biologia kat 3o 4o

Click here to load reader

  • date post

    12-Mar-2016
  • Category

    Documents

  • view

    219
  • download

    3

Embed Size (px)

description

biologia kat themata panellinion 3o kai 4o thema

Transcript of biologia kat 3o 4o

  • -

    -1-

    3 210 42.56.128

  • -

    -2-

    3 210 42.56.128

  • - 2000-2012

    -3-

    3 210 42.56.128

    . 2000 :

    3 , . .

    . 9

    . .

    9 . .

    7

    4 46 . . 1. DNA ,

    ;

    2. . 4

    . , , .

    M 9

    . DNA :

    5- C CGG AAT TTC TAG CAT -3 .

    1. , m-RNA DNA, 5 3 m-RNA.

    3 2. t-RNA

    m-RNA. M 7

  • - 2000-2012

    -4-

    3 210 42.56.128

    . 2000 :

    3 .

    . )

    ; 7

    ) ;

    8

    . , ;

    10 4 DNA

    ) ; 8

    ) mRNA ; 8

    ) mRNA - , - mRNA .

    9

    - T A C - A G T - G G A - G A A - G C T - A T T - ( 1) - - A T G - T C A - C C T - C T T - C G A - T A A - ( 2)

  • - 2000-2012

    -5-

    3 210 42.56.128

    . 2001 :

    3 1. %

    .

    1, 2 ; 2

    . 3

    2. Zea mays () . 20 109 , 5 109 10 109 . .

    12

    3. (ADA) . mRNA ADA . mRNA :

    : AUG GAA UUU UGG GGG CGC ACG UCG..........

    : AUG GAA UUU UAG GGG CGC ACG UCG..........

    . ; 6

    . ; 2

    4 :

    - -1, -2 .- -2, -3

    .

    -1 -2 : .

    4

    . 5

    . . 6

    . 10

    C G

    1: 28 28 22 22

    2: 31 31 19 19

  • - 2000-2012

    -6-

    3 210 42.56.128

    . 2001 :

    3 1.

    . 10

    2. . . . .

    5

    . . 10

    4 . , , . . 100 .

    x : 51 49 .

    x : 100 .

    x : 24 26 25 25 .

    .

    . . 10

    . , . 15

  • - 2000-2012

    -7-

    3 210 42.56.128

    . 2001 :

    3 N : 1.

    . ;

    10 2.

    (). ;

    15 4

    mRNA:

    - AUU - UCA - CCU - CUU - CGA - CAA

    1. mRNA , DNA ' .

    10 2. ;

    10 3. DNA 50%;

    5

  • - 2000-2012

    -8-

    3 210 42.56.128

    . 2001 :

    5

    2 1. ;

    10

    2. ;

    5

    3. .

    10

    3 1. DNA

    . .

    6

    2. . 12

    3. "" mRN. 7

    4 . . . .

    . ; 2

    . 8

    . ; 4

    . 11

  • - 2000-2012

    -9-

    3 210 42.56.128

    . 2002 :

    3 1. DNA .

    5 3 GAATTCTTAATGCAGATCATAAAGAATTCTAG CTTAAGAATTACGTCTAGTATTT C TTAAGATC

    3 5 DNA EcoRI, , . .

    6

    . 8

    .

    2. , Cri-du-chat ( ) 3.

    . . 8

    . ; 3

    4 , , : . . , .

    . F1 F2 .

    4

    . F2 . 9

    . F2 , - , .

    12

  • - 2000-2012

    -10-

    3 210 42.56.128

    . 2002 :

    3

    1. .

    6

    ;

    4

    2. , :

    C- - - - - -- - - - - -2

    . .

    6

    . 3 5 . 2

    . 7

    :

    4 .

    1 () .

    2 () -.

    , II2 () .

    . .

    5

    . I II . 8

    . II1 . .

    12

    GCU

    GUG

    ACU

    CUA

    AAG

    AUG

    CCG

    UCG

  • - 2000-2012

    -11-

    3 210 42.56.128

    . 2002 :

    2 A. ,

    . 1. 51 ...........

