RESEARCH ARTICLE

Transforming Growth Factor-b1 PrimesProliferating Adult Neural Progenitor Cells

to Electrophysiological Functionality

Sabrina Kraus1 Bernadette Lehner2 Nadine Reichhart13 Sebastien Couillard-Despres45

Katrin Wagner45 Ulrich Bogdahn2 Ludwig Aigner45 and Olaf Strauszlig13

The differentiation of adult neural progenitors (NPCs) into functional neurons is still a limiting factor in the neural stem cellfield but mandatory for the potential use of NPCs in therapeutic approaches Neuronal function requires the appropriate elec-trophysiological properties Here we demonstrate that priming of NPCs using transforming growth factor (TGF)-b1 underconditions that usually favor NPCsrsquo proliferation induces electrophysiological neuronal properties in adult NPCs Gene chiparray analyses revealed upregulation of voltage-dependent ion channel subunits (Kcnd3 Scn1b Cacng4 and Accn1) neuro-transmitters and synaptic proteins (Cadps Snap25 Grik4 Gria3 Syngr3 and Gria4) as well as other neuronal proteins (dou-blecortin [DCX] Nrxn1 Sept8 and Als2cr3) Patch-clamp analysis demonstrated that control-treated cells expressed onlyvoltage-dependent K1-channels of the delayed-rectifier type and the A-type channels TGF-b1-treated cells possessed morenegative resting potentials than nontreated cells owing to the presence of delayed-rectifier and inward-rectifier channels Fur-thermore TGF-b1-treated cells expressed voltage-dependent TTX-sensitive Na1 channels which showed increasing currentdensity with TGF-b1 treatment duration and voltage-dependent (1)BayK8644-sensitive L-Type Ca21 channels In contrast tonontreated cells TGF-b1-treated cells responded to current injections with action-potentials in the current-clamp mode Fur-thermore TGF-b1-treated cells responded to application of GABA with an increase in membrane conductance and showedspontaneous synaptic currents that were blocked by the GABA-receptor antagonist picrotoxine Only NPCs which weretreated with TGF-b1 showed Na1 channel currents action potentials and GABAergic currents In summary stimulation ofNPCs by TGF-b1 fosters a functional neuronal phenotype which will be of relevance for future cell replacement strategies inneurodegenerative diseases or acute CNS lesions

GLIA 2013611767-1783Key words adult neural progenitor cells neuronal excitability action potential firing voltage-gated ion channels

Introduction

The identification of neural stem and progenitor cells

(NPCs) in the adult brain opened the potential for the

development of NPC transplantation-based therapies for the

degenerating or acutely injured central nervous system

(CNS) Indeed NPCs can be isolated from the adult brain

and expanded under the stimulation of basic fibroblast

growth factor (bFGF) and epidermal growth factor (EGF) in

adherent or in suspension (neurosphere) cultures with high

efficacy (Babu et al 2011 Reynolds et al 1992 Steffenha-

gen et al 2011 Wachs et al 2003) In vitro the differentia-

tion of NPCs into neurons typically requires growth-factor

removal and the addition of active molecules such as retinoic

acid or valproic acid or of neurotrophic factors such as brain-

derived neurotrophic factor (BDNF) (Hsieh and Gage 2004

Takahashi et al 1999)

In culture the frequency of neuronal differentiation of

NPCs as assessed by means of immunohistochemistry is

sparse and typically lt30 (Babu et al 2011 Steffenhagen

et al 2011 Takahashi et al 1999 Wachs et al 2003)

View this article online at wileyonlinelibrarycom DOI 101002glia22551

Published online 30 August 2013 in Wiley Online Library (wileyonlinelibrarycom) Received June 26 2013 Accepted for publication June 27 2013

Address correspondence to Olaf Strauszlig Experimental Ophthalmology Ophthalmology Charite Universiteuroatsmedizin Berlin Augustenburger Platz 1 13353 Berlin

Germany E-mail olafstrausscharitede or Ludwig Aigner Institute of Molecular Regenerative Medicine Spinal Cord Injury and Tissue Regeneration Center

Salzburg Paracelsus Medical University Strubergasse 21 5020 Salzburg Austria E-mail ludwigaignerpmuacat

From the 1Department of Experimental Ophthalmology Eye Clinic University Medical Center Regensburg Regensburg Germany 2Department of Neurology

University Medical Center Regensburg Regensburg Germany 3Department of Experimental Ophthalmology Ophthalmology Charite Universitaetsmedizin Berlin

Berlin Germany 4Institute of Molecular Regenerative Medicine Paracelsus Medical University Salzburg Austria 5Spinal Cord Injury and Tissue Regeneration

Center Salzburg Paracelsus Medical University Salzburg Austria

VC 2013 Wiley Periodicals Inc 1767

Moreover following transplantation of in vitro-expanded

NPCs into the hippocampus which represents a neurogenic

niche only 3ndash5 of implanted cells will generate neurons

(Shetty et al 2008) The situation is even worse after trans-

plantation into non-neurogenic regions such as the spinal

cord where none of the transplanted NPCs differentiate and

integrate as functional neurons (Shihabuddin et al 2000

Vroemen et al 2003) This poor neuronal differentiation

potential is in sharp contrast to the behavior of endogenous

NPCs present in the two main neurogenic niches of the adult

brain that is the hippocampal dentate gyrus and the subven-

tricular zoneolfactory bulb system Within these neurogenic

zones approximately 90 of proliferating NPCs differentiate

into neurons (Brown et al 2003)

In vitro culture conditions are therefore lacking pro-

neuronal stimuli to adequately support the full potential of

NPCs for neuronal differentiation Moreover the application

of EGF and bFGF according to the actual methods might

weaken the potential of NPCs to differentiate into neurons

This hypothesis was supported by a recent report describing

a NPC culture protocol devoid of EGF and bFGF that dem-

onstrated the intrinsic neuronal fate of NPCs (Costa et al

2011) However in the absence of EGF and bFGF NPCs do

not proliferate and therefore the protocol established by Costa

and colleagues is unsuitable for NPC expansion in culture

Moreover EGF regulates in vivo the expansion self-renewal

and maintenance of endogenous NPCs in neural stem cell

niches (Aguirre et al 2010) Hence it is not the presence of

the EGF per se that mitigates the NPCsrsquo neuronal differentia-

tion capacity

Here we are aiming to identify in vitro culture condi-

tions that exploit the full potential of adult NPCs that is

proliferation as well as functional neuronal differentiation

We hypothesize that priming of NPCs while they are still

expanding under EGF and bFGF stimulation constitutes a

key step in obtaining functional neurons In support of this

hypothesis exposure of proliferating NPCs to lithium chlo-

ride has been shown to approximately double the efficacy to

generate neurons at the expense of an astroglial fate (Vazey

and Connor 2009) Similarly pretreatment of proliferating

fetal NPCs with BDNF elevates the production of neurons

from approximately 20ndash55 (Ito et al 2003)

Because of its pleiotropic activities TGF-b1 represents an

attractive candidate factor for the neuronal priming of NPCs

First TGF-b1 counteracts the mitogenic effects of EGF and

bFGF and efficiently induced a cell-cycle arrest in NPCs

(Buckwalter et al 2006 Kandasamy et al 2010 Wachs et al

2006) Second TGF-b1 promotes neuronal differentiation

such as neurite outgrowth in hippocampal neurons in vitro(Ishihara et al 1994) increases the expression of neuronal dif-

ferentiation markers in mouse cortical and hippocampal pro-

genitors (Vogel et al 2010) and promotes dopaminergic

differentiation of mesencephalic progenitors (Roussa et al

2006) Moreover TGF-b1 is neuroprotective an activity that

could be particularly relevant in neurodegenerative diseases

(Aigner and Bogdahn 2008 Caraci et al 2011 Dhandapani

and Brann 2003 Henrich-Noack et al 1996 Prehn et al

1993 Ueberham et al 2006 Unsicker and Krieglstein 2002

Wyss-Coray 2006 Zhu et al 2001 2004)

In this report we address the potential of TGF-b1 to

prime NPCs under proliferation conditions (PCs) toward a

neuronal fate Although numerous studies assessed neuronal

differentiation by referring to the expression of neuron-specific

markers we are focusing here specifically on electrophysiologi-

cal functionality which is the essence of neuronal performance

Materials and Methods

Cell CultureAdult NPCs derived from the lateral ventricle wall from 3- to 4-

month old female Fischer 344 rats (Charles River Sulzfeld Ger-

many) were isolated and grown as described previously (Steffenhagen

et al 2011 Wachs et al 2003) The single-cell suspension was estab-

lished in NB medium (Gibco BRL Karlsruhe Germany) supple-

mented with B27 (Gibco BRL) (NBB27) 2 mM of L-glutamine

(PAN) 100 UmL of penicillin and 100 lgmL of streptomycin

(PAN Aidenbach Germany) 2 lgmL of heparin (Sigma Tauf-

kirchen Germany) 20 ngmL of bFGF-2 (RampD systems

Wiesbaden-Nordenstadt Germany) and 20 ngmL of EGF (RampD

systems Wiesbaden-Nordenstadt Germany) This medium composi-

tion is defined for PCs in this study Cells were seeded in T-25 cul-

ture flasks and cultures were maintained at 37C in an incubator

with 5 of CO2 Single cells began to form spheres within 5ndash7 days

of suspension culture and continued to grow in mass and number

over the next weeks For passaging of cells the culture medium con-

taining floating neurospheres was collected in a 15-mL centrifuge

tube and centrifuged at 120g for 5 min The pellet was resuspended

in 200 lL of Accutase (PAA Pasching Austria) and triturated

approximately 10 times using a pipette Dissociated cells were centri-

fuged at 120g for 5 min resuspended and reseeded

To prepare cells for patch-clamp analysis NPCs were seeded

at a density of 5 3 104 cellsmL in T75 culture flasks after passag-

ing (Day 0) On the next day TGF-b1 (RampD Systems Wiesbaden-

Nordenstadt Germany) (10 lgmL stock solution in 4 mM HCl

with 1 mgmL bovine serum albumin [BSA]) was added to a final

concentration of 10 ngmL Moreover TGF-b1 was applied at the

same concentration on Days 4 and 7 Control cells received equal

volumes of 4 mM HCl with 1 mgmL BSA instead of TGF-b1

During the 7-day incubation with TGF-b1 the medium was not

changed On Day 8 cells were dissociated with Accutase as described

and reseeded on poly-L-ornithine (250 lgmL) (Sigma Taufkirchen

Germany) and laminin (5 lgmL) (Sigma Germany)-coated glass

coverslips (Menzel GmbH Braunschweig Germany) where cells

readily adhered in 24-well plates at a density of 25 3 104 cells in

500 lL medium per well under PC in the presence or absence of

1768 Volume 61 No 11

TGF-b1 For the next 3 days (Days 9 10 and 11) patch-clamp

recordings were conducted

ImmunocytochemistryImmunocytochemistry was performed as described earlier (Steffenha-

gen et al 2011) The primary antibody used was a rabbit anti-DCX

antibody (1500 Cell Signaling Danvers MA) Detection was per-

formed using a secondary donkey antirabbit Alexa 488-conjugated

antibody (dilution 11000 Invitrogen Molecular Probes Eugene

OR) Nuclear counterstain was obtained using 025 mgmL of 406-

diamidino-2-phenylindole (Sigma Taufkirchen Germany)

Western BlottingVehicle or TGF-b1-treated neurospheres were pelleted and homoge-

nized in 50 lL SUB buffer (05 SDS 2 2-mercaptoethanol and

8 M urea) Homogenates were cleared by centrifugation at 10000g

for 10 min The supernatants were collected and protein concentra-

tions were determined using Bradford assay (Sigma Taufkirchen

Germany) In brief 5 lg of total proteins was separated on a 12

denaturating SDS-PAGE and blotted to a nitrocellulose membrane

The membrane was blocked with fish skin gelatin buffer (20 mM

Tris-HCl pH 73 09 wv NaCl 1 vv fish skin gelatin and

01 vv Tween-20) and incubated with a rabbit anti-DCX antibody

(dilution 12000 Cell Signaling Danvers MA) For normalization

a rabbit antiactin antibody (Sigma 15000) was used Visualization

was performed with a secondary horseradish peroxidase-coupled don-

key antirabbit antibody (Dianonva Hamburg Germany 110000)

and ECL-plus chemiluminescence system (GE Healthcare Amer-

sham Munich Germany) Quantification of band intensities was

performed with the ImageJ software (httprsbinfonihgovij)

Gene Chip ArrayRNAs were isolated from NPC cultures treated for 7 days with

TGF-b1 or the vehicle solution (4 mM HCl 1 mgmL BSA) using

RNeasy Midi Kit (Qiagen Hilden Germany) according to the man-

ufacturersquos protocol Hybridization was performed on Affymetrix

GeneChip rat genome 230 20 Array and Affymetrix GeneChip rat

expression 230A array (Affymetrix High Wycombe United King-

dom) Arrays were stained at the Affymetrix Fluidics Station 400

and scanned with the Hewlett Packard GeneArray scanner G2500A

to visualize hybridization For quality control of both microarray

analyses a GCOS expression report file was generated and evaluated

Single-array analyses were performed with Affymetrix Gene Chip-

Operating Software (GCOS 12) and Affymetrix Microarray Suite

50 Software (MAS 50) using Affymetrix default settings To com-

pare the arrays of the two experiments global scaling was used for

normalization Statistical analysis was performed by using the statisti-

cal software R (httpwwwr-projectorg) To identify the biological

function of the significantly regulated genes Gene Ranker Software

(Genomatix Munich Germany) was used The detailed information

on the array will be published elsewhere

Quantitative RT-PCRTotal RNA was isolated using RNeasy Mini Kit (Qiagen Hilden

Germany) by following the manufacturersquos protocol and 1 lg of

RNA was reversed transcribed using Promega reverse transcription

system (Promega Mannheim Germany) Real-time PCR was per-

formed with Mx 3000 P qPCR System real-time cycler (Stratagene

Waldbronn Germany) using specific primers for DCX (fwd

GGAAGGGGAAAGCTATGTCTG rev TTGCTGCTAGCCAAG

GACTG) and glucose-6-phosphate dehydrogenase (G6PDH) (fwd

CCAGCCTCCACAAGCACCTCAAC rev AATTAGCCCCCAC

GACCCTCAGTA) and QuantiTect SYBR Green PCR kit (Qiagen

Hilden Germany) for detection A standard curve was obtained by

serial dilution of mixed cDNA from control and TGF-b1-treated

cells Results were evaluated using Mx ProTM QPCR software (Stra-

tagene Waldbronn Germany)

Patch-Clamp RecordingsCurrent- and voltage-clamp recordings were performed using the

whole-cell patch-clamp technique at room temperature Coverslips

with adherent NPCs were placed into a perfusion chamber mounted

onto the stage of an inverted microscope For recordings of potas-

sium channels the cells were superfused with a standard bath solu-

tion containing (in mM) 130 NaCl 5 KCl 4 MgCl2 1 CaCl2 25

ethylene glycol tetraacetic acid (EGTA) 10 4-(2-hydroxyethyl)-1-

piperazineethanesulfonic acid (HEPES) and 5 glucose adjusted to

pH 74 with NaOH

Recordings of Ca21 and Na1 currents were performed in a

K1-free bath solution consisting of (in mM) 125 NaCl 05 CaCl2

4 MgCl2 25 EGTA 10 HEPES 5 glucose adjusted to pH 74

with NaOH Pipettes used for experiments to measure Ca21- or

Na1-currents were filled with (in mM) 140 CsCl 1 CaCl2 2

MgCl2 25 EGTA 10 HEPES and 3 ATP pH 74 adjusted with

NaOH Additional 10 mM BaCl2 served as charge carrier to mea-

sure currents through Ca21-channels TTX (10 nM) was added to

the K1-free solution as indicated to identify the contribution of

voltage-dependent Na1 channels Current traces were recorded

before and after the application of TTX (10 nM) and subtracted to

isolate the TTX-sensitive component Delayed rectifying potassium

currents (IK(DR)) were isolated using a 240 mV prepulse to inacti-

vate A-type potassium channels (IK(A)) IK(A) was obtained subtract-

ing IK(DR) from IK(DR1A)

