lable at ScienceDirect

Nutrition 30 (2014) 228–233

Contents lists avai

Nutrition

journal homepage: www.nutr i t ionjrnl .com

Basic nutritional investigation

R-a lipoic acid g-cyclodextrin complex increases energy expenditure:A 4-month feeding study in mice

Sibylle Nikolai M.Sc. a, Patricia Huebbe Ph.D. a, Cornelia C. Metges Ph.D. b, Anke Schloesser M.Sc. a,Janina Dose M.Sc. a, Naoko Ikuta M.Sc. c,d, Keiji Terao Ph.D. e, Seiichi Matsugo Prof. d,Gerald Rimbach Prof. a,*a Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Germanyb Leibniz Institute for Farm Animal Biology, Institute of Nutritional Physiology, Dummerstorf, GermanycGraduate School of Medicine, Kobe University, Kobe, Japand School of Natural Systems, College of Science and Engineering, Kanazawa University, JapaneCycloChem Bio Co, Ltd., Kobe, Japan

a r t i c l e i n f o

Article history:Received 12 April 2013Accepted 6 August 2013

Keywords:Energy expenditureg-cyclodextrinLipoic acidMiceBrown adipose tissueUncoupling protein

GR, SN, PH, NI, KT, and SM contributed to the constudy. SN, GR, PH, AS, JD, NI, CCM, KT, and SM contcollection, assembly, analysis, and/or interpretation ofCCM contributed to the drafting of the manuscript. SSM, and GR approved the final version of the manusc* Corresponding author. Tel.: þ49 (0) 431 880-258

2628.E-mail address: rimbach@foodsci.uni-kiel.de (G. R

0899-9007/$ - see front matter � 2014 Elsevier Inc. Ahttp://dx.doi.org/10.1016/j.nut.2013.08.002

a b s t r a c t

Objective: A high-fat diet (HFD) affects energy expenditure in laboratory rodents. R-a lipoic acidcyclodextrin (RALA-CD) complex is a stable form of lipoic acid (LA) and may improve energyexpenditure. The aim of this study was to determine the effect of RALA-CD on energy expenditureand underlying molecular targets in female laboratory mice.Methods: Female C57BL/6J mice were fed a HFD containing 0.1% LA for about 16 wk. The effects onenergy expenditure, gene and protein expression were assessed using indirect calorimetry, real-time reverse transcriptase polymerase chain reaction, and Western blot, respectively.Results: Supplementing mice with RALA-CD resulted in a significant increase in energy expendi-ture. However, both RALA per se (without g-cyclodextrin) and S-a lipoic acid cyclodextrin did notsignificantly alter energy expenditure. Furthermore RALA-CD changed expression of genesencoding proteins centrally involved in energy metabolism. Transcriptional key regulators sirtuin 3and peroxisome proliferator-activated receptor-g, coactivator 1 alpha, as well as thyroid relatedenzyme type 2 iodothyronine deiodinase were up-regulated in brown adipose tissue (BAT) ofRALA-CD–fed mice. Importantly, mRNA and/or protein expression of downstream effectorsuncoupling protein (Ucp) 1 and 3 also were elevated in BAT from RALA-CD-supplemented mice.Conclusion: Overall, present data suggest that RALA-CD is a regulator of energy expenditure inlaboratory mice.

� 2014 Elsevier Inc. All rights reserved.

Introduction in laboratory rodents [4,5]. Furthermore, recent studies have

Lipoic acid (1,2-dithiolane-3-pentanoic acid; LA) is animportant cofactor of mitochondrial enzymes [1,2], includingpyruvate decarboxylase, oxoglutarate dehydrogenase, andbranched chain keto acid dehydrogenase [3].

