IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple...

57
IgA nephropathy Ιωάννης Γ. Γριβέας,MD,PhD

Transcript of IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple...

Page 1: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.

IgA nephropathy

Ιωάννης Γ. Γριβέας,MD,PhD

Page 2: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 3: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 4: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 5: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 6: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 7: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 8: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 9: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 10: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 11: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 12: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 13: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 14: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 15: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 16: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 17: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 18: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 19: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 20: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 21: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 22: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 23: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 24: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 25: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 26: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 27: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 28: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 29: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 30: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 31: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 32: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 33: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 34: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 35: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 36: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 37: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 38: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 39: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 40: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 41: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 42: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 43: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 44: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 45: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 46: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 47: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 48: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 49: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 50: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 51: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 52: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 53: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 54: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 55: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 56: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.
Page 57: IgA nephropathy - Athens-Nephrology · Immunoglobulin A nephropathy probably can result multiple different etiologies and such as (1) ,Abnormal structure and function of IgA molecules.

Understanding secondary antibodies - Boston … 2 5-0 5 / 1 0-F F Anti-IgM Anti-IgA Secondary antibodies Anti-IgG H&L Host Target Conjugate Applications Datasheet €¦ Donkey Goat

Understanding secondary antibodies - Boston … 2 5-0 5 / 1 0-F F Anti-IgM Anti-IgA Secondary antibodies Anti-IgG H&L Host Target Conjugate Applications Datasheet €¦ Donkey Goat

Sup Figure1 160707 - media.nature.com · aagatacgattactacggtagtagctactttgactactgg LP IgA ... (α4β7) and IgD on normal B cells and GFP+ memory B cells. The memory B cells also expressed

Sup Figure1 160707 - media.nature.com · aagatacgattactacggtagtagctactttgactactgg LP IgA ... (α4β7) and IgD on normal B cells and GFP+ memory B cells. The memory B cells also expressed

SIEROPROTEINE · - La VES aumenta alla fine della prima settimana di malattia e nelle gammopatie monoclonali da IgM, IgA, IgG. Intervalli di riferimento VES ... - E’ una proteina

SIEROPROTEINE · - La VES aumenta alla fine della prima settimana di malattia e nelle gammopatie monoclonali da IgM, IgA, IgG. Intervalli di riferimento VES ... - E’ una proteina

ACUTE PERITONEAL DIALYSIS ALTERNATIVE FORM OF CRRT Mignon McCulloch Departments of Paediatric Nephrology & PICU Red Cross Children’s Hospital & University.

ACUTE PERITONEAL DIALYSIS ALTERNATIVE FORM OF CRRT Mignon McCulloch Departments of Paediatric Nephrology & PICU Red Cross Children’s Hospital & University.

IGA Lecture II: Dirac Geometry · IGA Lecture II: Dirac Geometry Eckhard Meinrenken Adelaide, September 6, 2011 Eckhard Meinrenken IGA Lecture II: Dirac Geometry. Dirac geometry Dirac

IGA Lecture II: Dirac Geometry · IGA Lecture II: Dirac Geometry Eckhard Meinrenken Adelaide, September 6, 2011 Eckhard Meinrenken IGA Lecture II: Dirac Geometry. Dirac geometry Dirac

Effects of TGF-β1 in ischemia / reperfusion injury and ... · 2.1. Part I: Expression of TGF ... (Ponticelli C. 2000). It has now become clear that chronic allograft nephropathy

Effects of TGF-β1 in ischemia / reperfusion injury and ... · 2.1. Part I: Expression of TGF ... (Ponticelli C. 2000). It has now become clear that chronic allograft nephropathy

Diabetic nephropathy · incidence of diabetic nephropathy doubled from the years 1991–2001 . Fortunately, the rate of increase has slowed down, probably because of the adoption

Diabetic nephropathy · incidence of diabetic nephropathy doubled from the years 1991–2001 . Fortunately, the rate of increase has slowed down, probably because of the adoption

Protocollo 101 : TSH Reflex AL SUD - aslal.it · Ricerca morbo celiaco Screening e Approfondimento Dosaggio IgA Anti transglutaminasi tTG-IgA Negativo IgA totali > 5 mg/dl STOP tTG-IgA

Protocollo 101 : TSH Reflex AL SUD - aslal.it · Ricerca morbo celiaco Screening e Approfondimento Dosaggio IgA Anti transglutaminasi tTG-IgA Negativo IgA totali > 5 mg/dl STOP tTG-IgA

EL-β2GPI (IgM-IgG-IgA)™ · The TheraTest EL-β2GPI (IgM, IgG, IgA) is a set of in vitro diagnostic tests for the measurement of IgM, IgG, and IgA autoantibodies in human serum