Patch-clamp electrodes were pulled from borosilicate glass

tubes using a Zeitz DMZ Universal Puller (Zeitz Augsburg Ger-

many) and showed a resistance of 3ndash5 MX The pipette solution

used for K1-channel experiments contained (in mM) 140 KCl 2

MgCl2 1 CaCl2 25 EGTA 10 HEPES and 3 ATP pH 74

adjusted with KOH No changes in cell size were observed during

the whole-cell configuration with these solutions

All recordings were made with an HEKA EPC 10 amplifier

(HEKA Electronic Lamprecht Germany) TIDA software (HEKA

Electronic Lamprecht Germany) were used for electrical stimulation

as well as for data acquisition and analysis

If not stated otherwise voltage-dependent currents were acti-

vated using a voltage-step protocol consisting of voltage steps of 10

mV increasing amplitude and 50 ms duration to depolarize cells

from the indicated holding potential (240 mV for K1-currents

measuring and 280 mV for Ca21 and Na1 recordings) This was

followed by voltage steps of 210 mV increasing amplitude and 50

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1769

Moreover following transplantation of in vitro-expanded

NPCs into the hippocampus which represents a neurogenic

niche only 3ndash5 of implanted cells will generate neurons

(Shetty et al 2008) The situation is even worse after trans-

plantation into non-neurogenic regions such as the spinal

cord where none of the transplanted NPCs differentiate and

integrate as functional neurons (Shihabuddin et al 2000

Vroemen et al 2003) This poor neuronal differentiation

potential is in sharp contrast to the behavior of endogenous

NPCs present in the two main neurogenic niches of the adult

brain that is the hippocampal dentate gyrus and the subven-

tricular zoneolfactory bulb system Within these neurogenic

zones approximately 90 of proliferating NPCs differentiate

into neurons (Brown et al 2003)

In vitro culture conditions are therefore lacking pro-

neuronal stimuli to adequately support the full potential of

NPCs for neuronal differentiation Moreover the application

of EGF and bFGF according to the actual methods might

weaken the potential of NPCs to differentiate into neurons

This hypothesis was supported by a recent report describing

a NPC culture protocol devoid of EGF and bFGF that dem-

onstrated the intrinsic neuronal fate of NPCs (Costa et al

2011) However in the absence of EGF and bFGF NPCs do

not proliferate and therefore the protocol established by Costa

and colleagues is unsuitable for NPC expansion in culture

Moreover EGF regulates in vivo the expansion self-renewal

and maintenance of endogenous NPCs in neural stem cell

niches (Aguirre et al 2010) Hence it is not the presence of

the EGF per se that mitigates the NPCsrsquo neuronal differentia-

tion capacity

Here we are aiming to identify in vitro culture condi-

tions that exploit the full potential of adult NPCs that is

proliferation as well as functional neuronal differentiation

We hypothesize that priming of NPCs while they are still

expanding under EGF and bFGF stimulation constitutes a

key step in obtaining functional neurons In support of this

hypothesis exposure of proliferating NPCs to lithium chlo-

ride has been shown to approximately double the efficacy to

generate neurons at the expense of an astroglial fate (Vazey

and Connor 2009) Similarly pretreatment of proliferating

fetal NPCs with BDNF elevates the production of neurons

from approximately 20ndash55 (Ito et al 2003)

Because of its pleiotropic activities TGF-b1 represents an

attractive candidate factor for the neuronal priming of NPCs

First TGF-b1 counteracts the mitogenic effects of EGF and

bFGF and efficiently induced a cell-cycle arrest in NPCs

(Buckwalter et al 2006 Kandasamy et al 2010 Wachs et al

2006) Second TGF-b1 promotes neuronal differentiation

such as neurite outgrowth in hippocampal neurons in vitro(Ishihara et al 1994) increases the expression of neuronal dif-

ferentiation markers in mouse cortical and hippocampal pro-

genitors (Vogel et al 2010) and promotes dopaminergic

differentiation of mesencephalic progenitors (Roussa et al

2006) Moreover TGF-b1 is neuroprotective an activity that

could be particularly relevant in neurodegenerative diseases

(Aigner and Bogdahn 2008 Caraci et al 2011 Dhandapani

and Brann 2003 Henrich-Noack et al 1996 Prehn et al

1993 Ueberham et al 2006 Unsicker and Krieglstein 2002

Wyss-Coray 2006 Zhu et al 2001 2004)

In this report we address the potential of TGF-b1 to

prime NPCs under proliferation conditions (PCs) toward a

neuronal fate Although numerous studies assessed neuronal

differentiation by referring to the expression of neuron-specific

markers we are focusing here specifically on electrophysiologi-

cal functionality which is the essence of neuronal performance

Materials and Methods

Cell CultureAdult NPCs derived from the lateral ventricle wall from 3- to 4-

month old female Fischer 344 rats (Charles River Sulzfeld Ger-

many) were isolated and grown as described previously (Steffenhagen

et al 2011 Wachs et al 2003) The single-cell suspension was estab-

lished in NB medium (Gibco BRL Karlsruhe Germany) supple-

mented with B27 (Gibco BRL) (NBB27) 2 mM of L-glutamine

(PAN) 100 UmL of penicillin and 100 lgmL of streptomycin

(PAN Aidenbach Germany) 2 lgmL of heparin (Sigma Tauf-

kirchen Germany) 20 ngmL of bFGF-2 (RampD systems

Wiesbaden-Nordenstadt Germany) and 20 ngmL of EGF (RampD

systems Wiesbaden-Nordenstadt Germany) This medium composi-

tion is defined for PCs in this study Cells were seeded in T-25 cul-

ture flasks and cultures were maintained at 37C in an incubator

with 5 of CO2 Single cells began to form spheres within 5ndash7 days

of suspension culture and continued to grow in mass and number

over the next weeks For passaging of cells the culture medium con-

taining floating neurospheres was collected in a 15-mL centrifuge

tube and centrifuged at 120g for 5 min The pellet was resuspended

in 200 lL of Accutase (PAA Pasching Austria) and triturated

approximately 10 times using a pipette Dissociated cells were centri-

fuged at 120g for 5 min resuspended and reseeded

To prepare cells for patch-clamp analysis NPCs were seeded

at a density of 5 3 104 cellsmL in T75 culture flasks after passag-

ing (Day 0) On the next day TGF-b1 (RampD Systems Wiesbaden-

Nordenstadt Germany) (10 lgmL stock solution in 4 mM HCl

with 1 mgmL bovine serum albumin [BSA]) was added to a final

concentration of 10 ngmL Moreover TGF-b1 was applied at the

same concentration on Days 4 and 7 Control cells received equal

volumes of 4 mM HCl with 1 mgmL BSA instead of TGF-b1

During the 7-day incubation with TGF-b1 the medium was not

changed On Day 8 cells were dissociated with Accutase as described

and reseeded on poly-L-ornithine (250 lgmL) (Sigma Taufkirchen

Germany) and laminin (5 lgmL) (Sigma Germany)-coated glass

coverslips (Menzel GmbH Braunschweig Germany) where cells

readily adhered in 24-well plates at a density of 25 3 104 cells in

500 lL medium per well under PC in the presence or absence of

1768 Volume 61 No 11

TGF-b1 For the next 3 days (Days 9 10 and 11) patch-clamp

recordings were conducted

ImmunocytochemistryImmunocytochemistry was performed as described earlier (Steffenha-

gen et al 2011) The primary antibody used was a rabbit anti-DCX

antibody (1500 Cell Signaling Danvers MA) Detection was per-

formed using a secondary donkey antirabbit Alexa 488-conjugated

antibody (dilution 11000 Invitrogen Molecular Probes Eugene

OR) Nuclear counterstain was obtained using 025 mgmL of 406-

diamidino-2-phenylindole (Sigma Taufkirchen Germany)

Western BlottingVehicle or TGF-b1-treated neurospheres were pelleted and homoge-

nized in 50 lL SUB buffer (05 SDS 2 2-mercaptoethanol and

8 M urea) Homogenates were cleared by centrifugation at 10000g

for 10 min The supernatants were collected and protein concentra-

tions were determined using Bradford assay (Sigma Taufkirchen

Germany) In brief 5 lg of total proteins was separated on a 12

denaturating SDS-PAGE and blotted to a nitrocellulose membrane

The membrane was blocked with fish skin gelatin buffer (20 mM

Tris-HCl pH 73 09 wv NaCl 1 vv fish skin gelatin and

01 vv Tween-20) and incubated with a rabbit anti-DCX antibody

(dilution 12000 Cell Signaling Danvers MA) For normalization

a rabbit antiactin antibody (Sigma 15000) was used Visualization

was performed with a secondary horseradish peroxidase-coupled don-

key antirabbit antibody (Dianonva Hamburg Germany 110000)

and ECL-plus chemiluminescence system (GE Healthcare Amer-

sham Munich Germany) Quantification of band intensities was

performed with the ImageJ software (httprsbinfonihgovij)

Gene Chip ArrayRNAs were isolated from NPC cultures treated for 7 days with

TGF-b1 or the vehicle solution (4 mM HCl 1 mgmL BSA) using

RNeasy Midi Kit (Qiagen Hilden Germany) according to the man-

ufacturersquos protocol Hybridization was performed on Affymetrix

GeneChip rat genome 230 20 Array and Affymetrix GeneChip rat

expression 230A array (Affymetrix High Wycombe United King-

dom) Arrays were stained at the Affymetrix Fluidics Station 400

and scanned with the Hewlett Packard GeneArray scanner G2500A

to visualize hybridization For quality control of both microarray

analyses a GCOS expression report file was generated and evaluated

Single-array analyses were performed with Affymetrix Gene Chip-

Operating Software (GCOS 12) and Affymetrix Microarray Suite

50 Software (MAS 50) using Affymetrix default settings To com-

pare the arrays of the two experiments global scaling was used for

normalization Statistical analysis was performed by using the statisti-

cal software R (httpwwwr-projectorg) To identify the biological

function of the significantly regulated genes Gene Ranker Software

(Genomatix Munich Germany) was used The detailed information

on the array will be published elsewhere

Quantitative RT-PCRTotal RNA was isolated using RNeasy Mini Kit (Qiagen Hilden

Germany) by following the manufacturersquos protocol and 1 lg of

RNA was reversed transcribed using Promega reverse transcription

system (Promega Mannheim Germany) Real-time PCR was per-

formed with Mx 3000 P qPCR System real-time cycler (Stratagene

Waldbronn Germany) using specific primers for DCX (fwd

GGAAGGGGAAAGCTATGTCTG rev TTGCTGCTAGCCAAG

GACTG) and glucose-6-phosphate dehydrogenase (G6PDH) (fwd

CCAGCCTCCACAAGCACCTCAAC rev AATTAGCCCCCAC

GACCCTCAGTA) and QuantiTect SYBR Green PCR kit (Qiagen

Hilden Germany) for detection A standard curve was obtained by

serial dilution of mixed cDNA from control and TGF-b1-treated

cells Results were evaluated using Mx ProTM QPCR software (Stra-

tagene Waldbronn Germany)

Patch-Clamp RecordingsCurrent- and voltage-clamp recordings were performed using the

whole-cell patch-clamp technique at room temperature Coverslips

with adherent NPCs were placed into a perfusion chamber mounted

onto the stage of an inverted microscope For recordings of potas-

sium channels the cells were superfused with a standard bath solu-

tion containing (in mM) 130 NaCl 5 KCl 4 MgCl2 1 CaCl2 25

ethylene glycol tetraacetic acid (EGTA) 10 4-(2-hydroxyethyl)-1-

piperazineethanesulfonic acid (HEPES) and 5 glucose adjusted to

pH 74 with NaOH

Recordings of Ca21 and Na1 currents were performed in a

K1-free bath solution consisting of (in mM) 125 NaCl 05 CaCl2

4 MgCl2 25 EGTA 10 HEPES 5 glucose adjusted to pH 74

with NaOH Pipettes used for experiments to measure Ca21- or

Na1-currents were filled with (in mM) 140 CsCl 1 CaCl2 2

MgCl2 25 EGTA 10 HEPES and 3 ATP pH 74 adjusted with

NaOH Additional 10 mM BaCl2 served as charge carrier to mea-

sure currents through Ca21-channels TTX (10 nM) was added to

the K1-free solution as indicated to identify the contribution of

voltage-dependent Na1 channels Current traces were recorded

before and after the application of TTX (10 nM) and subtracted to

isolate the TTX-sensitive component Delayed rectifying potassium

currents (IK(DR)) were isolated using a 240 mV prepulse to inacti-

vate A-type potassium channels (IK(A)) IK(A) was obtained subtract-

ing IK(DR) from IK(DR1A)

Patch-clamp electrodes were pulled from borosilicate glass

tubes using a Zeitz DMZ Universal Puller (Zeitz Augsburg Ger-

many) and showed a resistance of 3ndash5 MX The pipette solution

used for K1-channel experiments contained (in mM) 140 KCl 2

MgCl2 1 CaCl2 25 EGTA 10 HEPES and 3 ATP pH 74

adjusted with KOH No changes in cell size were observed during

the whole-cell configuration with these solutions

All recordings were made with an HEKA EPC 10 amplifier

(HEKA Electronic Lamprecht Germany) TIDA software (HEKA

Electronic Lamprecht Germany) were used for electrical stimulation

as well as for data acquisition and analysis

If not stated otherwise voltage-dependent currents were acti-

vated using a voltage-step protocol consisting of voltage steps of 10

mV increasing amplitude and 50 ms duration to depolarize cells

from the indicated holding potential (240 mV for K1-currents

measuring and 280 mV for Ca21 and Na1 recordings) This was

followed by voltage steps of 210 mV increasing amplitude and 50

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1769

TGF-b1 For the next 3 days (Days 9 10 and 11) patch-clamp

recordings were conducted

ImmunocytochemistryImmunocytochemistry was performed as described earlier (Steffenha-

gen et al 2011) The primary antibody used was a rabbit anti-DCX

antibody (1500 Cell Signaling Danvers MA) Detection was per-

formed using a secondary donkey antirabbit Alexa 488-conjugated

antibody (dilution 11000 Invitrogen Molecular Probes Eugene

OR) Nuclear counterstain was obtained using 025 mgmL of 406-

diamidino-2-phenylindole (Sigma Taufkirchen Germany)

Western BlottingVehicle or TGF-b1-treated neurospheres were pelleted and homoge-

nized in 50 lL SUB buffer (05 SDS 2 2-mercaptoethanol and

8 M urea) Homogenates were cleared by centrifugation at 10000g

for 10 min The supernatants were collected and protein concentra-

tions were determined using Bradford assay (Sigma Taufkirchen

Germany) In brief 5 lg of total proteins was separated on a 12

denaturating SDS-PAGE and blotted to a nitrocellulose membrane

The membrane was blocked with fish skin gelatin buffer (20 mM

Tris-HCl pH 73 09 wv NaCl 1 vv fish skin gelatin and

01 vv Tween-20) and incubated with a rabbit anti-DCX antibody

(dilution 12000 Cell Signaling Danvers MA) For normalization

a rabbit antiactin antibody (Sigma 15000) was used Visualization

was performed with a secondary horseradish peroxidase-coupled don-

key antirabbit antibody (Dianonva Hamburg Germany 110000)

and ECL-plus chemiluminescence system (GE Healthcare Amer-

sham Munich Germany) Quantification of band intensities was

performed with the ImageJ software (httprsbinfonihgovij)