There is increasing experimental evidence suggesting that LAmay affect gene expression in relation to energy expenditure (EE)

ception and design of theributed to the generation,data. GR, SN, PH, SM, andN, PH, CCM, AS, JD, NI, KT,ript.3; fax: þ49 (0) 431 880-

imbach).

ll rights reserved.

shown that LA supplementation in rats resulted in significantaccentuation of circadian rhythm profiles in liver tissue accom-panied by changes in lipid metabolism [6]. However, the un-derlying cellular and molecular mechanisms by which LA mayaffect genes encoding proteins involved in energy metabolismhave not been fully elucidated. In contrast, high-fat diets (HFDs)seem to impair EE in laboratory rodents [7]. This leads to thequestion of whether simultaneously administered LA couldprevent HFD-induced body weight gain.

a-Lipoic acid (ALA) has a chiral center at its C6 carbon leadingto two enantiomers, R(þ)- and S(�)-ALA, of which RALA is thenaturally occurring form [3,8]. Commercially available LA ismainly a racemate of R(þ)- and S(�)-ALA. RALA is unstable whenexposed to low pH or heat. Thus, it is difficult to use enantiopureRALA as a pharmaceutical and nutraceutical. We have recently

Fig. 1. Representative scanning electron microscopy images of R-a lipoic acid cyclodextrin (A) and S-a lipoic acid cyclodextrin (B) complexes.

S. Nikolai et al. / Nutrition 30 (2014) 228–233 229

shown that it is possible to stabilize RALA through complexformation with g-cyclodextrin (CD) yielding RALA-CD [9]. Arepresentative scanning electron microscopy image of theRALA-CD complex is presented in Figure 1. RALA-CD particlesexhibit a relatively smooth surface and shapes formed by thesecrystals show square and parallel structures. SALA-CD particlesshow a similar appearance like RALA-CD, and also form squareand parallel structures. SALA-CD particles have a rougher surfacecompared with RALA-CD. Moreover, the particle size of SALA-CDseems to be smaller than that of RALA-CD.

The biological activity of RALA-CD has not yet been system-atically investigated and it remains unknown if, and to whatextend, RALA-CD regulates gene expression and EE in vivo.Therefore, in the present study we compared the effect of RALA-CDwith RALA and SALA-CD in terms of gene expression and EE inmice. We focused on those genes encoding proteins centrallyinvolved in energy metabolism.

Materials and methods

Morphological characterization of RALA-CD and SALA-CD complexes via scanningelectron microscopy analysis

For scanning electron microscopy (SEM) analysis, the RALA-CD and SALA-CDcomplexes were sprinkled onto conductive glue on a palladium SEM stub andsputter coatedwith gold for 3min. Then, the RALA-CD complexes weremeasuredat 15 kV with the SEM S-4500, HITACHI, for morphology analysis. Three differentfields within each sample were randomly chosen, and four images of each fieldwere taken at the magnifications 300, 500, 1000 and 5000, giving a total numberof 12 images per sample.

Mice and diets

Animal experiments were performed according to German animal welfarelaws and regulations, and with permission of the appropriate authorities. FemaleC57BL/6J mice were purchased from Charles River Laboratories (Sulzfeld, Ger-many) at the age of 16 mo. Mice were housed in groups of four in macrolon cagesunder controlled environmental conditions (55% relative humidity, 21–25�C and12-h light/dark cycle). All animals had free access to water and semi-syntheticHFDs that also were high in sugar and therefore hypercaloric (composition ofthe basal diet [%]: sucrose, 32.8; butter fat, 21.2; casein, 17.1; maize starch, 14.5;cholesterol, 1.25; Sniff special diets, Soest, Germany). All diets were adjusted foran effective LA content of 0.1%.

After 1 wk of acclimatization, mice were divided into four groups of eightanimals each. The groups were fed either the basal HFD (control group HFD), anidentical diet fortified with 0.1% RALA, or the basal diet supplemented with 0.1%RALA or SALA derived from a g-cyclodextrin complex (RALA-CD or SALA-CD,respectively; all forms of LA CycloChem Bio Co, Ltd., Kobe, Japan). During theentire feeding trial, food intake was controlled daily, and body weight wasdetermined weekly. Food intake was not affected by LA supplementation andbody weights (BW) did not differ significantly between groups (mean initial BW� SEM [g]: HFD: 28.2� 0.92; RALA: 27.4� 0.65; RALA-CD: 27.9� 0.48; SALA-CD:27.9� 0.48; mean final BW � SEM [g]: HFD: 31.6 � 1.17; RALA: 31.1�1.02; RALA-CD: 32.9 � 1.33; SALA-CD: 31.4 � 0.96). Percentage changes of BW (12.5%–17.6%)over the 4-mo experimental duration were without significant differences be-tween groups. Furthermore, final liver weight of the mice (mean final liver