EL-β2GPI (IgM-IgG-IgA)™ · The TheraTest EL-β2GPI (IgM, IgG, IgA) is a set of in vitro diagnostic tests for the measurement of IgM, IgG, and IgA autoantibodies in human serum

Original Article Effects of Jiangya Xiaoke prescription on ...in diabetic nephropathy rats with hypertension 5131 Int J Clin Exp Med 2015;8(4):5129-5136 control group (n = 10). After

Original Article Effects of Jiangya Xiaoke prescription on ...in diabetic nephropathy rats with hypertension 5131 Int J Clin Exp Med 2015;8(4):5129-5136 control group (n = 10). After

The effects of ozone therapy on caspase pathways, TNF-α ......diabetic nephropathy in rats. Also the histopathological changes in diabetic kidney tissue with ozone treatment were

The effects of ozone therapy on caspase pathways, TNF-α ......diabetic nephropathy in rats. Also the histopathological changes in diabetic kidney tissue with ozone treatment were

Opisna geometrija II. DVO^RTNI POSTOPEK · @iga Turk Opisna geometrija - kopije prosojnic II/1 97/10 1 Opisna geometrija II. DVO^RTNI POSTOPEK 2 Dvo~rtni postopek • Pridru`ni ortogonalni

Opisna geometrija II. DVO^RTNI POSTOPEK · @iga Turk Opisna geometrija - kopije prosojnic II/1 97/10 1 Opisna geometrija II. DVO^RTNI POSTOPEK 2 Dvo~rtni postopek • Pridru`ni ortogonalni

e-monsiteasklepiosentraide.e-monsite.com/medias/files/5-les... · Web viewPlus de 90% des IgA sécrétés par un plasmocyte le sont sous forme de dimère permettant de les stabiliser

e-monsiteasklepiosentraide.e-monsite.com/medias/files/5-les... · Web viewPlus de 90% des IgA sécrétés par un plasmocyte le sont sous forme de dimère permettant de les stabiliser

Original Article Reduced beta 2 glycoprotein I improves ... · PDF fileReduced beta 2 glycoprotein I improves diabetic nephropathy via inhibiting TGF-β1-p38 MAPK pathway Tong Wang,

Original Article Reduced beta 2 glycoprotein I improves ... · PDF fileReduced beta 2 glycoprotein I improves diabetic nephropathy via inhibiting TGF-β1-p38 MAPK pathway Tong Wang,

XI ΙΑΗΝ CONGRESS - IAHN · Most historians of medicine would name major figures in the founding of 20th Century North American Nephrology in the 1920s and 1930s as Henry Christian,

XI ΙΑΗΝ CONGRESS - IAHN · Most historians of medicine would name major figures in the founding of 20th Century North American Nephrology in the 1920s and 1930s as Henry Christian,

ΕΛΛΗΝΙΚΗ ∆ΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ Η ... · 2019-03-06 · 1 enothta 1 25 182022 vzv igm, iga ΕΞΕΤ ΠΑ.Γ.Ν.Η. 480 2,1500 1.279,68 1 enothta

ΕΛΛΗΝΙΚΗ ∆ΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ Η ... · 2019-03-06 · 1 enothta 1 25 182022 vzv igm, iga ΕΞΕΤ ΠΑ.Γ.Ν.Η. 480 2,1500 1.279,68 1 enothta

IgA SALIVA ELISA - Diametra IFU IgA saliva CE.pdf · temperatura controllata di 2-8°C nei loro contenitori originali. Eventuali eccezioni sono chiaramente indicate. I reagenti sono

IgA SALIVA ELISA - Diametra IFU IgA saliva CE.pdf · temperatura controllata di 2-8°C nei loro contenitori originali. Eventuali eccezioni sono chiaramente indicate. I reagenti sono

IFE ISE sjdiem · una componente monoclonale ... IgG e un rapporto κ/λdelle catene leggere libere nel siero ... Una CM, di solito IgA Lambda, ...

IFE ISE sjdiem · una componente monoclonale ... IgG e un rapporto κ/λdelle catene leggere libere nel siero ... Una CM, di solito IgA Lambda, ...

Diabetic nephropathy is a clinical syndrome.

Diabetic nephropathy is a clinical syndrome.

Occurrence and development of diabetic nephropathy caused ... · Diabetic nephropathy affected by Wnt-`-catenin signaling pathway inhibited by CD63 285 the pathological process of

Occurrence and development of diabetic nephropathy caused ... · Diabetic nephropathy affected by Wnt-`-catenin signaling pathway inhibited by CD63 285 the pathological process of