    .............. .............. ...........

    2. mRNA mRNA ............ , .......... .

    9

    . .

    1. ; 8

    2. ; 4

    3. ; 4

    3 . 1. ;

    5

    2. ; 8

    .

    1. .

    2. . 12

    4 DNA :

    ) 35 53; ;

    8

    ) mRNA ; 8

    ) mRNA . tRNA .

    9

    - A T G - C G A - C C T - T C A - C G A - C T T - - ( )

    - T A C - G C T - G G A - A G T - G C T - G A A - A T T ( )

  • - 2000-2012

    -12-

    3 210 42.56.128

    . 2002 :

    3

    1. DNA , ; 12

    2. . 8

    3. ; 5

    4 , , . . , .

    . ; 2

    . 8

    . ; 5

    . 10

  • - 2000-2012

    -13-

    3 210 42.56.128

    . 2003 :

    3 1. ;

    10

    2. . ; .

    15

    4 DNA, :

    - - - -

    .

    1. DNA, ( 3) ( 9).

    12

    2. DNA :

    - - - -

    ( 6) ( 7).

    13

    . UAU AUA

    : /:

    : /:

    : /:

  • - 2000-2012

    -14-

    3 210 42.56.128

    . 2003 :

    3 .

    1. ; 5

    2. ; 5

    3. .

    15

    4 . (3), (6) (7) .

    1. ; 5

    2. .

    9

    3. (8) (9) ; ( 3). ( 8).

    11

  • - 2000-2012

    -15-

    3 210 42.56.128

    . 2003 :

    3 . Bacillus thuringiensis ,

    . ;

    10

    . ; 5

    ;

    10

    4 , , - :

    (tyr) - UAU (phe) - UUU (pro) - CCC

    ) mRNA :

    - phe - phe - pro - tyr - tyr - pro - 5

    ) DNA , 3 5 .

    15

    ) DNA;

    5

  • - 2000-2012

    -16-

    3 210 42.56.128

    . 2003 :

    3 . 1990,

    (ADA). .

    10

    . 1.

    . 3

    2. .

    6

    3. , . 6

    4 DNA, :

    (I) ... TT T TA C G TT AT G A A AG A TA C TC GG C T C ...

    (II) ... AA A AT G C AAT A C TT T CT A T GA GC C G A G ...

    . , () (), ; 10

    . m-RNA DNA 3 5 .

    5

    . ; 5

    . t-RNA m-RNA.

    5

  • - 2000-2012

    -17-

    3 210 42.56.128

    . 2004 :

    3 , , Turner (). 1.

    . 7

    2. Turner; 6

    3. Turner .

    12

    4 , . .

    . . 6

    . .

    12

    . , ( 2), ( 5).

    7

  • - 2000-2012

    -18-

    3 210 42.56.128

    . 2004 :

    3 , - .

    1. ; 6

    2. ;

    6

    3. - ;

    8

    4. ; 5

    4 . 2 , II2 2 () , 2 II3 () .

    1. . ( ).

    7

    2. .

    8

    3. 2 1 .

    10

  • - 2000-2012

    -19-

    3 210 42.56.128

    . 2004 :

    2

    3

    . ; 5

    . . 15

    . .

    5

    4 Escherichia coli .

    . t0 t1 ;

    5

    . t1 t2 ;

    5

    . t3, , 80 0C. . t3 , .

    15

  • - 2000-2012

    -20-

    3 210 42.56.128

    . 2004 :

    3 . DNA, ,

    :

    . , DNA , 3 5 .

    5

    . DNA . ;

    10

    . . ;

    5

    . Klinefelter; 5

    4 , , .

    . ; .

    6

    . ; .

    12

    . . ;

    7

  • - 2000-2012

    -21-

    3 210 42.56.128

    . 2005 :

    3 .

    1.

    . .

    . ( 2).

    ( 12).

    14

    2. ; 5

    3. ; 6

    4 DNA ,

    , :`

    H