weight � SEM [g]: HFD: 2.05 � 0.09; RALA: 1.77 � 0.13; RALA-CD: 2.00 � 0.15;SALA-CD: 1.83 � 0.06) was also similar between groups. At week 14, EE wasmeasured using indirect calorimetry (n ¼ 4/group). During the entire experi-mental period, mice were in good health conditions. We did not observe anyadverse effects (AEs) in mice fed diets supplemented with 0.1% LA. After 4 mo ofsupplementation, mice were fasted overnight, anaesthetized, and sacrificed bycervical dislocation. Liver, skeletal muscle (musculus quadriceps femoris), andinterscapular brown adipose tissue (BAT) were removed postmortem and storedat �80�C until analysis.

Energy expenditure analysis

Volumes of oxygen consumption (VO2) and carbon dioxide production(VCO2) were measured and EE was calculated using the TSE PhenoMaster (TSESystems GmbH, Bad Homburg, Germany). Individual mice were placed in res-piratory chambers (V: 9l, temperature: 22–23�C, humidity: 45%–55%) with an airflow of 0.35 L/min for 48 h. Mice were allowed to settle for 24 h then O2 (%) andCO2 (%) data were collected every 15 min during the following 24 h. The EE wascalculated using the formula: EE ¼ (3.941*VO2 þ 1.106*VCO2)/1000. Data areexpressed as kcal$h$kg�0.75.

RNA isolation and PCR analyses

Total RNA from mouse BAT was isolated according to manufacturer’s in-structions, using PARISTM kit (Ambion, Kassel, Germany).

Reverse transcriptase polymerase chain reaction (RT-PCR) primers weredesigned using PRIMER v. 3 input software (v. 0.4.0) or taken from http://pga.mgh.harvard.edu/primerbank/, respectively. (Gapdh, housekeeping gene: F:CCGCATCTTCTTGTGCAGT, R: GGCAACAATCTCCACTTTGC; Ucp1: F: GAAAGGGACCCCTAATC, R: GGGACGTCATCTGCCAGTA; Dio2: F: ACAGCTTCCTCCTAGATGCCTA, R: AGTCAAGAAGGTGGCATTCG; Pgc1a: F: AAGGTCCCCAGGCAGTAGAT, R:GCGGTATTCATCCCTCTTGA; Sirt3: F: AGGTGGAGGAAGCAGTGAGA, R: CGGGATGTCATACTGCTGAA; and Ucp2 (PrimerBank ID: 188035853c3): F: GTGGTGGTCGGAGATACCAGA, R: GGGCAACATTGGGAGAAGTCC; Ucp3 (PrimerBank ID: 133892795c1) F: CTGCACCGCCAGATGAGTTT, R: ATCATGGCTTGAAATCGGACC; Cidea(PrimerBank ID: 162287226c3): F: AATGGACACCGGGTAGTAAGT, R: CAGCCTGTATAGGTCGAAGGT). One-step quantitative RT-PCR was performed using the Sensi-Mix SYBR No-ROX one-step kit (Bioline, Luckenwalde, Germany) with SybrGreendetection using a Rotorgene 6000 cycler (Corbett Life Science, Sydney, Australia).

Western blot analysis

BAT whole-cell extracts were prepared for Western blotting using the PARISTM

kit according to the manufacturer’s protocol (Ambion, Kassel, Germany). Liver andmuscle whole-cell protein lysates were prepared as described previously [10].Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electro-phoresis and transferred onto a polyvinylidene fluoridemembrane. Target proteinswere identified, using respective primary anti-uncoupling protein (UCP;1:1000),anti-Histone H3 (1:1000) antibodies and the MitoProfile� total OXPHOS RodentWB Antibody Cocktail together with their corresponding secondary antibodies (allAbcam, Cambridge, UK. Except for secondary antibody to MitoProfile� AntibodyCocktail: Mouse TrueBlot ULTRA, Rockland, Gilbertsville, USA). Protein bands werevisualized with electrochemiluminescence reagents (Fisher Scientific, Schwerte,Germany) in a ChemiDoc XRS system (BioRad, Munich, Germany).