Gene Chip ArrayRNAs were isolated from NPC cultures treated for 7 days with

TGF-b1 or the vehicle solution (4 mM HCl 1 mgmL BSA) using

RNeasy Midi Kit (Qiagen Hilden Germany) according to the man-

ufacturersquos protocol Hybridization was performed on Affymetrix

GeneChip rat genome 230 20 Array and Affymetrix GeneChip rat

expression 230A array (Affymetrix High Wycombe United King-

dom) Arrays were stained at the Affymetrix Fluidics Station 400

and scanned with the Hewlett Packard GeneArray scanner G2500A

to visualize hybridization For quality control of both microarray

analyses a GCOS expression report file was generated and evaluated

Single-array analyses were performed with Affymetrix Gene Chip-

Operating Software (GCOS 12) and Affymetrix Microarray Suite

50 Software (MAS 50) using Affymetrix default settings To com-

pare the arrays of the two experiments global scaling was used for

normalization Statistical analysis was performed by using the statisti-

cal software R (httpwwwr-projectorg) To identify the biological

function of the significantly regulated genes Gene Ranker Software

(Genomatix Munich Germany) was used The detailed information

on the array will be published elsewhere

Quantitative RT-PCRTotal RNA was isolated using RNeasy Mini Kit (Qiagen Hilden

Germany) by following the manufacturersquos protocol and 1 lg of

RNA was reversed transcribed using Promega reverse transcription

system (Promega Mannheim Germany) Real-time PCR was per-

formed with Mx 3000 P qPCR System real-time cycler (Stratagene

Waldbronn Germany) using specific primers for DCX (fwd

GGAAGGGGAAAGCTATGTCTG rev TTGCTGCTAGCCAAG

GACTG) and glucose-6-phosphate dehydrogenase (G6PDH) (fwd

CCAGCCTCCACAAGCACCTCAAC rev AATTAGCCCCCAC

GACCCTCAGTA) and QuantiTect SYBR Green PCR kit (Qiagen

Hilden Germany) for detection A standard curve was obtained by

serial dilution of mixed cDNA from control and TGF-b1-treated

cells Results were evaluated using Mx ProTM QPCR software (Stra-

tagene Waldbronn Germany)

Patch-Clamp RecordingsCurrent- and voltage-clamp recordings were performed using the

whole-cell patch-clamp technique at room temperature Coverslips

with adherent NPCs were placed into a perfusion chamber mounted

onto the stage of an inverted microscope For recordings of potas-

sium channels the cells were superfused with a standard bath solu-

tion containing (in mM) 130 NaCl 5 KCl 4 MgCl2 1 CaCl2 25

ethylene glycol tetraacetic acid (EGTA) 10 4-(2-hydroxyethyl)-1-

piperazineethanesulfonic acid (HEPES) and 5 glucose adjusted to

pH 74 with NaOH

Recordings of Ca21 and Na1 currents were performed in a

K1-free bath solution consisting of (in mM) 125 NaCl 05 CaCl2

4 MgCl2 25 EGTA 10 HEPES 5 glucose adjusted to pH 74

with NaOH Pipettes used for experiments to measure Ca21- or

Na1-currents were filled with (in mM) 140 CsCl 1 CaCl2 2

MgCl2 25 EGTA 10 HEPES and 3 ATP pH 74 adjusted with

NaOH Additional 10 mM BaCl2 served as charge carrier to mea-

sure currents through Ca21-channels TTX (10 nM) was added to

the K1-free solution as indicated to identify the contribution of

voltage-dependent Na1 channels Current traces were recorded

before and after the application of TTX (10 nM) and subtracted to

isolate the TTX-sensitive component Delayed rectifying potassium

currents (IK(DR)) were isolated using a 240 mV prepulse to inacti-

vate A-type potassium channels (IK(A)) IK(A) was obtained subtract-

ing IK(DR) from IK(DR1A)

Patch-clamp electrodes were pulled from borosilicate glass

tubes using a Zeitz DMZ Universal Puller (Zeitz Augsburg Ger-

many) and showed a resistance of 3ndash5 MX The pipette solution

used for K1-channel experiments contained (in mM) 140 KCl 2

MgCl2 1 CaCl2 25 EGTA 10 HEPES and 3 ATP pH 74

adjusted with KOH No changes in cell size were observed during

the whole-cell configuration with these solutions

All recordings were made with an HEKA EPC 10 amplifier

(HEKA Electronic Lamprecht Germany) TIDA software (HEKA

Electronic Lamprecht Germany) were used for electrical stimulation

as well as for data acquisition and analysis

If not stated otherwise voltage-dependent currents were acti-

vated using a voltage-step protocol consisting of voltage steps of 10

mV increasing amplitude and 50 ms duration to depolarize cells

from the indicated holding potential (240 mV for K1-currents

measuring and 280 mV for Ca21 and Na1 recordings) This was

followed by voltage steps of 210 mV increasing amplitude and 50

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1769

ms duration from the holding potential to record hyperpolarization-

activated currents such as inward rectifier currents The membrane

capacitance and access resistance were compensated for after the

whole-cell configuration was established The access resistance was

compensated for to values lower than 10 MX The resting potential

was measured directly after establishing the whole-cell configuration

and before membrane capacitance or access resistance compensation

Current densities were expressed as the ratio between maximal cur-

rent amplitude and whole-cell membrane capacitance (pApF21) at

given voltages

In current-clamp recordings current pulses (01ndash1 nA) were

injected to examine whether the cells were capable to show action

potentials (APs) and threshold amplitude duration and after-

hyperpolarization of the AP were analyzed Duration of AP was

measured between the fast upstroke and the rectification at the 50

level of maximal amplitude

Stock solutions of drugs were prepared in H2O or ethanol and

stored at 220C in the dark For electrophysiological measurements

stock solutions were freshly diluted in bath solution and ATP-

containing solutions were kept on ice prior to application As a fast-

application device of GABA application was not available the possi-

ble desensitization was taken into account by using GABA concen-

trations of 1 mM All chemicals were purchased from Sigma

(Meurounchen Germany) and Alomone Labs (Jerusalem Israel)

ELISAEndogenous release of TGF-b1 was assessed in culture supernatants

from three independent adult rat NSC cultures using ELISA Adult

rat NSCs were seeded at a density of 5 3 104 cells per milliliter in

NB all medium After 7 days the medium was collected and ana-

lyzed using Quantikine ELISA for rat TGF-b1 (RampD Systems

Wiesbaden-Nordenstadt Germany) by following the manufacturerrsquos

protocol Optical density was measured at 450 nm using a Tristar

LB 941 96-well plate reader (Berthold Technologies Bad Wildbad

Germany) Medium from TGF-1-treated cultures (10 ngmL) and

human platelet lysate obtained form the Department of Transfusion

Medicine University Hospital Salzburg were used as positive con-

trols All measurements were performed in triplicates

Data AnalysisFor the analysis of voltage-dependent activation steady-state currents

were plotted against the membrane potentials of the electrical stimu-

lation Values were normalized to the peak amplitudes Plots of each

individual cell were fitted using the Boltzmann equation Half-

maximal activation was obtained from a fit with a Boltzmann

equation

I5frac1211exp ethV052V THORN=kact 21 (1)

V05 is the potential of half-maximal activation and kact is the slope

factor Activation time constants were calculated by fitting current

traces by a monoexponential function

I ethtTHORN5A03exp eth2t=sactTHORN1C (2)

sact is the activation time constant I(t) is the current at time t after

the onset of the depolarization A0 is the coefficient of activation

and C is the maximal current The activation thresholds were

determined according to raw currentndashvoltage data without Boltz-

mann fit

Statistical AnalysisAll data are presented as mean 6 SEM for the indicated number of

independent experiments (n) Statistical analyses were performed

using SigmaPlot 10 (Systat Software Richmond CA) P-values of

lt005 were considered to be significant acquired by Studentrsquos t-test

Statistical significance was assumed when P lt 005 by an asterisk

() P lt 001 by double asterisk () and P lt 0001 by triple aster-

isk () Mean values of data obtained from Boltzmann fits for each

individual cell

Results

TGF-b1 Induces the Expression of Neuronal Genesin Proliferating NPCsNPCs were treated for 1 week with 10 ngmL of TGF-b1 or

vehicle solution (control) in the presence of EGF and bFGF

dissociated and reseeded on coated coverslips In contrast to

control cultures NPCs pretreated with TGF-b1 for 7 days

readily started to extend neuronal-like processes when

reseeded on poly-L-ornithine and laminin-coated glass cover-

slips despite the presence of EGF and bFGF (Fig 1A) This

could be an indication for a stimulated neuronal differentia-

tion To investigate the latter we further analyzed the expres-

sion of the immature neuronal marker DCX Indeed elevated

expression of DCX protein (Fig 1BC) and mRNA (Fig 1D)

could be detected in NPCs treated for 1 week with TGF-b1

in the presence of EGF and bFGF Moreover immunodetec-

tion of DCX was much more prominent in cells treated with

TGF-b1 (Fig 1E) To investigate if endogenously expressed

TGF-b1 might contribute to the observed effects we per-

formed a TGF-b1-ELISA This illustrated that the levels of

endogenous TGF-b1 secreted were below the detection limit

(approx 30 pgmL) In contrast we could measure an aver-

age concentration of TGF-b1 of 104 6 03 ngmL in cul-

ture medium supplemented with 10 ngmL of human

recombinant TGF-b1 In addition the human platelet lysates

(positive control) displayed an average TGF-b1 concentration

of 1184 6 73 ngmL

To further investigate the neurogenic responses to TGF-

b1 mRNA was isolated from NPCs treated for 1 week with

TGF-b1 or vehicle in the presence of EGF and bFGF Using

cDNA microarray analysis the gene expression in TGF-b1-

treated cells was compared with that of vehicle-treated cells

No upregulation of growth factor genes was detected (Table

1) suggesting that the effects observed in the TGF-b1-

stimulated cultures were indeed be induced by TGF-b1 and

not owing to an indirect effect mediated by another growth

factor TGF-b1 application led to increased expression levels

(gt15-fold) of genes relevant for electrophysiological

1770 Volume 61 No 11

properties such as voltage-dependent ion channel subunits

(Kcnd3 Scn1b Cacng4 and Accn1) neurotransmitters and

synaptic proteins (Cadps Snap25 Grik4 Gria3 Syngr3 and

Gria4) and other neuronal proteins (Nrxn1 Sept8 and

Als2cr3) (Table 2) In summary a 7-day TGF-b1 exposure

triggered elevated expression of DCX of neuronal ion chan-

nel subunits and of synaptic proteins indicative of a neuronal

phenotype maturation of NPCs

FIGURE 1 DCX expression in cells from neurospheres after treatment with TGF-b1 A Phase-contrast micrographs of NPCs that weretreated with TGF-b1 or vehicle (control) for 7 days and then reseeded on poly-L-ornithine and laminin-coated coverslips In contrast tovehicle-treated NPCs TGF-b1-treated NPCs started to extend neuronal-like processes (arrows) Scale bar 50 lm B Western blot of pro-teins from cells which have either been not treated or treated with TGF-b1 The blot was stained for DCX and for b-actin C Relativeexpression of DCX in cells which have either been not treated or treated with TGF-b1 measured by means of qPCR data were normal-ized to glucose-6-phosphatdehydrogenase D Quantification of DCX expression from Western blot analysis The expression level ofDCX protein was measured using densitometry and plotted in relation to b-actin TGF-b1-treated cells showed also on the protein levela significant higher DCX expression E Immunofluorescent detection of DCX expression in cells from neurospheres either untreated ortreated with TGF-b1

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1771

TABLE 1 Change in Expression of Growth Factor Genes by TGF-b1 Treatment Measured by Gene Array Analysis

Gene Title Gene Symbol Change TGF-b1 VersusNonstimulated Cells

Allograft inflammatory factor 1 Aif1 NC

Brain-derived neurotrophic factor Bdnf NC

Chemokine-like factor 1 Cklf1 NC

Ciliary neurotrophic factor Cntf NC

Colony-stimulating factor 1 (macrophage) Csf1 NC

Colony-stimulating factor 2 (granulocyte-macrophage) Csf2 NC

Colony-stimulating factor 3 (granulocyte) Csf3 NC

Connective tissue growth factor Ctgf NC

Epidermal growth factor Egf NC

Fibroblast growth factor 1 Fgf1 NC

Fibroblast growth factor 10 Fgf10 NC

Fibroblast growth factor 11 Fgf11 NC

Fibroblast growth factor 12 Fgf12 NC

Fibroblast growth factor 13 Fgf13 NC

Fibroblast growth factor 14 Fgf14 NC

Fibroblast growth factor 15 Fgf15 NC

Fibroblast growth factor 16 Fgf16 NC

Fibroblast growth factor 17 Fgf17 NC

Fibroblast growth factor 18 Fgf18 NC

Fibroblast growth factor 2 Fgf2 NC

Fibroblast growth factor 20 Fgf20 NC

Fibroblast growth factor 21 Fgf21 NC

Fibroblast growth factor 22 Fgf22 NC

Fibroblast growth factor 23 Fgf23 NC

Fibroblast growth factor 3 Fgf3 NC

Fibroblast growth factor 4 Fgf4 NC

Fibroblast growth factor 5 Fgf5 NC

Fibroblast growth factor 6 Fgf6 NC

Fibroblast growth factor 7 Fgf7 NC

Fibroblast growth factor 8 Fgf8 NC

Fibroblast growth factor 9 Fgf9 NC

Glia maturation factor b Gmfb NC

Glia maturation factor c Gmfg NC

Glial cell line-derived neurotrophic factor Gdnf NC

Growth differentiation factor 10 Gdf10 NC

Growth differentiation factor 11 Gdf11 NC

Growth differentiation factor 15 Gdf15 NC

1772 Volume 61 No 11

TABLE 1 Continued

Gene Title Gene Symbol Change TGF-b1 VersusNonstimulated Cells

Growth differentiation factor 6 Gdf6 NC

Growth differentiation factor 8 Gdf8 NC

Growth differentiation factor 9 Gdf9 NC

Growth factor independent 1 Gfi1 NC

Growth factor erv1-like Gfer NC

Hepatic leukemia factor Hlf NC

Hepatocyte growth factor Hgf NC

Hepatoma-derived growth factor Hdgf NC

Insulin-like growth factor 1 Igf1 NC

Insulin-like growth factor 2 Igf2 NC

Kruppel-like factor Klf2 NC

Kruppel-like factor 15 Klf15 NC

Kruppel-like factor 3 (basic) Klf3 NC

Kruppel-like factor 5 Klf5 NC

Kruppel-like factor 7 (ubiquitous) (predicted) Klf7_predicted NC

Leukemia inhibitory factor Lif NC

LPS-induced TNF-a factor RGD69294 NC

Macrophage migration inhibitory factor Mif D

Macrophage stimulating 1 (hepatocyte growth factor-like) Mst1 NC

Nerve growth factor b Ngfb NC

Nerve growth factor c Ngfg NC

Placental growth factor Pgf NC

Platelet-derived growth factor a Pdgfa D

Pre-B-cell colony enhancing factor 1 Pbef1 NC

Stem cell growth factor Scgf NC

Stromal cell-derived factor 2 (predicted) Sdf2_predicted NC

Stromal cell-derived factor 4 Sdf4 NC

Thyrotroph embryonic factor Tef NC

TGF-a Tgfa D

TGF-b1 Tgfb1 NC

TGF-b2 Tgfb2 D

TGF-b2 Tgfb2 NC

TGF-b3 Tgfb3 NC

Vascular endothelial growth factor A Vegfa NC

Vascular endothelial growth factor C Vegfc NC

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1773

TGF-b1 Changes Basic ElectrophysiologicalProperties of NPCsImmediately after breaking into the whole-cell recording the

resting membrane potentials were recorded in current-clamp

mode In TGF-b1-treated cells the resting membrane poten-

tials showed a mean value of 2658 6 38 mV (n 5 27) In

control cells the resting membrane potentials were with

2505 6 82 mV (n 5 21 P lt 00001 Fig 2A) more posi-

tive than that in the treated cells Membrane capacitance

ranged in both groups of cells between 22 and 102 pF

(mean value 6 6 27 pF n 5 44)

