25, (2020). doi:10.2807/1560-7917.ES.2020.25.3.2000045 Medline

37. Y. Zhang, M. Huo, J. Zhou, S. Xie, PKSolver: An add-in program for pharmacokinetic and pharmacodynamic data analysis in Microsoft Excel. Comput. Methods Programs Biomed. 99, 306–314 (2010). doi:10.1016/j.cmpb.2010.01.007 Medline

38. W. C. Hsu, H. C. Chang, C. Y. Chou, P. J. Tsai, P. I. Lin, G. G. Chang, Critical assessment of important regions in the subunit association and catalytic action of the severe acute respiratory syndrome coronavirus main protease. J. Biol. Chem. 280, 22741–22748 (2005). doi:10.1074/jbc.M502556200 Medline

39. C. A. Bräutigam, Calculations and publication-quality illustrations for analytical ultracentrifugation data. Methods Enzymol. 562, 109–133 (2015). doi:10.1016/bs.mie.2015.05.001 Medline

40. M. S. Weiss, R. Hilgenfeld, On the use of the merging R factor as a quality indicator for X-ray data. J. Appl. Crystallogr. 30, 203–205 (1997). doi:10.1107/S0021889897003907

41. P. A. Karplus, K. Diederichs, Linking crystallographic model and data quality. Science 336, 1030–1033 (2012). doi:10.1126/science.1218231 Medline

42. V. B. Chen, W. B. Arendall 3rd, J. J. Headd, D. A. Keedy, R. M. Immormino, G. J. Kapral, L. W. Murray, J. S. Richardson, D. C. Richardson, MolProbity: All-atom structure validation for macromolecular crystallography. Acta Crystallogr. D 66, 12–21 (2010). doi:10.1107/S0907444909042073 Medline