Statistical analysis

Statistical analysis (including outlier test) comparing the HFD and RALA-CDgroups was performed, using SPSS v. 15.0 software (SPSS GmbH Software,

Table 1Total 24-h energy expenditure and corresponding food consumption of mice fed HFD versus RALA-, RALA-CD- and SALA-CD-enriched diets (during light and dark phase)

HFD RALA RALA-CD SALA-CD

Energy expenditure–light phase (kcal$h$kg�0.75) 5.76 � 0.12 5.83 � 0.07 6.35 � 0.11* 6.05 � 0.12Energy expenditure–dark phase (kcal$h$kg�0.75) 6.58 � 0.24 6.41 � 0.11 7.24 � 0.25 7.20 � 0.20Energy expenditure–24 h (kcal$h$kg�0.75) 6.17 � 0.16 6.12 � 0.09 6.79 � 0.16* 6.62 � 0.16Food intake–24 h (g) 2.71 � 0.10 3.03 � 0.46 2.85 � 0.74 3.42 � 0.54

CD, cyclodextrin; HFD, high-fat diet; RALA, R-a lipoic acid; SALA, S-a lipoic acidAll values are means � SEM (n ¼ 4)

* P < 0.05 compared with HFD.

S. Nikolai et al. / Nutrition 30 (2014) 228–233230

Munich, Germany). Kolmogorov-Smirnov and Shapiro-Wilk tests were used totest the data for normal distribution. Data following a Gaussian distributionwereanalyzed by Student’s t test. In the case of a non-Gaussian distribution, a Mann-Whitney U-test was performed. To compare the HFD control group with allsupplementation groups, one-way analysis of variance was performed followedby the Tukey post hoc test. Results are expressed as means and SEM, and dif-ferences were considered significant when the P value was < 0.05, whereasdiscussed as a trend when P < 0.1.

Results

As expected, the EE of the mice was higher during the darkthan during the light phase. Under the conditions investigated,RALA-CD significantly increased EE over 24 h compared withcontrols. Unlike RALA-CD, RALA did not affect EE. Although SALA-CD tended to increase EE (24-h value; P¼ 0.053), these results didnot reach statistical significance comparedwith controls (Table 1).

Fig. 2. mRNA expression of thermogenesis-related genes in brown adipose tissue of 20-mRNA was isolated and Sirt3 (A), Pgc1a (B), Dio2 (C), Ucp2 (D), Ucp3 (E) and Cidea (F) mRmeans þ SEM (n ¼ 5–7), *P < 0.05. In order to obtain normal distribution, Ucp2 and Pgc1RALA-CD, R- a lipoic acid cyclodextrin; Sirt3, sirtuin 3; Pgc1a, peroxisome proliferator-aUcp3, uncoupling protein 3; Cidea, cell death-inducing DNA fragmentation factor, a sub

In order to assess the underlying mechanisms of the elevatedEE in RALA-CD fed mice, we monitored expression of genescentrally involved in energy homeostasis. Therefore, we mea-sured mRNA expression of thermogenic regulators sirtuin 3(Sirt3) and type 2 iodothyronine deiodinase (Dio2) as well as oftheir downstream targets peroxisome proliferator-activatedreceptor-g, coactivator 1a (Pgc1a), and Ucp 1–3 in BAT. Weobserved significantly increased mRNA concentrations of Sirt3and Pgc1a in RALA-CD compared with control mice (Fig. 2A, B).Moreover, dietary RALA-CD supplementation resulted in asignificant threefold increase of Dio2 (Fig. 2C). Interestingly,RALA-CD–fed mice exhibited 60% and 50% higher mRNA con-centrations of Pgc1a (Fig. 2B) and Dio2 (Fig. 2C) target genesUcp1 (Fig. 3A) and Ucp3 (Fig. 2E) compared with controls,respectively. However, mRNA expression of Ucp2 remained

o-old female C57BL/6J mice fed either a HFD or a HFD-enriched with RALA-CD. TotalNA levels were measured in relation to the housekeeping gene. All data representa data were transformed (square root) before statistical analyses. HFD, high-fat diet;ctivated receptor g coactivator 1a; Dio2, deiodinase 2; Ucp2, uncouling protein 2;unit-like effector A.