NPCs treated with TGF-b1 showed different patterns

of ion channels compared with that of vehicle-treated cells

Although control cells showed only outwardly rectifying ion

channels which could be activated by depolarization from a

holding potential of 280 mV and an activation threshold at

220 mV (Fig 2BD) the TGF-b1-treated cells showed a

more complex pattern of voltage-dependent ion channels

(Fig 2CE) Depolarization from 280 mV lead to activation

of fast activating inward currents followed by fast activating

and inactivating outwardly rectifying currents Moreover the

incomplete inactivation of the outward currents suggests the

presence of an outwardly rectifying channel endowed with

slow activation and no inactivation Thus treatment of adult

NPCs with TGF-b1 changed the pattern of expressed ion

channels and established a clear neuronal phenotype The pre-

cise properties of ion channels were examined in more detail

to define the nature of the TGF-b1-induced phenotype

Characterization of Voltage-Gated Ion ChannelExpression Induced by TGF-b1

VOLTAGE-GATED Na1 CURRENTS Depolarization of

TGF-b1-treated NPCs led to fast activating and inactivating

inward currents showing properties of voltage-dependent

Na1 channels currents Under K1-free conditions a voltage-

clamp protocol was used to further test for the presence of

Na1 currents in the TGF-b1-treated and control cells This

protocol consisted of depolarizing steps to 110 mV with 10

mV increment and 50 ms duration from 280 mV holding

potential In TGF-b1-treated cells depolarizing voltage stim-

ulus elicited a fast activating inward current that peaked after

1ndash2 ms and inactivated within 5 ms (n 5 39 Fig 3A) These

currents activated at potentials more positive than 250 mV

The transient inward current was completely blocked by 10

nM TTX confirming that it originated from TTX-sensitive

Na1-currents (Fig 3BC) In contrast no inward Na1 cur-

rent was detected in any control-treated cells investigated here

(n 5 48) As the presence of voltage-dependent Na1 channels

was dependent on the treatment by TGF-b1 we next

TABLE 2 Change in Expression of Neuronal Genes by TGF-b1 Treatment Measured by Gene Array Analysis

Gene Gene Symbole Fold Change(TGF-b1 vs Control)

Neurexin 1 Nrxn1 296

Septin 8 (predicted) Sept8_predicted 252

Calcium channel voltage-dependent c subunit 4 Cacng4 245

Ca21-dependent activator protein for secretion Cadps 222

Sodium channel voltage-gated Type I b-polypeptide Scn1b 222

Amyotrophic lateral sclerosis 2 (juvenile) chromosomeregion candidate 3 homolog (human)

Als2cr3 222

ATPase Na1K1 transporting a2 polypeptide Atp1a2 207

Synaptosomal-associated protein 25 Snap25 194

Amiloride-sensitive cation channel 1 neuronal (degenerin) Accn1 191

Glutamate receptor ionotropic kainite 4 Grik4 180

Glutamate receptor ionotropic AMPA3 (a3) Gria3 194

Synaptogyrin 3 (predicted) Syngr3_predicted 181

Glutamate receptor ionotropic 4 Gria4 178

Potassium voltage-gated channel Shal-related family member 3 Kcnd3 173

Disks large (Drosophila) homolog-associated protein 1 Dlgap1 169

1774 Volume 61 No 11

examined whether density of INa would increase with days of

TGF-b1 treatment Indeed the average measured INa density

in the TGF-b1-treated cells more than doubled from Day 9

(865 6 47 pApF21 n 5 19) to Day 11 (2238 6 131

pApF21 n 5 18 P lt 00001 Fig 3D)

VOLTAGE-GATED K1-CURRENTS TGF-b1 treatments also

induced differences in outwardly rectifying ion currents

resembling rectifying potassium channels These outwardly

rectifying currents disappeared under K1-free conditions

strongly substantiating that they were mediated through

voltage-dependent K1-channels Therefore the characteriza-

tion of voltage-dependent K1-channels was performed in

more detail To avoid the recording of super-imposed Na1

channel currents the cells were voltage clamped to 240 mV

and stepped to potentials ranging from 2130 to 140 mV

using 10-mV increments for 50 ms whereas corresponding

currents were recorded Outward currents were observed in

all cells To analyze the presence of currents from different

K1-channels currents evoked by stepwise depolarization from

240 mV holding potential were subtracted from those

evoked from 280 mV holding potential In the TGF-b1-

treated cells we demonstrated that the outward currents result

from the coordinated activity of two K1-channel populations

First a noninactivating delayed-rectified current (IK(DR))

obtained from the 240 mV holding potential constituted

most of the total K1-current Second a fast-inactivating A-

type K1-current (IK(A)) was revealed by the subtraction proto-

col Both current components had activation thresholds

between 230 and 240 mV and both types of currents con-

tributed in different proportions to whole-cell currents in

morphologically identical cells In the majority of cells the

presence of the two different outward potassium currents

could be observed (Fig 4E) Furthermore some cells were

found to express only A-type (Fig 4C) or only delayed-

rectifier currents (Fig 4A) In the next step the relative con-

tribution of the three potassium channel combinations was

compared in control and TGF-b1-treated cells (Fig 4G) As

shown in Fig 4G 583 of the control cells (n 5 48) and

similarly 518 of the cells with TGF-b1 treatment (n 5 39)

showed that the outward current was composed of both K1-

channel types However TGF-b1 treatment significantly

decreased the percentage of cells expressing only A-type chan-

nels (IK(A)) from 297 in control cells to 36 whereas the

percentage of cells which express only delayed-rectifier chan-

nels (IK(DR)) was increased from 120 to 446 A separate

analysis of the inward and outward current densities showed a

significant higher inward current density with 440 6 36

FIGURE 2 Voltage-dependent membrane currents of rat NPCs under control conditions and after TGF-b1 treatment A The mean rest-ing membrane potential (RMP) was significantly shifted toward more hyperpolarized potentials B Whole-cell currents under control con-ditions (physiological Na1- and K1-concentrations) elicited by electrical stimulation shown in the inset from a holding potential of 280mV the cells were first depolarized by nine voltage steps of 10 mV increasing amplitude and 50 ms duration which were followed bynine voltage steps of 210 mV increasing amplitude to hyperpolarize the cells Representative current trace recorded in cells withoutTGF-b1 treatment showed mainly outwardly directed currents and no inward currents C In contrast after TGF-b1 treatment the cellsexpressed voltage-gated sodium currents Averaged IV-curves are shown in (D) and (E) for the time points indicated by the open (initialresponse) and filled circle (steady state) Error bars indicate SEM where error bars are not visible they are smaller than the symbols

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1775

pApF21 in TGF-b1-treated cells (n 5 35) than in control

cells (42 6 03 pApF21 n 5 43 P lt 00001) whereas the

maximal outward current density was with 2062 6 339

pApF21 in control cells nearly equal to that in TGF-b1-

treated cells (2189 6 171 pApF21 P 5 072 Fig 4H)

Moreover in TGF-b1-treated cells the stepwise hyper-

polarization from a holding potential of 280 to 2170 mV

(10 mV increment 50 ms duration) elicited an inwardly rec-

tifying current (n 5 35 Fig 5AB) activated at potentials

more negative than 270 mV (Fig 5C) and showing mild

inactivation at very low potentials In contrast no inward rec-

tifier current was detected in any of the cells without TGF-

b1 treatment (n 5 43) As shown in Fig 5D 30 of the

TGF-b1-treated cells showed a combination of inward recti-

fier currents with delayed rectifier potassium current only

whereas 63 of the cells showed a combination with A-type

and delayed-rectifier K1-currents

VOLTAGE-GATED Ca21 CHANNEL CURRENTS To inves-

tigate the expression of voltage-dependent Ca21 channels as

an additional neuronal marker whole-cell recordings were

performed under extra- and intracellular K1-free conditions

with cells from both experimental groups As a standard set-

ting the cells were stimulated by stepwise depolarization

from a holding potential of 280 mV (110 mV increment

50 ms duration) Currents were measured with 10 mM Ba21

as charge carrier as well as 10 nM TTX in the bath solution

to inhibit superimposed sodium currents We found the

expression of Ca21 channels only after treatment with TGF-

b1 Depolarizing voltage pulse elicited fast activating inward

currents that showed little inactivation during the voltage

stimulus (Fig 6A) The currents which reached a steady state

within 5 ms got activated at potentials higher than 240 6

22 mV (n 5 7 Fig 6B) and reached a maximal current den-

sity of 124 6 19 pApF21 (n 5 7) at 110 mV The

voltage-dependent activation was calculated using the Boltz-

mann equation to fit the activation curve The Ba21-currents

were sensitive to dihydropyridine derivatives Application of

the enantiomer (1)BayK8644 (2 lM) a blocker of voltage-

dependent L-type Ca21 channels reduced the currents to

361 6 32 of the control values (peak current amplitude

n 5 7) These currents showed a voltage dependence

FIGURE 3 Voltage-gated sodium currents To measure currents through voltage-dependent Na1 channels whole-cell recordings wereperformed under extra- and intracellular K1-free conditions membrane voltage was clamped at a holding potential of 280 mV and thecells were depolarized to 10 mV in 10 mV steps in 50 ms followed by 210 mV steps to 2170 mV A Representative voltage-clamprecording of voltage-gated Na1 current (INa) from TGF-b1-treated cells using potassium-free solution B Fast inward currents could becompletely blocked by application of TTX (10 nM) C Normalized currentndashvoltage relationship of the peak INa shown in (A) and afteraddition of 10 nM TTX Addition of 10 nM tetrodotoxin (TTX) in the bath solution blocked INa completely INa displayed the characteris-tic IndashV relationship of voltage-gated sodium currents with a peak close to 210 mV and an activation threshold close to 250 mV D Dia-gram showing the effect of TGF-b1 treatment on the rise in sodium current density [INa] (P lt 0001)

1776 Volume 61 No 11

pharmacological and kinetic characteristics for L-type calcium

currents The properties of calcium channel currents in TGF-

b1-treated cells are summarized in Table 3

TGF-b1-treated cells show APs

We then determined whether the activity of voltage-activated

sodium conductance in TGF-b1-treated cells is strong enough

to allow the generation of APs Depolarizing current steps

(01ndash1 nA) were applied in the current-clamp mode Without

TGF-b1 treatment none of the progenitor cells (n 5 48)

fired APs in response to current injections In contrast 42

out of 50 tested cells with TGF-b1 treatment showed after 1

s of depolarization at least one AP that could be reversibly

blocked by TTX (10 nM Fig 7) The threshold for AP ini-

tiation was 2303 6 04 mV (n 5 15) to generate a TTX-

sensitive AP with a duration of 51 6 02 ms (n 5 15) and a

short after-hyperpolarization APs reached an amplitude of

4278 6 047 mV (n 5 15) The length of the after-

hyperpolarization was 219 6 11 ms with a maximal ampli-

tude of 139 6 05 mV (n 5 15) The properties of APs are

summarized in Table 4

TGF-b1-treated cells form synapses

To further study neuronal differentiation on the functional

level the expression of neurotransmitter receptor and the for-

mation of synapses was analyzed Whole-cell currents were

measured from TGF-b1-treated cells using K1 containing

control solutions and membrane conductance was monitored

by electrical stimulation from a holding potential of 270 mV

by 5 voltage steps of 50 ms duration and 20 mV increment

to depolarize the cells and five voltage steps of 50 ms dura-

tion and 220 mV increment to hyperpolarize the cells

Application of 1 mM GABA led to an increase in the mem-

brane conductance which resulted in an inwardly rectifying

conductance with a reversal potential of 261 6 02 mV (n5 3) close to the Nernst potential for K1 at our recording

conditions of 274 mV (Fig 8A) which is consistent with the

activation of a K1-conductance The TGF-b1-treated cells

FIGURE 4 Voltage-gated outward potassium currents Outward currents were evoked in response to membrane voltage steps from2130 mV to 140 mV at 10 mV intervals from a holding potential of 240 mV Data illustrate the classification of cells according to theirresponses to current steps and the corresponding IndashV plots Analysis of voltage-dependent activation steady-state current amplitudeswere plotted against the membrane potentials of the electrical stimulation Three major cell types were identified A Type I cells exhib-ited delayed rectifier potassium current only C Type II cells expressing only A-type potassium currents and Type III cells exhibited botha fast inactivating A-type potassium current and a noninactivating delayed rectifier potassium current E) Averaged IV-curves of eachtype are shown in (B D and F) G Data illustrate the relative contributions of the different potassium currents (stimulation 240 mV) inthe population of cells examined The percentage of cells expressing delayed rectifier potassium currents only (IK(DR)) increased signifi-cantly after TGF-b1 treatment In contrast the total outward current density (IK(DR1A)) remained relatively constant H Comparison ofthe maximal outward current density of cells measured under control conditions and after TGF-b1 treatment

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1777

showed in the presence of GABA an increase in the mem-

brane current at a holding potential of 2150 mV from

2176 6 47 pA (n 5 3) to 21080 6 142 pA (n 5 3 P 5

0004) Nontreated NPCs showed no changes in the mem-

brane conductance after application of GABA

As the TGF-b1-treated cells showed expression of

GABA receptors the possible formation of synapses was stud-

ied For this purpose long-time recordings of the holding

current at 270 mV were performed (Fig 8B) At higher

amplification current fluctuations were measured with ampli-

tudes of 32 6 27 pA (n 5 4) Application of 100 lM picro-

toxine led to a decrease in these current fluctuations to 119

6 11 pA (n 5 4 P 5 00005 Fig 8CD) In some cells

we observed a shift of the base-line currents toward 0 pA

Thus we cannot exclude that some of the cells showed tonic

receptor activation

Summary of TGF-b1 effects on NPCs

To give an overview on the TGF-b1-induced functional

effects the number of cells which show different aspects of

functional neuronal differentiation was compared between

TGF-b1 and control groups (Fig 9) Among the nontreated

cells there were no cells showing Na1 channel currents APs

or GABAergic currents In contrast to that the TGF-b1-

FIGURE 5 Inward rectifier potassium currents in TGF-b1-treated cells A Hyperpolarizing voltage steps from a holding potential of 280to 2170 mV (10 mV increment 50 ms duration) induced an inwardly rectifying current as shown here in a representative trace for TGF-b1-treated cell B Inward rectifier K1-component of the total current C Corresponding currentvoltage relationship of the current Thecurrents activate at potentials more negative than 270 mV D Frequency distribution of inwardly rectifying K1 currents expression incontrol cells and in cells after TGF-b1 treatment In control cells no inward inwardly rectifying current was detected in any of the cellsexamined In TGF-b1-treated cells 94 of the cells showed inwardly rectifying currents (n 5 35) In brief 63 of these showed a combi-nation with A-type and delayed rectifier K1-currents whereas only 30 with delayed rectifier currents

FIGURE 6 Voltage-gated Ca21 channel currents A Currentswere activated by voltage steps from 2170 mV to 110 mV for50 ms from a holding potential of 280 mV Experiments weredone under extra- and intracellular K1-free conditions in thepresence of 10 nM TTX in the bath solution to inhibit sodiumcurrents and with Ba21 as the charge carrier Normalized cur-rentndashvoltage relationships fitted with Boltzmann function areshown in (B) The kinetic properties of calcium channel currentsare summarized in Table 3

1778 Volume 61 No 11

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

properties such as voltage-dependent ion channel subunits

(Kcnd3 Scn1b Cacng4 and Accn1) neurotransmitters and

synaptic proteins (Cadps Snap25 Grik4 Gria3 Syngr3 and

Gria4) and other neuronal proteins (Nrxn1 Sept8 and

Als2cr3) (Table 2) In summary a 7-day TGF-b1 exposure

triggered elevated expression of DCX of neuronal ion chan-

nel subunits and of synaptic proteins indicative of a neuronal

phenotype maturation of NPCs

FIGURE 1 DCX expression in cells from neurospheres after treatment with TGF-b1 A Phase-contrast micrographs of NPCs that weretreated with TGF-b1 or vehicle (control) for 7 days and then reseeded on poly-L-ornithine and laminin-coated coverslips In contrast tovehicle-treated NPCs TGF-b1-treated NPCs started to extend neuronal-like processes (arrows) Scale bar 50 lm B Western blot of pro-teins from cells which have either been not treated or treated with TGF-b1 The blot was stained for DCX and for b-actin C Relativeexpression of DCX in cells which have either been not treated or treated with TGF-b1 measured by means of qPCR data were normal-ized to glucose-6-phosphatdehydrogenase D Quantification of DCX expression from Western blot analysis The expression level ofDCX protein was measured using densitometry and plotted in relation to b-actin TGF-b1-treated cells showed also on the protein levela significant higher DCX expression E Immunofluorescent detection of DCX expression in cells from neurospheres either untreated ortreated with TGF-b1