Fig. 3. Relative mRNA (A) and protein levels (B) of Ucp1 in brown adipose tissue of 20-mo-old female C57BL/6J mice fed either a HFD or a HFD-enriched with RALA-CD. (A)Total RNA was isolated and Ucp1 mRNA levels measured in relation to the housekeeping gene. (B) Total protein was isolated and Ucp1 protein levels determined by Westernblot. Densitometric analysis was normalized to a loading control. A representative blot is shown. Mean expression in the HFD group was set to an arbitrary unit of 1. All datarepresent means þ SEM (n ¼ 6–7), *P < 0.05. HFD, high-fat diet; RALA-CD, R-a lipoic acid cyclodextrin; Ucp1, uncoupling protein 1.

S. Nikolai et al. / Nutrition 30 (2014) 228–233 231

unchanged (Fig. 2D). Expression of BAT marker gene cell death–inducing DNA fragmentation factor, a subunit-like effector A(Cidea) was also not effected by RALA-CD supplementation(Fig. 2E).

We confirmed the effect of RALA-CD on Ucp1 gene expressionalso on the protein level byWestern blotting. Differences in Ucp1mRNAwere reproduced at the protein level, with RALA-CD micedemonstrating an approximately 30% increase in Ucp1 proteincompared with controls (Fig. 3B).

Fig. 4. Representative Western blots of mitochondrial respiratory chain complexes I to VC57BL/6J mice fed either a HFD or a HFD-enriched with RALA-CD. Total protein was isoladetermined byWestern blot. HFD, high-fat diet; RALA-CD, R-a lipoic acid cyclodextrin; ATcytochrome c oxidase I, mitochondrial; NDUFB8, NADH dehydrogenase (ubiquinone) 1 bUQCRC2, ubiquinol cytochrome c reductase core protein 2.

Mitochondrial respiratory chain complexes I to V in liver(Fig. 4A), skeletal muscle (Fig. 4B), and BAT (Fig. 4C) were notsignificantly different between controls and RALA-CD mice.

Discussion

In the present study, LA supplementation did not affect foodintake in mice. All diets were supplemented with 0.1% LA, whichmay be considered a rather pharmacologic LA concentration. We

in liver (A), skeletal muscle (B) and brown adipose tissue (C) of 20-mo-old femaleted and protein expression of mitochondrial respiratory chain complexes I to V wasP5A, ATP synthase, Hþ transporting, mitochondrial F1 complex, a subunit 1; MTCO1,subcomplex 8; SDHB, succinate dehydrogenase complex, subunit B, iron sulfur (Ip);

Fig. 5. Putative mechanism by which RALA-CD may affect thermogenesis and en-ergy expenditure. RALA-CD increases Sirt3 and Pgc1a, known to be important forUcp expression via Ppars and Thra. Furthermore RALA-CD induces Dio2, whichconverts T4 into T3. T3 in turn regulates Ucp expression. It has been recently shownthat Sirt3 may be also a potential target of Pgc1a [30]. Molecular targets of RALA-CDand metabolic outcomes determined in this study are given in bold. Sirt3, sirtuin3;Pgc1a, peroxisome proliferator-activated receptor g, coactivator 1a; Ppar, peroxi-some proliferator activated receptor; Dio2, deiodinase 2; T3, triiodothyronine; T4,thyroxine; Thra, thyroid hormone receptor-a T3 receptor; Creb, cAMP-responsiveelement binding protein; Lxra, liver X receptor-a; Ucp, uncoupling protein.

S. Nikolai et al. / Nutrition 30 (2014) 228–233232

used this dietary concentration of LA because it has been previ-ously reported to be safe and to not alter food consumption inmice [11–14]. Higher concentrations of LA have been associatedwith a significant depression in food intake [15], rendering itdifficult to discriminate between LA-mediated effects and effectsresulting from a reduction in food intake that could influenceenergy metabolism and differential gene expression.

We have recently shown that g-cyclodextrin–complexedRALA is more stable than free RALAwhen subjected to humidity,high temperature, and low pH [9]. The observation that RALA-CDwas able to induce in vivo effects, despite free RALA failing to, islikely to be a result of its enhanced stability and possibly higherbioavailability. SALA-CD was less effective in changing EE andgene expression compared with cyclodextrin-complexed RALA.This may be due to the fact that the R-form of LA is thought to bethe bioactive isomer [16,17]. On the other hand, complexes ofRALA-CD showed a different particle size distribution patterncompared with SALA-CD [9], possibly leading to metabolic dif-ferences between the two complexes.