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1771

TABLE 1 Change in Expression of Growth Factor Genes by TGF-b1 Treatment Measured by Gene Array Analysis

Gene Title Gene Symbol Change TGF-b1 VersusNonstimulated Cells

Allograft inflammatory factor 1 Aif1 NC

Brain-derived neurotrophic factor Bdnf NC

Chemokine-like factor 1 Cklf1 NC

Ciliary neurotrophic factor Cntf NC

Colony-stimulating factor 1 (macrophage) Csf1 NC

Colony-stimulating factor 2 (granulocyte-macrophage) Csf2 NC

Colony-stimulating factor 3 (granulocyte) Csf3 NC

Connective tissue growth factor Ctgf NC

Epidermal growth factor Egf NC

Fibroblast growth factor 1 Fgf1 NC

Fibroblast growth factor 10 Fgf10 NC

Fibroblast growth factor 11 Fgf11 NC

Fibroblast growth factor 12 Fgf12 NC

Fibroblast growth factor 13 Fgf13 NC

Fibroblast growth factor 14 Fgf14 NC

Fibroblast growth factor 15 Fgf15 NC

Fibroblast growth factor 16 Fgf16 NC

Fibroblast growth factor 17 Fgf17 NC

Fibroblast growth factor 18 Fgf18 NC

Fibroblast growth factor 2 Fgf2 NC

Fibroblast growth factor 20 Fgf20 NC

Fibroblast growth factor 21 Fgf21 NC

Fibroblast growth factor 22 Fgf22 NC

Fibroblast growth factor 23 Fgf23 NC

Fibroblast growth factor 3 Fgf3 NC

Fibroblast growth factor 4 Fgf4 NC

Fibroblast growth factor 5 Fgf5 NC

Fibroblast growth factor 6 Fgf6 NC

Fibroblast growth factor 7 Fgf7 NC

Fibroblast growth factor 8 Fgf8 NC

Fibroblast growth factor 9 Fgf9 NC

Glia maturation factor b Gmfb NC

Glia maturation factor c Gmfg NC

Glial cell line-derived neurotrophic factor Gdnf NC

Growth differentiation factor 10 Gdf10 NC

Growth differentiation factor 11 Gdf11 NC

Growth differentiation factor 15 Gdf15 NC

1772 Volume 61 No 11

TABLE 1 Continued

Gene Title Gene Symbol Change TGF-b1 VersusNonstimulated Cells

Growth differentiation factor 6 Gdf6 NC

Growth differentiation factor 8 Gdf8 NC

Growth differentiation factor 9 Gdf9 NC

Growth factor independent 1 Gfi1 NC

Growth factor erv1-like Gfer NC

Hepatic leukemia factor Hlf NC

Hepatocyte growth factor Hgf NC

Hepatoma-derived growth factor Hdgf NC

Insulin-like growth factor 1 Igf1 NC

Insulin-like growth factor 2 Igf2 NC

Kruppel-like factor Klf2 NC

Kruppel-like factor 15 Klf15 NC

Kruppel-like factor 3 (basic) Klf3 NC

Kruppel-like factor 5 Klf5 NC

Kruppel-like factor 7 (ubiquitous) (predicted) Klf7_predicted NC

Leukemia inhibitory factor Lif NC

LPS-induced TNF-a factor RGD69294 NC

Macrophage migration inhibitory factor Mif D

Macrophage stimulating 1 (hepatocyte growth factor-like) Mst1 NC

Nerve growth factor b Ngfb NC

Nerve growth factor c Ngfg NC

Placental growth factor Pgf NC

Platelet-derived growth factor a Pdgfa D

Pre-B-cell colony enhancing factor 1 Pbef1 NC

Stem cell growth factor Scgf NC

Stromal cell-derived factor 2 (predicted) Sdf2_predicted NC

Stromal cell-derived factor 4 Sdf4 NC

Thyrotroph embryonic factor Tef NC

TGF-a Tgfa D

TGF-b1 Tgfb1 NC

TGF-b2 Tgfb2 D

TGF-b2 Tgfb2 NC

TGF-b3 Tgfb3 NC

Vascular endothelial growth factor A Vegfa NC

Vascular endothelial growth factor C Vegfc NC

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1773

TGF-b1 Changes Basic ElectrophysiologicalProperties of NPCsImmediately after breaking into the whole-cell recording the

resting membrane potentials were recorded in current-clamp

mode In TGF-b1-treated cells the resting membrane poten-

tials showed a mean value of 2658 6 38 mV (n 5 27) In

control cells the resting membrane potentials were with

2505 6 82 mV (n 5 21 P lt 00001 Fig 2A) more posi-

tive than that in the treated cells Membrane capacitance

ranged in both groups of cells between 22 and 102 pF

(mean value 6 6 27 pF n 5 44)

NPCs treated with TGF-b1 showed different patterns

of ion channels compared with that of vehicle-treated cells

Although control cells showed only outwardly rectifying ion

channels which could be activated by depolarization from a

holding potential of 280 mV and an activation threshold at

220 mV (Fig 2BD) the TGF-b1-treated cells showed a

more complex pattern of voltage-dependent ion channels

(Fig 2CE) Depolarization from 280 mV lead to activation

of fast activating inward currents followed by fast activating

and inactivating outwardly rectifying currents Moreover the

incomplete inactivation of the outward currents suggests the

presence of an outwardly rectifying channel endowed with

slow activation and no inactivation Thus treatment of adult

NPCs with TGF-b1 changed the pattern of expressed ion

channels and established a clear neuronal phenotype The pre-

cise properties of ion channels were examined in more detail

to define the nature of the TGF-b1-induced phenotype

Characterization of Voltage-Gated Ion ChannelExpression Induced by TGF-b1

VOLTAGE-GATED Na1 CURRENTS Depolarization of

TGF-b1-treated NPCs led to fast activating and inactivating

inward currents showing properties of voltage-dependent

Na1 channels currents Under K1-free conditions a voltage-

clamp protocol was used to further test for the presence of

Na1 currents in the TGF-b1-treated and control cells This

protocol consisted of depolarizing steps to 110 mV with 10

mV increment and 50 ms duration from 280 mV holding

potential In TGF-b1-treated cells depolarizing voltage stim-

ulus elicited a fast activating inward current that peaked after

1ndash2 ms and inactivated within 5 ms (n 5 39 Fig 3A) These

currents activated at potentials more positive than 250 mV

The transient inward current was completely blocked by 10

nM TTX confirming that it originated from TTX-sensitive

Na1-currents (Fig 3BC) In contrast no inward Na1 cur-

rent was detected in any control-treated cells investigated here

(n 5 48) As the presence of voltage-dependent Na1 channels

was dependent on the treatment by TGF-b1 we next

TABLE 2 Change in Expression of Neuronal Genes by TGF-b1 Treatment Measured by Gene Array Analysis

Gene Gene Symbole Fold Change(TGF-b1 vs Control)

Neurexin 1 Nrxn1 296

Septin 8 (predicted) Sept8_predicted 252

Calcium channel voltage-dependent c subunit 4 Cacng4 245

Ca21-dependent activator protein for secretion Cadps 222

Sodium channel voltage-gated Type I b-polypeptide Scn1b 222

Amyotrophic lateral sclerosis 2 (juvenile) chromosomeregion candidate 3 homolog (human)

Als2cr3 222

ATPase Na1K1 transporting a2 polypeptide Atp1a2 207

Synaptosomal-associated protein 25 Snap25 194

Amiloride-sensitive cation channel 1 neuronal (degenerin) Accn1 191

Glutamate receptor ionotropic kainite 4 Grik4 180

Glutamate receptor ionotropic AMPA3 (a3) Gria3 194

Synaptogyrin 3 (predicted) Syngr3_predicted 181

Glutamate receptor ionotropic 4 Gria4 178

Potassium voltage-gated channel Shal-related family member 3 Kcnd3 173

Disks large (Drosophila) homolog-associated protein 1 Dlgap1 169

1774 Volume 61 No 11

examined whether density of INa would increase with days of

TGF-b1 treatment Indeed the average measured INa density

in the TGF-b1-treated cells more than doubled from Day 9

(865 6 47 pApF21 n 5 19) to Day 11 (2238 6 131

pApF21 n 5 18 P lt 00001 Fig 3D)

VOLTAGE-GATED K1-CURRENTS TGF-b1 treatments also

induced differences in outwardly rectifying ion currents

resembling rectifying potassium channels These outwardly

rectifying currents disappeared under K1-free conditions

strongly substantiating that they were mediated through

voltage-dependent K1-channels Therefore the characteriza-

tion of voltage-dependent K1-channels was performed in

more detail To avoid the recording of super-imposed Na1

channel currents the cells were voltage clamped to 240 mV

and stepped to potentials ranging from 2130 to 140 mV

using 10-mV increments for 50 ms whereas corresponding

currents were recorded Outward currents were observed in

all cells To analyze the presence of currents from different

K1-channels currents evoked by stepwise depolarization from

240 mV holding potential were subtracted from those

evoked from 280 mV holding potential In the TGF-b1-

treated cells we demonstrated that the outward currents result

from the coordinated activity of two K1-channel populations

First a noninactivating delayed-rectified current (IK(DR))

obtained from the 240 mV holding potential constituted

most of the total K1-current Second a fast-inactivating A-

type K1-current (IK(A)) was revealed by the subtraction proto-

col Both current components had activation thresholds

between 230 and 240 mV and both types of currents con-

tributed in different proportions to whole-cell currents in

morphologically identical cells In the majority of cells the

presence of the two different outward potassium currents

could be observed (Fig 4E) Furthermore some cells were

found to express only A-type (Fig 4C) or only delayed-

rectifier currents (Fig 4A) In the next step the relative con-

tribution of the three potassium channel combinations was

compared in control and TGF-b1-treated cells (Fig 4G) As

shown in Fig 4G 583 of the control cells (n 5 48) and

similarly 518 of the cells with TGF-b1 treatment (n 5 39)

showed that the outward current was composed of both K1-

channel types However TGF-b1 treatment significantly

decreased the percentage of cells expressing only A-type chan-

nels (IK(A)) from 297 in control cells to 36 whereas the

percentage of cells which express only delayed-rectifier chan-

nels (IK(DR)) was increased from 120 to 446 A separate

analysis of the inward and outward current densities showed a

significant higher inward current density with 440 6 36

FIGURE 2 Voltage-dependent membrane currents of rat NPCs under control conditions and after TGF-b1 treatment A The mean rest-ing membrane potential (RMP) was significantly shifted toward more hyperpolarized potentials B Whole-cell currents under control con-ditions (physiological Na1- and K1-concentrations) elicited by electrical stimulation shown in the inset from a holding potential of 280mV the cells were first depolarized by nine voltage steps of 10 mV increasing amplitude and 50 ms duration which were followed bynine voltage steps of 210 mV increasing amplitude to hyperpolarize the cells Representative current trace recorded in cells withoutTGF-b1 treatment showed mainly outwardly directed currents and no inward currents C In contrast after TGF-b1 treatment the cellsexpressed voltage-gated sodium currents Averaged IV-curves are shown in (D) and (E) for the time points indicated by the open (initialresponse) and filled circle (steady state) Error bars indicate SEM where error bars are not visible they are smaller than the symbols

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1775

pApF21 in TGF-b1-treated cells (n 5 35) than in control

cells (42 6 03 pApF21 n 5 43 P lt 00001) whereas the

maximal outward current density was with 2062 6 339

pApF21 in control cells nearly equal to that in TGF-b1-

treated cells (2189 6 171 pApF21 P 5 072 Fig 4H)

Moreover in TGF-b1-treated cells the stepwise hyper-

polarization from a holding potential of 280 to 2170 mV

(10 mV increment 50 ms duration) elicited an inwardly rec-

tifying current (n 5 35 Fig 5AB) activated at potentials

more negative than 270 mV (Fig 5C) and showing mild

inactivation at very low potentials In contrast no inward rec-

tifier current was detected in any of the cells without TGF-

b1 treatment (n 5 43) As shown in Fig 5D 30 of the

TGF-b1-treated cells showed a combination of inward recti-

fier currents with delayed rectifier potassium current only

whereas 63 of the cells showed a combination with A-type

and delayed-rectifier K1-currents

VOLTAGE-GATED Ca21 CHANNEL CURRENTS To inves-

tigate the expression of voltage-dependent Ca21 channels as

an additional neuronal marker whole-cell recordings were

performed under extra- and intracellular K1-free conditions

with cells from both experimental groups As a standard set-

ting the cells were stimulated by stepwise depolarization

from a holding potential of 280 mV (110 mV increment

50 ms duration) Currents were measured with 10 mM Ba21

as charge carrier as well as 10 nM TTX in the bath solution

to inhibit superimposed sodium currents We found the

expression of Ca21 channels only after treatment with TGF-

b1 Depolarizing voltage pulse elicited fast activating inward

currents that showed little inactivation during the voltage

stimulus (Fig 6A) The currents which reached a steady state

within 5 ms got activated at potentials higher than 240 6

22 mV (n 5 7 Fig 6B) and reached a maximal current den-

sity of 124 6 19 pApF21 (n 5 7) at 110 mV The

voltage-dependent activation was calculated using the Boltz-

mann equation to fit the activation curve The Ba21-currents

were sensitive to dihydropyridine derivatives Application of

the enantiomer (1)BayK8644 (2 lM) a blocker of voltage-

dependent L-type Ca21 channels reduced the currents to

361 6 32 of the control values (peak current amplitude

n 5 7) These currents showed a voltage dependence

FIGURE 3 Voltage-gated sodium currents To measure currents through voltage-dependent Na1 channels whole-cell recordings wereperformed under extra- and intracellular K1-free conditions membrane voltage was clamped at a holding potential of 280 mV and thecells were depolarized to 10 mV in 10 mV steps in 50 ms followed by 210 mV steps to 2170 mV A Representative voltage-clamprecording of voltage-gated Na1 current (INa) from TGF-b1-treated cells using potassium-free solution B Fast inward currents could becompletely blocked by application of TTX (10 nM) C Normalized currentndashvoltage relationship of the peak INa shown in (A) and afteraddition of 10 nM TTX Addition of 10 nM tetrodotoxin (TTX) in the bath solution blocked INa completely INa displayed the characteris-tic IndashV relationship of voltage-gated sodium currents with a peak close to 210 mV and an activation threshold close to 250 mV D Dia-gram showing the effect of TGF-b1 treatment on the rise in sodium current density [INa] (P lt 0001)