However, cyclodextrin per se might mediate biological ac-tivity beyond chemical stability of RALA. It has been previouslyshown that cyclodextrins can be metabolized by amylase [18,19]but also function as glucosidase inhibitors [20–22], therebypotentially influencing carbohydrate metabolism.

AHFD, as used in the present study, has beenpreviously shownto impair EE in mice [7]. In the present study, RALA-CD alonesignificantly increased EE in mice. Given that SALA-CD did notalter EE in the present study, it is unlikely that cyclodextrin itselfmay have affected energy metabolism and corresponding geneexpression at the dietary concentration administered. In order toaddress putative underlying molecular mechanisms by which

RALA-CD might regulate energy metabolism we monitored dif-ferential gene expression in BAT of our mice.

As far as energy metabolism is concerned, we found Sirt3,Pgc1a, Dio2, Ucp1, and Ucp3 to be significantly regulated byRALA-CD in BAT of the mice. All of these proteins seem tosignificantly contribute to thermoregulatory processes afterchanges in environmental temperature and availability of diets[23–27]. Usually these stimuli activate the sympathetic nervoussystem, thereby releasing neurotransmitter norepinephrine. Thesubsequent increase in cytosolic cAMP activates a thermogenicprogram [24,28].

Pgc1a is a central player in thermogenesis [24] and is sug-gested to be up-regulated by Sirt3 [24,29]. Thus, the elevatedSirt3 mRNA expressionwe observed in RALA-CD–fed mice, couldat least partly contribute to the increase of Pgc1a. This, in turnmay lead to various effects in brown adipocytes. Interestingly,one study has shown that Sirt3 also may be a potential target ofPgc1a [30]. Furthermore it has been shown that Pgc1a serves ascoactivator for several transcription factors (e.g., Creb, Ppara andPparg, Lxra and Thra) [24,31]. The latter are thought to be part ofa complex network regulating Ucp expression [25]. FurthermoreDio2 is centrally involved in the conversion of thyroxine (T4) totriiothyronine (T3), thereby driving Ucp1 gene expression [32].

An increase in EE partly depends on Ucp activity [33–35];Ucp1 has been shown to uncouple adenosine triphosphate pro-duction from the respiratory chain in the inner mitochondrialmembrane, thereby initiating energy loss via heat production[23,27,35,36]. As reported previously, the observed increase in EEin our RALA-CD mice could be driven by up-regulation of theSirt3–Pgc1–Ucp axis [25,28] as well as of the Dio2–T3–Ucppathway [28,37] as summarized in Figure 5.

We speculate that the increase in EE in the RALA-CD mice ismost likely a direct result of the increase in Ucp1 and Ucp3expression. Interestingly, we did not observe differences inprotein expression of mitochondrial complexes I to V in BAT,liver, and skeletal muscle. Thus energy excess due to the HFD inRALA-CD mice seems to be compensated for by an increase inthermogenesis. Nevertheless, there were no significant changesin BW of the mice in response to RALA-CD treatment. Thus,further studies are needed which may take changes inbody composition (lean body mass versus total body mass) intoaccount.

Conclusion

Our results indicate that RALA-CDmaymodulate EE of C57BL/6J mice. Possibly the up-regulation of the Sirt3–Pgc1a–Ucppathway in BAT contributes to the observed effect. Furthermore,elevated EE could partly be mediated by induction of the Dio2–T3–Ucp pathway. It also should be pointed out that BAT is usuallyrelatively low in adult humans compared with mice [38]. Thus,present data in laboratory rodents addressing the effect of RALA-CD on EE should be verified in future human studies.

Acknowledgments

SN is funded by an ILGS DiVA grant. CycloChem Bio Co, Ltd.(president KT) provided funding for this study.

References

[1] Bustamante J, Lodge JK, Marcocci L, Tritschler HJ, Packer L, Rihn BH.a-Lipoic acid in liver metabolism and disease. Free Radic Biol Med 1998;24:1023–39.

S. Nikolai et al. / Nutrition 30 (2014) 228–233 233

[2] Wagner AE, Ernst IM, Birringer M, Sancak O, Barella L, Rimbach G. Acombination of lipoic acid plus coenzyme Q10 induces PGC1a, a masterswitch of energy metabolism, improves stress response, and increasescellular glutathione levels in cultured C2C12 skeletal muscle cells. OxidMed Cell Longev 2012;2012:835970.