1776 Volume 61 No 11

pharmacological and kinetic characteristics for L-type calcium

currents The properties of calcium channel currents in TGF-

b1-treated cells are summarized in Table 3

TGF-b1-treated cells show APs

We then determined whether the activity of voltage-activated

sodium conductance in TGF-b1-treated cells is strong enough

to allow the generation of APs Depolarizing current steps

(01ndash1 nA) were applied in the current-clamp mode Without

TGF-b1 treatment none of the progenitor cells (n 5 48)

fired APs in response to current injections In contrast 42

out of 50 tested cells with TGF-b1 treatment showed after 1

s of depolarization at least one AP that could be reversibly

blocked by TTX (10 nM Fig 7) The threshold for AP ini-

tiation was 2303 6 04 mV (n 5 15) to generate a TTX-

sensitive AP with a duration of 51 6 02 ms (n 5 15) and a

short after-hyperpolarization APs reached an amplitude of

4278 6 047 mV (n 5 15) The length of the after-

hyperpolarization was 219 6 11 ms with a maximal ampli-

tude of 139 6 05 mV (n 5 15) The properties of APs are

summarized in Table 4

TGF-b1-treated cells form synapses

To further study neuronal differentiation on the functional

level the expression of neurotransmitter receptor and the for-

mation of synapses was analyzed Whole-cell currents were

measured from TGF-b1-treated cells using K1 containing

control solutions and membrane conductance was monitored

by electrical stimulation from a holding potential of 270 mV

by 5 voltage steps of 50 ms duration and 20 mV increment

to depolarize the cells and five voltage steps of 50 ms dura-

tion and 220 mV increment to hyperpolarize the cells

Application of 1 mM GABA led to an increase in the mem-

brane conductance which resulted in an inwardly rectifying

conductance with a reversal potential of 261 6 02 mV (n5 3) close to the Nernst potential for K1 at our recording

conditions of 274 mV (Fig 8A) which is consistent with the

activation of a K1-conductance The TGF-b1-treated cells

FIGURE 4 Voltage-gated outward potassium currents Outward currents were evoked in response to membrane voltage steps from2130 mV to 140 mV at 10 mV intervals from a holding potential of 240 mV Data illustrate the classification of cells according to theirresponses to current steps and the corresponding IndashV plots Analysis of voltage-dependent activation steady-state current amplitudeswere plotted against the membrane potentials of the electrical stimulation Three major cell types were identified A Type I cells exhib-ited delayed rectifier potassium current only C Type II cells expressing only A-type potassium currents and Type III cells exhibited botha fast inactivating A-type potassium current and a noninactivating delayed rectifier potassium current E) Averaged IV-curves of eachtype are shown in (B D and F) G Data illustrate the relative contributions of the different potassium currents (stimulation 240 mV) inthe population of cells examined The percentage of cells expressing delayed rectifier potassium currents only (IK(DR)) increased signifi-cantly after TGF-b1 treatment In contrast the total outward current density (IK(DR1A)) remained relatively constant H Comparison ofthe maximal outward current density of cells measured under control conditions and after TGF-b1 treatment

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1777

showed in the presence of GABA an increase in the mem-

brane current at a holding potential of 2150 mV from

2176 6 47 pA (n 5 3) to 21080 6 142 pA (n 5 3 P 5

0004) Nontreated NPCs showed no changes in the mem-

brane conductance after application of GABA

As the TGF-b1-treated cells showed expression of

GABA receptors the possible formation of synapses was stud-

ied For this purpose long-time recordings of the holding

current at 270 mV were performed (Fig 8B) At higher

amplification current fluctuations were measured with ampli-

tudes of 32 6 27 pA (n 5 4) Application of 100 lM picro-

toxine led to a decrease in these current fluctuations to 119

6 11 pA (n 5 4 P 5 00005 Fig 8CD) In some cells

we observed a shift of the base-line currents toward 0 pA

Thus we cannot exclude that some of the cells showed tonic

receptor activation

Summary of TGF-b1 effects on NPCs

To give an overview on the TGF-b1-induced functional

effects the number of cells which show different aspects of

functional neuronal differentiation was compared between

TGF-b1 and control groups (Fig 9) Among the nontreated

cells there were no cells showing Na1 channel currents APs

or GABAergic currents In contrast to that the TGF-b1-

FIGURE 5 Inward rectifier potassium currents in TGF-b1-treated cells A Hyperpolarizing voltage steps from a holding potential of 280to 2170 mV (10 mV increment 50 ms duration) induced an inwardly rectifying current as shown here in a representative trace for TGF-b1-treated cell B Inward rectifier K1-component of the total current C Corresponding currentvoltage relationship of the current Thecurrents activate at potentials more negative than 270 mV D Frequency distribution of inwardly rectifying K1 currents expression incontrol cells and in cells after TGF-b1 treatment In control cells no inward inwardly rectifying current was detected in any of the cellsexamined In TGF-b1-treated cells 94 of the cells showed inwardly rectifying currents (n 5 35) In brief 63 of these showed a combi-nation with A-type and delayed rectifier K1-currents whereas only 30 with delayed rectifier currents

FIGURE 6 Voltage-gated Ca21 channel currents A Currentswere activated by voltage steps from 2170 mV to 110 mV for50 ms from a holding potential of 280 mV Experiments weredone under extra- and intracellular K1-free conditions in thepresence of 10 nM TTX in the bath solution to inhibit sodiumcurrents and with Ba21 as the charge carrier Normalized cur-rentndashvoltage relationships fitted with Boltzmann function areshown in (B) The kinetic properties of calcium channel currentsare summarized in Table 3

1778 Volume 61 No 11

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

TABLE 1 Change in Expression of Growth Factor Genes by TGF-b1 Treatment Measured by Gene Array Analysis

Gene Title Gene Symbol Change TGF-b1 VersusNonstimulated Cells

Allograft inflammatory factor 1 Aif1 NC

Brain-derived neurotrophic factor Bdnf NC

Chemokine-like factor 1 Cklf1 NC

Ciliary neurotrophic factor Cntf NC

Colony-stimulating factor 1 (macrophage) Csf1 NC

Colony-stimulating factor 2 (granulocyte-macrophage) Csf2 NC

Colony-stimulating factor 3 (granulocyte) Csf3 NC

Connective tissue growth factor Ctgf NC

Epidermal growth factor Egf NC

Fibroblast growth factor 1 Fgf1 NC

Fibroblast growth factor 10 Fgf10 NC

Fibroblast growth factor 11 Fgf11 NC

Fibroblast growth factor 12 Fgf12 NC

Fibroblast growth factor 13 Fgf13 NC

Fibroblast growth factor 14 Fgf14 NC

Fibroblast growth factor 15 Fgf15 NC

Fibroblast growth factor 16 Fgf16 NC

Fibroblast growth factor 17 Fgf17 NC

Fibroblast growth factor 18 Fgf18 NC

Fibroblast growth factor 2 Fgf2 NC

Fibroblast growth factor 20 Fgf20 NC

Fibroblast growth factor 21 Fgf21 NC

Fibroblast growth factor 22 Fgf22 NC

Fibroblast growth factor 23 Fgf23 NC

Fibroblast growth factor 3 Fgf3 NC

Fibroblast growth factor 4 Fgf4 NC

Fibroblast growth factor 5 Fgf5 NC

Fibroblast growth factor 6 Fgf6 NC

Fibroblast growth factor 7 Fgf7 NC

Fibroblast growth factor 8 Fgf8 NC

Fibroblast growth factor 9 Fgf9 NC

Glia maturation factor b Gmfb NC

Glia maturation factor c Gmfg NC

Glial cell line-derived neurotrophic factor Gdnf NC

Growth differentiation factor 10 Gdf10 NC

Growth differentiation factor 11 Gdf11 NC

Growth differentiation factor 15 Gdf15 NC

1772 Volume 61 No 11

TABLE 1 Continued

Gene Title Gene Symbol Change TGF-b1 VersusNonstimulated Cells

Growth differentiation factor 6 Gdf6 NC

Growth differentiation factor 8 Gdf8 NC

Growth differentiation factor 9 Gdf9 NC

Growth factor independent 1 Gfi1 NC

Growth factor erv1-like Gfer NC

Hepatic leukemia factor Hlf NC

Hepatocyte growth factor Hgf NC

Hepatoma-derived growth factor Hdgf NC

Insulin-like growth factor 1 Igf1 NC

Insulin-like growth factor 2 Igf2 NC

Kruppel-like factor Klf2 NC

Kruppel-like factor 15 Klf15 NC

Kruppel-like factor 3 (basic) Klf3 NC

Kruppel-like factor 5 Klf5 NC

Kruppel-like factor 7 (ubiquitous) (predicted) Klf7_predicted NC

Leukemia inhibitory factor Lif NC

LPS-induced TNF-a factor RGD69294 NC

Macrophage migration inhibitory factor Mif D

Macrophage stimulating 1 (hepatocyte growth factor-like) Mst1 NC

Nerve growth factor b Ngfb NC

Nerve growth factor c Ngfg NC

Placental growth factor Pgf NC

Platelet-derived growth factor a Pdgfa D

Pre-B-cell colony enhancing factor 1 Pbef1 NC

Stem cell growth factor Scgf NC

Stromal cell-derived factor 2 (predicted) Sdf2_predicted NC

Stromal cell-derived factor 4 Sdf4 NC

Thyrotroph embryonic factor Tef NC

TGF-a Tgfa D

TGF-b1 Tgfb1 NC

TGF-b2 Tgfb2 D

TGF-b2 Tgfb2 NC

TGF-b3 Tgfb3 NC

Vascular endothelial growth factor A Vegfa NC

Vascular endothelial growth factor C Vegfc NC

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1773

TGF-b1 Changes Basic ElectrophysiologicalProperties of NPCsImmediately after breaking into the whole-cell recording the

resting membrane potentials were recorded in current-clamp

mode In TGF-b1-treated cells the resting membrane poten-

tials showed a mean value of 2658 6 38 mV (n 5 27) In

control cells the resting membrane potentials were with

2505 6 82 mV (n 5 21 P lt 00001 Fig 2A) more posi-

tive than that in the treated cells Membrane capacitance

ranged in both groups of cells between 22 and 102 pF

(mean value 6 6 27 pF n 5 44)

NPCs treated with TGF-b1 showed different patterns

of ion channels compared with that of vehicle-treated cells

Although control cells showed only outwardly rectifying ion

channels which could be activated by depolarization from a

holding potential of 280 mV and an activation threshold at

220 mV (Fig 2BD) the TGF-b1-treated cells showed a

more complex pattern of voltage-dependent ion channels

(Fig 2CE) Depolarization from 280 mV lead to activation

of fast activating inward currents followed by fast activating

and inactivating outwardly rectifying currents Moreover the

incomplete inactivation of the outward currents suggests the

presence of an outwardly rectifying channel endowed with

slow activation and no inactivation Thus treatment of adult

NPCs with TGF-b1 changed the pattern of expressed ion

channels and established a clear neuronal phenotype The pre-

cise properties of ion channels were examined in more detail

to define the nature of the TGF-b1-induced phenotype

Characterization of Voltage-Gated Ion ChannelExpression Induced by TGF-b1

VOLTAGE-GATED Na1 CURRENTS Depolarization of

TGF-b1-treated NPCs led to fast activating and inactivating

inward currents showing properties of voltage-dependent

Na1 channels currents Under K1-free conditions a voltage-

clamp protocol was used to further test for the presence of

Na1 currents in the TGF-b1-treated and control cells This

protocol consisted of depolarizing steps to 110 mV with 10

mV increment and 50 ms duration from 280 mV holding

potential In TGF-b1-treated cells depolarizing voltage stim-

ulus elicited a fast activating inward current that peaked after

1ndash2 ms and inactivated within 5 ms (n 5 39 Fig 3A) These

currents activated at potentials more positive than 250 mV

The transient inward current was completely blocked by 10

nM TTX confirming that it originated from TTX-sensitive

Na1-currents (Fig 3BC) In contrast no inward Na1 cur-

rent was detected in any control-treated cells investigated here

(n 5 48) As the presence of voltage-dependent Na1 channels

was dependent on the treatment by TGF-b1 we next

TABLE 2 Change in Expression of Neuronal Genes by TGF-b1 Treatment Measured by Gene Array Analysis

Gene Gene Symbole Fold Change(TGF-b1 vs Control)

Neurexin 1 Nrxn1 296

Septin 8 (predicted) Sept8_predicted 252

Calcium channel voltage-dependent c subunit 4 Cacng4 245

Ca21-dependent activator protein for secretion Cadps 222

Sodium channel voltage-gated Type I b-polypeptide Scn1b 222

Amyotrophic lateral sclerosis 2 (juvenile) chromosomeregion candidate 3 homolog (human)

Als2cr3 222

ATPase Na1K1 transporting a2 polypeptide Atp1a2 207

Synaptosomal-associated protein 25 Snap25 194

Amiloride-sensitive cation channel 1 neuronal (degenerin) Accn1 191

Glutamate receptor ionotropic kainite 4 Grik4 180

Glutamate receptor ionotropic AMPA3 (a3) Gria3 194

Synaptogyrin 3 (predicted) Syngr3_predicted 181

Glutamate receptor ionotropic 4 Gria4 178

Potassium voltage-gated channel Shal-related family member 3 Kcnd3 173

Disks large (Drosophila) homolog-associated protein 1 Dlgap1 169

1774 Volume 61 No 11

examined whether density of INa would increase with days of

TGF-b1 treatment Indeed the average measured INa density

in the TGF-b1-treated cells more than doubled from Day 9

(865 6 47 pApF21 n 5 19) to Day 11 (2238 6 131

pApF21 n 5 18 P lt 00001 Fig 3D)

VOLTAGE-GATED K1-CURRENTS TGF-b1 treatments also

induced differences in outwardly rectifying ion currents

resembling rectifying potassium channels These outwardly

rectifying currents disappeared under K1-free conditions

strongly substantiating that they were mediated through

voltage-dependent K1-channels Therefore the characteriza-

tion of voltage-dependent K1-channels was performed in

more detail To avoid the recording of super-imposed Na1

channel currents the cells were voltage clamped to 240 mV

and stepped to potentials ranging from 2130 to 140 mV

using 10-mV increments for 50 ms whereas corresponding

currents were recorded Outward currents were observed in

all cells To analyze the presence of currents from different

K1-channels currents evoked by stepwise depolarization from

240 mV holding potential were subtracted from those

evoked from 280 mV holding potential In the TGF-b1-

treated cells we demonstrated that the outward currents result

from the coordinated activity of two K1-channel populations

First a noninactivating delayed-rectified current (IK(DR))

obtained from the 240 mV holding potential constituted

most of the total K1-current Second a fast-inactivating A-

type K1-current (IK(A)) was revealed by the subtraction proto-

col Both current components had activation thresholds

between 230 and 240 mV and both types of currents con-

tributed in different proportions to whole-cell currents in

morphologically identical cells In the majority of cells the

presence of the two different outward potassium currents

could be observed (Fig 4E) Furthermore some cells were

found to express only A-type (Fig 4C) or only delayed-

rectifier currents (Fig 4A) In the next step the relative con-

tribution of the three potassium channel combinations was

compared in control and TGF-b1-treated cells (Fig 4G) As

shown in Fig 4G 583 of the control cells (n 5 48) and

similarly 518 of the cells with TGF-b1 treatment (n 5 39)

showed that the outward current was composed of both K1-

channel types However TGF-b1 treatment significantly

decreased the percentage of cells expressing only A-type chan-

nels (IK(A)) from 297 in control cells to 36 whereas the

percentage of cells which express only delayed-rectifier chan-

nels (IK(DR)) was increased from 120 to 446 A separate

analysis of the inward and outward current densities showed a

significant higher inward current density with 440 6 36

FIGURE 2 Voltage-dependent membrane currents of rat NPCs under control conditions and after TGF-b1 treatment A The mean rest-ing membrane potential (RMP) was significantly shifted toward more hyperpolarized potentials B Whole-cell currents under control con-ditions (physiological Na1- and K1-concentrations) elicited by electrical stimulation shown in the inset from a holding potential of 280mV the cells were first depolarized by nine voltage steps of 10 mV increasing amplitude and 50 ms duration which were followed bynine voltage steps of 210 mV increasing amplitude to hyperpolarize the cells Representative current trace recorded in cells withoutTGF-b1 treatment showed mainly outwardly directed currents and no inward currents C In contrast after TGF-b1 treatment the cellsexpressed voltage-gated sodium currents Averaged IV-curves are shown in (D) and (E) for the time points indicated by the open (initialresponse) and filled circle (steady state) Error bars indicate SEM where error bars are not visible they are smaller than the symbols

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1775

pApF21 in TGF-b1-treated cells (n 5 35) than in control

cells (42 6 03 pApF21 n 5 43 P lt 00001) whereas the

maximal outward current density was with 2062 6 339

pApF21 in control cells nearly equal to that in TGF-b1-

treated cells (2189 6 171 pApF21 P 5 072 Fig 4H)