[3] Packer L, Kraemer K, Rimbach G. Molecular aspects of lipoic acid in theprevention of diabetes complications. Nutrition 2001;17:888–95.

[4] Hagen TM, Ingersoll RT, Lykkesfeldt J, Liu J, Wehr CM, Vinarsky V, et al. (R)-Alpha-lipoic acid-supplemented old rats have improved mitochondrialfunction, decreased oxidative damage, and increased metabolic rate. FASEBJ 1999;13:411–8.

[5] Wang Y, Li X, Guo Y, Chan L, Guan X. alpha-Lipoic acid increases energyexpenditure by enhancing adenosine monophosphate-activated proteinkinase-peroxisome proliferator-activated receptor-gamma coactivator-1-alpha signaling in the skeletal muscle of aged mice. Metabolism 2010;59:967–76.

[6] Finlay LA, Michels AJ, Butler JA, Smith EJ, Monette JS, Moreau RF, et al. R-a-lipoic acid does not reverse hepatic inflammation of aging, but lowers lipidanabolism, while accentuating circadian rhythm transcript profiles. Am JPhysiol Regul Integr Comp Physiol 2012;302:R587–97.

[7] Sparks LM, Xie H, Koza RA, Mynatt R, Hulver MW, Bray GA, et al. A high-fatdiet coordinately downregulates genes required for mitochondrial oxida-tive phosphorylation in skeletal muscle. Diabetes 2005;54:1926–33.

[8] Jia L, Liu Z, Sun L, Miller SS, Ames BN, Cotman CW, et al. A toxicant incigarette smoke, causes oxidative damage and mitochondrial dysfunctionin RPE cells: protection by (R)-alpha-lipoic acid. Invest Ophthalmol Vis Sci2007;48:339–48.

[9] Ikuta N, Sugiyama H, Shimosegawa H, Nakane R, Ishida Y, Uekaji Y, et al.Analysis of the enhanced stability of R(þ)-alpha lipoic acid by the complexformation with cyclodextrins. Int J Mol Sci 2013;14:3639–55.

[10] Boesch-Saadatmandi C, Egert S, Schrader C, Coumol X, Barouki R,Muller MJ, et al. Effect of quercetin on paraoxonase 1 activity–studies incultured cells, mice and humans. J Physiol Pharmacol 2010;61:99–105.

[11] Cremer DR, Rabeler R, Roberts A, Lynch B. Safety evaluation of a-lipoic acid(ALA). Regul Toxicol Pharmacol 2006;46:29–41.

[12] Xiao Y, Cui J, Shi Y, Le G. Lipoic acid increases the expression of genesinvolved in bone formation in mice fed a high-fat diet. Nutr Res 2011;31:309–17.

[13] Cui J, Xiao Y, Shi YH, Wang B, Le GW. Lipoic acid attenuates high-fat-diet-induced oxidative stress and B-cell-related immune depression. Nutrition2012;28:275–80.

[14] Abadi A, Crane JD, Ogborn D, Hettinga B, Akhtar M, Stokl A, et al. Supple-mentation with a-lipoic acid, CoQ10, and vitamin E augments runningperformance and mitochondrial function in female mice. PLoS One2013;8:e60722.

[15] Cremer DR, Rabeler R, Roberts A, Lynch B. Long-term safety of a-lipoic acid(ALA) consumption: a 2-year study. Regul Toxicol Pharmacol 2006;46:193–201.

[16] Packer L, Weber SU, Rimbach G. Molecular aspects of alpha-tocotrienolantioxidant action and cell signalling. J Nutr 2001;131:369S–73S.

[17] Shay KP, Moreau RF, Smith EJ, Smith AR, Hagen TM. Alpha-lipoic acid as adietary supplement: molecular mechanisms and therapeutic potential.Biochim Biophys Acta 2009;1790:1149–60.

[18] Kondo H, Nakatani H, Hiromi K. In vitro action of human and porcinea-amylases on cyclo-malto-oligosaccharides. Carbohydr Res 1990;204:207–13.

[19] Lumholdt LR, Holm R, Jørgensen EB, Larsen KL. In vitro investigations of a-amylase mediated hydrolysis of cyclodextrins in the presence of ibuprofen,flurbiprofen, or benzo[a]pyrene. Carbohydr Res 2012;362:56–61.