Moreover in TGF-b1-treated cells the stepwise hyper-

polarization from a holding potential of 280 to 2170 mV

(10 mV increment 50 ms duration) elicited an inwardly rec-

tifying current (n 5 35 Fig 5AB) activated at potentials

more negative than 270 mV (Fig 5C) and showing mild

inactivation at very low potentials In contrast no inward rec-

tifier current was detected in any of the cells without TGF-

b1 treatment (n 5 43) As shown in Fig 5D 30 of the

TGF-b1-treated cells showed a combination of inward recti-

fier currents with delayed rectifier potassium current only

whereas 63 of the cells showed a combination with A-type

and delayed-rectifier K1-currents

VOLTAGE-GATED Ca21 CHANNEL CURRENTS To inves-

tigate the expression of voltage-dependent Ca21 channels as

an additional neuronal marker whole-cell recordings were

performed under extra- and intracellular K1-free conditions

with cells from both experimental groups As a standard set-

ting the cells were stimulated by stepwise depolarization

from a holding potential of 280 mV (110 mV increment

50 ms duration) Currents were measured with 10 mM Ba21

as charge carrier as well as 10 nM TTX in the bath solution

to inhibit superimposed sodium currents We found the

expression of Ca21 channels only after treatment with TGF-

b1 Depolarizing voltage pulse elicited fast activating inward

currents that showed little inactivation during the voltage

stimulus (Fig 6A) The currents which reached a steady state

within 5 ms got activated at potentials higher than 240 6

22 mV (n 5 7 Fig 6B) and reached a maximal current den-

sity of 124 6 19 pApF21 (n 5 7) at 110 mV The

voltage-dependent activation was calculated using the Boltz-

mann equation to fit the activation curve The Ba21-currents

were sensitive to dihydropyridine derivatives Application of

the enantiomer (1)BayK8644 (2 lM) a blocker of voltage-

dependent L-type Ca21 channels reduced the currents to

361 6 32 of the control values (peak current amplitude

n 5 7) These currents showed a voltage dependence

FIGURE 3 Voltage-gated sodium currents To measure currents through voltage-dependent Na1 channels whole-cell recordings wereperformed under extra- and intracellular K1-free conditions membrane voltage was clamped at a holding potential of 280 mV and thecells were depolarized to 10 mV in 10 mV steps in 50 ms followed by 210 mV steps to 2170 mV A Representative voltage-clamprecording of voltage-gated Na1 current (INa) from TGF-b1-treated cells using potassium-free solution B Fast inward currents could becompletely blocked by application of TTX (10 nM) C Normalized currentndashvoltage relationship of the peak INa shown in (A) and afteraddition of 10 nM TTX Addition of 10 nM tetrodotoxin (TTX) in the bath solution blocked INa completely INa displayed the characteris-tic IndashV relationship of voltage-gated sodium currents with a peak close to 210 mV and an activation threshold close to 250 mV D Dia-gram showing the effect of TGF-b1 treatment on the rise in sodium current density [INa] (P lt 0001)

1776 Volume 61 No 11

pharmacological and kinetic characteristics for L-type calcium

currents The properties of calcium channel currents in TGF-

b1-treated cells are summarized in Table 3

TGF-b1-treated cells show APs

We then determined whether the activity of voltage-activated

sodium conductance in TGF-b1-treated cells is strong enough

to allow the generation of APs Depolarizing current steps

(01ndash1 nA) were applied in the current-clamp mode Without

TGF-b1 treatment none of the progenitor cells (n 5 48)

fired APs in response to current injections In contrast 42

out of 50 tested cells with TGF-b1 treatment showed after 1

s of depolarization at least one AP that could be reversibly

blocked by TTX (10 nM Fig 7) The threshold for AP ini-

tiation was 2303 6 04 mV (n 5 15) to generate a TTX-

sensitive AP with a duration of 51 6 02 ms (n 5 15) and a

short after-hyperpolarization APs reached an amplitude of

4278 6 047 mV (n 5 15) The length of the after-

hyperpolarization was 219 6 11 ms with a maximal ampli-

tude of 139 6 05 mV (n 5 15) The properties of APs are

summarized in Table 4

TGF-b1-treated cells form synapses

To further study neuronal differentiation on the functional

level the expression of neurotransmitter receptor and the for-

mation of synapses was analyzed Whole-cell currents were

measured from TGF-b1-treated cells using K1 containing

control solutions and membrane conductance was monitored

by electrical stimulation from a holding potential of 270 mV

by 5 voltage steps of 50 ms duration and 20 mV increment

to depolarize the cells and five voltage steps of 50 ms dura-

tion and 220 mV increment to hyperpolarize the cells

Application of 1 mM GABA led to an increase in the mem-

brane conductance which resulted in an inwardly rectifying

conductance with a reversal potential of 261 6 02 mV (n5 3) close to the Nernst potential for K1 at our recording

conditions of 274 mV (Fig 8A) which is consistent with the

activation of a K1-conductance The TGF-b1-treated cells

FIGURE 4 Voltage-gated outward potassium currents Outward currents were evoked in response to membrane voltage steps from2130 mV to 140 mV at 10 mV intervals from a holding potential of 240 mV Data illustrate the classification of cells according to theirresponses to current steps and the corresponding IndashV plots Analysis of voltage-dependent activation steady-state current amplitudeswere plotted against the membrane potentials of the electrical stimulation Three major cell types were identified A Type I cells exhib-ited delayed rectifier potassium current only C Type II cells expressing only A-type potassium currents and Type III cells exhibited botha fast inactivating A-type potassium current and a noninactivating delayed rectifier potassium current E) Averaged IV-curves of eachtype are shown in (B D and F) G Data illustrate the relative contributions of the different potassium currents (stimulation 240 mV) inthe population of cells examined The percentage of cells expressing delayed rectifier potassium currents only (IK(DR)) increased signifi-cantly after TGF-b1 treatment In contrast the total outward current density (IK(DR1A)) remained relatively constant H Comparison ofthe maximal outward current density of cells measured under control conditions and after TGF-b1 treatment

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1777

showed in the presence of GABA an increase in the mem-

brane current at a holding potential of 2150 mV from

2176 6 47 pA (n 5 3) to 21080 6 142 pA (n 5 3 P 5

0004) Nontreated NPCs showed no changes in the mem-

brane conductance after application of GABA

As the TGF-b1-treated cells showed expression of

GABA receptors the possible formation of synapses was stud-

ied For this purpose long-time recordings of the holding

current at 270 mV were performed (Fig 8B) At higher

amplification current fluctuations were measured with ampli-

tudes of 32 6 27 pA (n 5 4) Application of 100 lM picro-

toxine led to a decrease in these current fluctuations to 119

6 11 pA (n 5 4 P 5 00005 Fig 8CD) In some cells

we observed a shift of the base-line currents toward 0 pA

Thus we cannot exclude that some of the cells showed tonic

receptor activation

Summary of TGF-b1 effects on NPCs

To give an overview on the TGF-b1-induced functional

effects the number of cells which show different aspects of

functional neuronal differentiation was compared between

TGF-b1 and control groups (Fig 9) Among the nontreated

cells there were no cells showing Na1 channel currents APs

or GABAergic currents In contrast to that the TGF-b1-

FIGURE 5 Inward rectifier potassium currents in TGF-b1-treated cells A Hyperpolarizing voltage steps from a holding potential of 280to 2170 mV (10 mV increment 50 ms duration) induced an inwardly rectifying current as shown here in a representative trace for TGF-b1-treated cell B Inward rectifier K1-component of the total current C Corresponding currentvoltage relationship of the current Thecurrents activate at potentials more negative than 270 mV D Frequency distribution of inwardly rectifying K1 currents expression incontrol cells and in cells after TGF-b1 treatment In control cells no inward inwardly rectifying current was detected in any of the cellsexamined In TGF-b1-treated cells 94 of the cells showed inwardly rectifying currents (n 5 35) In brief 63 of these showed a combi-nation with A-type and delayed rectifier K1-currents whereas only 30 with delayed rectifier currents

FIGURE 6 Voltage-gated Ca21 channel currents A Currentswere activated by voltage steps from 2170 mV to 110 mV for50 ms from a holding potential of 280 mV Experiments weredone under extra- and intracellular K1-free conditions in thepresence of 10 nM TTX in the bath solution to inhibit sodiumcurrents and with Ba21 as the charge carrier Normalized cur-rentndashvoltage relationships fitted with Boltzmann function areshown in (B) The kinetic properties of calcium channel currentsare summarized in Table 3

1778 Volume 61 No 11

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

TABLE 1 Continued

Gene Title Gene Symbol Change TGF-b1 VersusNonstimulated Cells

Growth differentiation factor 6 Gdf6 NC

Growth differentiation factor 8 Gdf8 NC

Growth differentiation factor 9 Gdf9 NC

Growth factor independent 1 Gfi1 NC

Growth factor erv1-like Gfer NC

Hepatic leukemia factor Hlf NC

Hepatocyte growth factor Hgf NC

Hepatoma-derived growth factor Hdgf NC

Insulin-like growth factor 1 Igf1 NC

Insulin-like growth factor 2 Igf2 NC

Kruppel-like factor Klf2 NC

Kruppel-like factor 15 Klf15 NC

Kruppel-like factor 3 (basic) Klf3 NC

Kruppel-like factor 5 Klf5 NC

Kruppel-like factor 7 (ubiquitous) (predicted) Klf7_predicted NC

Leukemia inhibitory factor Lif NC

LPS-induced TNF-a factor RGD69294 NC

Macrophage migration inhibitory factor Mif D

Macrophage stimulating 1 (hepatocyte growth factor-like) Mst1 NC

Nerve growth factor b Ngfb NC

Nerve growth factor c Ngfg NC

Placental growth factor Pgf NC

Platelet-derived growth factor a Pdgfa D

Pre-B-cell colony enhancing factor 1 Pbef1 NC

Stem cell growth factor Scgf NC

Stromal cell-derived factor 2 (predicted) Sdf2_predicted NC

Stromal cell-derived factor 4 Sdf4 NC

Thyrotroph embryonic factor Tef NC

TGF-a Tgfa D

TGF-b1 Tgfb1 NC

TGF-b2 Tgfb2 D

TGF-b2 Tgfb2 NC

TGF-b3 Tgfb3 NC

Vascular endothelial growth factor A Vegfa NC

Vascular endothelial growth factor C Vegfc NC

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1773

TGF-b1 Changes Basic ElectrophysiologicalProperties of NPCsImmediately after breaking into the whole-cell recording the

resting membrane potentials were recorded in current-clamp

mode In TGF-b1-treated cells the resting membrane poten-

tials showed a mean value of 2658 6 38 mV (n 5 27) In

control cells the resting membrane potentials were with

2505 6 82 mV (n 5 21 P lt 00001 Fig 2A) more posi-

tive than that in the treated cells Membrane capacitance

ranged in both groups of cells between 22 and 102 pF

(mean value 6 6 27 pF n 5 44)

NPCs treated with TGF-b1 showed different patterns

of ion channels compared with that of vehicle-treated cells

Although control cells showed only outwardly rectifying ion

channels which could be activated by depolarization from a

holding potential of 280 mV and an activation threshold at

220 mV (Fig 2BD) the TGF-b1-treated cells showed a

more complex pattern of voltage-dependent ion channels

(Fig 2CE) Depolarization from 280 mV lead to activation

of fast activating inward currents followed by fast activating

and inactivating outwardly rectifying currents Moreover the

incomplete inactivation of the outward currents suggests the

presence of an outwardly rectifying channel endowed with

slow activation and no inactivation Thus treatment of adult

NPCs with TGF-b1 changed the pattern of expressed ion

channels and established a clear neuronal phenotype The pre-

cise properties of ion channels were examined in more detail

to define the nature of the TGF-b1-induced phenotype

Characterization of Voltage-Gated Ion ChannelExpression Induced by TGF-b1

VOLTAGE-GATED Na1 CURRENTS Depolarization of

TGF-b1-treated NPCs led to fast activating and inactivating

inward currents showing properties of voltage-dependent

Na1 channels currents Under K1-free conditions a voltage-

clamp protocol was used to further test for the presence of

Na1 currents in the TGF-b1-treated and control cells This

protocol consisted of depolarizing steps to 110 mV with 10

mV increment and 50 ms duration from 280 mV holding

potential In TGF-b1-treated cells depolarizing voltage stim-

ulus elicited a fast activating inward current that peaked after

1ndash2 ms and inactivated within 5 ms (n 5 39 Fig 3A) These

currents activated at potentials more positive than 250 mV

The transient inward current was completely blocked by 10

nM TTX confirming that it originated from TTX-sensitive

Na1-currents (Fig 3BC) In contrast no inward Na1 cur-

rent was detected in any control-treated cells investigated here

(n 5 48) As the presence of voltage-dependent Na1 channels

was dependent on the treatment by TGF-b1 we next

TABLE 2 Change in Expression of Neuronal Genes by TGF-b1 Treatment Measured by Gene Array Analysis

Gene Gene Symbole Fold Change(TGF-b1 vs Control)

Neurexin 1 Nrxn1 296

Septin 8 (predicted) Sept8_predicted 252

Calcium channel voltage-dependent c subunit 4 Cacng4 245

Ca21-dependent activator protein for secretion Cadps 222

Sodium channel voltage-gated Type I b-polypeptide Scn1b 222

Amyotrophic lateral sclerosis 2 (juvenile) chromosomeregion candidate 3 homolog (human)

Als2cr3 222

ATPase Na1K1 transporting a2 polypeptide Atp1a2 207

Synaptosomal-associated protein 25 Snap25 194

Amiloride-sensitive cation channel 1 neuronal (degenerin) Accn1 191

Glutamate receptor ionotropic kainite 4 Grik4 180

Glutamate receptor ionotropic AMPA3 (a3) Gria3 194

Synaptogyrin 3 (predicted) Syngr3_predicted 181

Glutamate receptor ionotropic 4 Gria4 178

Potassium voltage-gated channel Shal-related family member 3 Kcnd3 173

Disks large (Drosophila) homolog-associated protein 1 Dlgap1 169

1774 Volume 61 No 11

examined whether density of INa would increase with days of

TGF-b1 treatment Indeed the average measured INa density

in the TGF-b1-treated cells more than doubled from Day 9

(865 6 47 pApF21 n 5 19) to Day 11 (2238 6 131

pApF21 n 5 18 P lt 00001 Fig 3D)

VOLTAGE-GATED K1-CURRENTS TGF-b1 treatments also

induced differences in outwardly rectifying ion currents

resembling rectifying potassium channels These outwardly

rectifying currents disappeared under K1-free conditions

strongly substantiating that they were mediated through

voltage-dependent K1-channels Therefore the characteriza-

tion of voltage-dependent K1-channels was performed in

more detail To avoid the recording of super-imposed Na1

channel currents the cells were voltage clamped to 240 mV

and stepped to potentials ranging from 2130 to 140 mV

using 10-mV increments for 50 ms whereas corresponding

currents were recorded Outward currents were observed in

all cells To analyze the presence of currents from different

K1-channels currents evoked by stepwise depolarization from

240 mV holding potential were subtracted from those

evoked from 280 mV holding potential In the TGF-b1-

treated cells we demonstrated that the outward currents result

from the coordinated activity of two K1-channel populations

First a noninactivating delayed-rectified current (IK(DR))

obtained from the 240 mV holding potential constituted

most of the total K1-current Second a fast-inactivating A-

type K1-current (IK(A)) was revealed by the subtraction proto-

col Both current components had activation thresholds

between 230 and 240 mV and both types of currents con-

tributed in different proportions to whole-cell currents in

morphologically identical cells In the majority of cells the

presence of the two different outward potassium currents

could be observed (Fig 4E) Furthermore some cells were

found to express only A-type (Fig 4C) or only delayed-

rectifier currents (Fig 4A) In the next step the relative con-

tribution of the three potassium channel combinations was

compared in control and TGF-b1-treated cells (Fig 4G) As

shown in Fig 4G 583 of the control cells (n 5 48) and

similarly 518 of the cells with TGF-b1 treatment (n 5 39)

showed that the outward current was composed of both K1-

channel types However TGF-b1 treatment significantly

decreased the percentage of cells expressing only A-type chan-

nels (IK(A)) from 297 in control cells to 36 whereas the

percentage of cells which express only delayed-rectifier chan-

nels (IK(DR)) was increased from 120 to 446 A separate

analysis of the inward and outward current densities showed a

significant higher inward current density with 440 6 36

FIGURE 2 Voltage-dependent membrane currents of rat NPCs under control conditions and after TGF-b1 treatment A The mean rest-ing membrane potential (RMP) was significantly shifted toward more hyperpolarized potentials B Whole-cell currents under control con-ditions (physiological Na1- and K1-concentrations) elicited by electrical stimulation shown in the inset from a holding potential of 280mV the cells were first depolarized by nine voltage steps of 10 mV increasing amplitude and 50 ms duration which were followed bynine voltage steps of 210 mV increasing amplitude to hyperpolarize the cells Representative current trace recorded in cells withoutTGF-b1 treatment showed mainly outwardly directed currents and no inward currents C In contrast after TGF-b1 treatment the cellsexpressed voltage-gated sodium currents Averaged IV-curves are shown in (D) and (E) for the time points indicated by the open (initialresponse) and filled circle (steady state) Error bars indicate SEM where error bars are not visible they are smaller than the symbols