[20] Iwamoto H, Ohmori M, Ohno M, Hirose J, Hiromi K, Fukada H, Takahashi K,Hashimoto H, Sakai S. Interaction between pullulanase from Klebsiellapneumoniae and cyclodextrins. J Biochem 1993;113:93–6.

[21] Belshaw NJ, Williamson G. Interaction of b-cyclodextrin with the granularstarch binding domain of glucoamylase. Biochim Biophys Acta 1991;1078:117–20.

[22] Fukuda K, Teramoto Y, Goto M, Sakamoto J, Mitsuiki S, Hayashida S. Specificinhibition by cyclodextrins of raw starch digestion by fungal glucoamylase.Biosci Biotech Biochem 1992;56:556–9.

[23] Kopecky J, Clarke G, Enerbäck S, Spiegelman B, Kozak LP. Expression of themitochondrial uncoupling protein gene from the aP2 gene promoter pre-vents genetic obesity. J Clin Invest 1995;96:2914–23.

[24] Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, et al.Mechanisms controlling mitochondrial biogenesis and respiration throughthe thermogenic coactivator PGC-1. Cell 1999;98:115–24.

[25] Hokari F, Kawasaki E, Sakai A, Koshinaka K, Sakuma K, Kawanaka K. Musclecontractile activity regulates Sirt3 protein expression in rat skeletal mus-cles. J Appl Physiol 2010;109:332–40.

[26] Shi T, Wang F, Stieren E, Tong Q. SIRT3, a mitochondrial sirtuin deacetylase,regulates mitochondrial function and thermogenesis in brown adipocytes.J Biol Chem 2005;280:13560–7.

[27] Lin SC, Li P. CIDE-A, a novel link between brown adipose tissue and obesity.Trends Mol Med 2004;10:434–9.

[28] Marsili A, Aguayo-Mazzucato C, Chen T, Kumar A, Chung M, Lunsford EP,et al. Mice with a targeted deletion of the type 2 deiodinase are insulinresistant and susceptible to diet induced obesity. PLoS One 2011;6:e20832.

[29] Villena JA, Hock MB, Chang WY, Barcas JE, Gigu�ere V, Kralli A. Orphannuclear receptor estrogen-related receptor alpha is essential for adaptivethermogenesis. Proc Natl Acad Sci USA 2007;104:1418–23.

[30] Kong X, Wang R, Xue Y, Liu X, Zhang H, Chen Y, et al. Sirtuin 3, a new targetof PGC-1alpha, plays an important role in the suppression of ROS andmitochondrial biogenesis. PlosOne 2010;5:e11707.

[31] Kozak L. The genetics of brown adipocyte induction in white fat depots.Front Endocrinol (Lausanne) 2011;2:64.

[32] Bianco AC, Silva JE. Optimal response of key enzymes and uncouplingprotein to cold in BAT depends on local T3 generation. Am J Physiol1987;253:E255–63.

[33] Scarpace PJ, Matheny M, Pollock BH, Tümer N. Leptin increases uncouplingprotein expression and energy expenditure. Am J Physiol 1997;273:E226–30.

[34] Schrauwen P, Xia J, Bogardus C, Pratley RE, Ravussin E. Skeletal muscleuncoupling protein 3 expression is a determinant of energy expenditure inPima Indians. Diabetes 1999;48:146–9.

[35] Ricquier D. Respiration uncoupling and metabolism in the control of en-ergy expenditure. Proc Nutr Soc 2005;64:47–52.

[36] Kozak LP, Harper ME. Mitochondrial uncoupling proteins in energyexpenditure. Annu Rev Nutr 2000;20:339–63.

[37] Suzuki D, Murata Y, Oda S-I. Changes in Ucp1, D2 (Dio2) and Glut 4 (Slc2a4)mRNA expression in response to short-term cold exposure in the housemusk shrew (Suncus murinus). Exp Anim 2007;56:279–88.

[38] Vosselman MJ, van Marken Lichtenbelt WD, Schrauwen P. Energy dissi-pation in brown adipose tissue: from mice to men. Mol Cell Endocrinol;2013 Apr 28. pii:S0303–7207(13)00162–7.