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1775

pApF21 in TGF-b1-treated cells (n 5 35) than in control

cells (42 6 03 pApF21 n 5 43 P lt 00001) whereas the

maximal outward current density was with 2062 6 339

pApF21 in control cells nearly equal to that in TGF-b1-

treated cells (2189 6 171 pApF21 P 5 072 Fig 4H)

Moreover in TGF-b1-treated cells the stepwise hyper-

polarization from a holding potential of 280 to 2170 mV

(10 mV increment 50 ms duration) elicited an inwardly rec-

tifying current (n 5 35 Fig 5AB) activated at potentials

more negative than 270 mV (Fig 5C) and showing mild

inactivation at very low potentials In contrast no inward rec-

tifier current was detected in any of the cells without TGF-

b1 treatment (n 5 43) As shown in Fig 5D 30 of the

TGF-b1-treated cells showed a combination of inward recti-

fier currents with delayed rectifier potassium current only

whereas 63 of the cells showed a combination with A-type

and delayed-rectifier K1-currents

VOLTAGE-GATED Ca21 CHANNEL CURRENTS To inves-

tigate the expression of voltage-dependent Ca21 channels as

an additional neuronal marker whole-cell recordings were

performed under extra- and intracellular K1-free conditions

with cells from both experimental groups As a standard set-

ting the cells were stimulated by stepwise depolarization

from a holding potential of 280 mV (110 mV increment

50 ms duration) Currents were measured with 10 mM Ba21

as charge carrier as well as 10 nM TTX in the bath solution

to inhibit superimposed sodium currents We found the

expression of Ca21 channels only after treatment with TGF-

b1 Depolarizing voltage pulse elicited fast activating inward

currents that showed little inactivation during the voltage

stimulus (Fig 6A) The currents which reached a steady state

within 5 ms got activated at potentials higher than 240 6

22 mV (n 5 7 Fig 6B) and reached a maximal current den-

sity of 124 6 19 pApF21 (n 5 7) at 110 mV The

voltage-dependent activation was calculated using the Boltz-

mann equation to fit the activation curve The Ba21-currents

were sensitive to dihydropyridine derivatives Application of

the enantiomer (1)BayK8644 (2 lM) a blocker of voltage-

dependent L-type Ca21 channels reduced the currents to

361 6 32 of the control values (peak current amplitude

n 5 7) These currents showed a voltage dependence

FIGURE 3 Voltage-gated sodium currents To measure currents through voltage-dependent Na1 channels whole-cell recordings wereperformed under extra- and intracellular K1-free conditions membrane voltage was clamped at a holding potential of 280 mV and thecells were depolarized to 10 mV in 10 mV steps in 50 ms followed by 210 mV steps to 2170 mV A Representative voltage-clamprecording of voltage-gated Na1 current (INa) from TGF-b1-treated cells using potassium-free solution B Fast inward currents could becompletely blocked by application of TTX (10 nM) C Normalized currentndashvoltage relationship of the peak INa shown in (A) and afteraddition of 10 nM TTX Addition of 10 nM tetrodotoxin (TTX) in the bath solution blocked INa completely INa displayed the characteris-tic IndashV relationship of voltage-gated sodium currents with a peak close to 210 mV and an activation threshold close to 250 mV D Dia-gram showing the effect of TGF-b1 treatment on the rise in sodium current density [INa] (P lt 0001)

1776 Volume 61 No 11

pharmacological and kinetic characteristics for L-type calcium

currents The properties of calcium channel currents in TGF-

b1-treated cells are summarized in Table 3

TGF-b1-treated cells show APs

We then determined whether the activity of voltage-activated

sodium conductance in TGF-b1-treated cells is strong enough

to allow the generation of APs Depolarizing current steps

(01ndash1 nA) were applied in the current-clamp mode Without

TGF-b1 treatment none of the progenitor cells (n 5 48)

fired APs in response to current injections In contrast 42

out of 50 tested cells with TGF-b1 treatment showed after 1

s of depolarization at least one AP that could be reversibly

blocked by TTX (10 nM Fig 7) The threshold for AP ini-

tiation was 2303 6 04 mV (n 5 15) to generate a TTX-

sensitive AP with a duration of 51 6 02 ms (n 5 15) and a

short after-hyperpolarization APs reached an amplitude of

4278 6 047 mV (n 5 15) The length of the after-

hyperpolarization was 219 6 11 ms with a maximal ampli-

tude of 139 6 05 mV (n 5 15) The properties of APs are

summarized in Table 4

TGF-b1-treated cells form synapses

To further study neuronal differentiation on the functional

level the expression of neurotransmitter receptor and the for-

mation of synapses was analyzed Whole-cell currents were

measured from TGF-b1-treated cells using K1 containing

control solutions and membrane conductance was monitored

by electrical stimulation from a holding potential of 270 mV

by 5 voltage steps of 50 ms duration and 20 mV increment

to depolarize the cells and five voltage steps of 50 ms dura-

tion and 220 mV increment to hyperpolarize the cells

Application of 1 mM GABA led to an increase in the mem-

brane conductance which resulted in an inwardly rectifying

conductance with a reversal potential of 261 6 02 mV (n5 3) close to the Nernst potential for K1 at our recording

conditions of 274 mV (Fig 8A) which is consistent with the

activation of a K1-conductance The TGF-b1-treated cells

FIGURE 4 Voltage-gated outward potassium currents Outward currents were evoked in response to membrane voltage steps from2130 mV to 140 mV at 10 mV intervals from a holding potential of 240 mV Data illustrate the classification of cells according to theirresponses to current steps and the corresponding IndashV plots Analysis of voltage-dependent activation steady-state current amplitudeswere plotted against the membrane potentials of the electrical stimulation Three major cell types were identified A Type I cells exhib-ited delayed rectifier potassium current only C Type II cells expressing only A-type potassium currents and Type III cells exhibited botha fast inactivating A-type potassium current and a noninactivating delayed rectifier potassium current E) Averaged IV-curves of eachtype are shown in (B D and F) G Data illustrate the relative contributions of the different potassium currents (stimulation 240 mV) inthe population of cells examined The percentage of cells expressing delayed rectifier potassium currents only (IK(DR)) increased signifi-cantly after TGF-b1 treatment In contrast the total outward current density (IK(DR1A)) remained relatively constant H Comparison ofthe maximal outward current density of cells measured under control conditions and after TGF-b1 treatment

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1777

showed in the presence of GABA an increase in the mem-

brane current at a holding potential of 2150 mV from

2176 6 47 pA (n 5 3) to 21080 6 142 pA (n 5 3 P 5

0004) Nontreated NPCs showed no changes in the mem-

brane conductance after application of GABA

As the TGF-b1-treated cells showed expression of

GABA receptors the possible formation of synapses was stud-

ied For this purpose long-time recordings of the holding

current at 270 mV were performed (Fig 8B) At higher

amplification current fluctuations were measured with ampli-

tudes of 32 6 27 pA (n 5 4) Application of 100 lM picro-

toxine led to a decrease in these current fluctuations to 119

6 11 pA (n 5 4 P 5 00005 Fig 8CD) In some cells

we observed a shift of the base-line currents toward 0 pA

Thus we cannot exclude that some of the cells showed tonic

receptor activation

Summary of TGF-b1 effects on NPCs

To give an overview on the TGF-b1-induced functional

effects the number of cells which show different aspects of

functional neuronal differentiation was compared between

TGF-b1 and control groups (Fig 9) Among the nontreated

cells there were no cells showing Na1 channel currents APs

or GABAergic currents In contrast to that the TGF-b1-

FIGURE 5 Inward rectifier potassium currents in TGF-b1-treated cells A Hyperpolarizing voltage steps from a holding potential of 280to 2170 mV (10 mV increment 50 ms duration) induced an inwardly rectifying current as shown here in a representative trace for TGF-b1-treated cell B Inward rectifier K1-component of the total current C Corresponding currentvoltage relationship of the current Thecurrents activate at potentials more negative than 270 mV D Frequency distribution of inwardly rectifying K1 currents expression incontrol cells and in cells after TGF-b1 treatment In control cells no inward inwardly rectifying current was detected in any of the cellsexamined In TGF-b1-treated cells 94 of the cells showed inwardly rectifying currents (n 5 35) In brief 63 of these showed a combi-nation with A-type and delayed rectifier K1-currents whereas only 30 with delayed rectifier currents

FIGURE 6 Voltage-gated Ca21 channel currents A Currentswere activated by voltage steps from 2170 mV to 110 mV for50 ms from a holding potential of 280 mV Experiments weredone under extra- and intracellular K1-free conditions in thepresence of 10 nM TTX in the bath solution to inhibit sodiumcurrents and with Ba21 as the charge carrier Normalized cur-rentndashvoltage relationships fitted with Boltzmann function areshown in (B) The kinetic properties of calcium channel currentsare summarized in Table 3

1778 Volume 61 No 11

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

TGF-b1 Changes Basic ElectrophysiologicalProperties of NPCsImmediately after breaking into the whole-cell recording the

resting membrane potentials were recorded in current-clamp

mode In TGF-b1-treated cells the resting membrane poten-

tials showed a mean value of 2658 6 38 mV (n 5 27) In

control cells the resting membrane potentials were with

2505 6 82 mV (n 5 21 P lt 00001 Fig 2A) more posi-

tive than that in the treated cells Membrane capacitance

ranged in both groups of cells between 22 and 102 pF

(mean value 6 6 27 pF n 5 44)

NPCs treated with TGF-b1 showed different patterns

of ion channels compared with that of vehicle-treated cells

Although control cells showed only outwardly rectifying ion

channels which could be activated by depolarization from a

holding potential of 280 mV and an activation threshold at

220 mV (Fig 2BD) the TGF-b1-treated cells showed a

more complex pattern of voltage-dependent ion channels

(Fig 2CE) Depolarization from 280 mV lead to activation

of fast activating inward currents followed by fast activating

and inactivating outwardly rectifying currents Moreover the

incomplete inactivation of the outward currents suggests the

presence of an outwardly rectifying channel endowed with

slow activation and no inactivation Thus treatment of adult

NPCs with TGF-b1 changed the pattern of expressed ion

channels and established a clear neuronal phenotype The pre-

cise properties of ion channels were examined in more detail

to define the nature of the TGF-b1-induced phenotype

Characterization of Voltage-Gated Ion ChannelExpression Induced by TGF-b1

VOLTAGE-GATED Na1 CURRENTS Depolarization of

TGF-b1-treated NPCs led to fast activating and inactivating

inward currents showing properties of voltage-dependent

Na1 channels currents Under K1-free conditions a voltage-

clamp protocol was used to further test for the presence of

Na1 currents in the TGF-b1-treated and control cells This

protocol consisted of depolarizing steps to 110 mV with 10

mV increment and 50 ms duration from 280 mV holding

potential In TGF-b1-treated cells depolarizing voltage stim-

ulus elicited a fast activating inward current that peaked after

1ndash2 ms and inactivated within 5 ms (n 5 39 Fig 3A) These

currents activated at potentials more positive than 250 mV

The transient inward current was completely blocked by 10

nM TTX confirming that it originated from TTX-sensitive

Na1-currents (Fig 3BC) In contrast no inward Na1 cur-

rent was detected in any control-treated cells investigated here

(n 5 48) As the presence of voltage-dependent Na1 channels

was dependent on the treatment by TGF-b1 we next

TABLE 2 Change in Expression of Neuronal Genes by TGF-b1 Treatment Measured by Gene Array Analysis

Gene Gene Symbole Fold Change(TGF-b1 vs Control)

Neurexin 1 Nrxn1 296

Septin 8 (predicted) Sept8_predicted 252

Calcium channel voltage-dependent c subunit 4 Cacng4 245

Ca21-dependent activator protein for secretion Cadps 222

Sodium channel voltage-gated Type I b-polypeptide Scn1b 222

Amyotrophic lateral sclerosis 2 (juvenile) chromosomeregion candidate 3 homolog (human)

Als2cr3 222

ATPase Na1K1 transporting a2 polypeptide Atp1a2 207

Synaptosomal-associated protein 25 Snap25 194

Amiloride-sensitive cation channel 1 neuronal (degenerin) Accn1 191

Glutamate receptor ionotropic kainite 4 Grik4 180

Glutamate receptor ionotropic AMPA3 (a3) Gria3 194

Synaptogyrin 3 (predicted) Syngr3_predicted 181

Glutamate receptor ionotropic 4 Gria4 178

Potassium voltage-gated channel Shal-related family member 3 Kcnd3 173

Disks large (Drosophila) homolog-associated protein 1 Dlgap1 169

1774 Volume 61 No 11

examined whether density of INa would increase with days of

TGF-b1 treatment Indeed the average measured INa density

in the TGF-b1-treated cells more than doubled from Day 9

(865 6 47 pApF21 n 5 19) to Day 11 (2238 6 131

pApF21 n 5 18 P lt 00001 Fig 3D)

VOLTAGE-GATED K1-CURRENTS TGF-b1 treatments also

induced differences in outwardly rectifying ion currents

resembling rectifying potassium channels These outwardly

rectifying currents disappeared under K1-free conditions

strongly substantiating that they were mediated through

voltage-dependent K1-channels Therefore the characteriza-

tion of voltage-dependent K1-channels was performed in

more detail To avoid the recording of super-imposed Na1

channel currents the cells were voltage clamped to 240 mV

and stepped to potentials ranging from 2130 to 140 mV

using 10-mV increments for 50 ms whereas corresponding

currents were recorded Outward currents were observed in

all cells To analyze the presence of currents from different

K1-channels currents evoked by stepwise depolarization from

240 mV holding potential were subtracted from those

evoked from 280 mV holding potential In the TGF-b1-

treated cells we demonstrated that the outward currents result

from the coordinated activity of two K1-channel populations

First a noninactivating delayed-rectified current (IK(DR))

obtained from the 240 mV holding potential constituted

most of the total K1-current Second a fast-inactivating A-

type K1-current (IK(A)) was revealed by the subtraction proto-

col Both current components had activation thresholds

between 230 and 240 mV and both types of currents con-

tributed in different proportions to whole-cell currents in

morphologically identical cells In the majority of cells the

presence of the two different outward potassium currents

could be observed (Fig 4E) Furthermore some cells were

found to express only A-type (Fig 4C) or only delayed-

rectifier currents (Fig 4A) In the next step the relative con-

tribution of the three potassium channel combinations was

compared in control and TGF-b1-treated cells (Fig 4G) As

shown in Fig 4G 583 of the control cells (n 5 48) and

similarly 518 of the cells with TGF-b1 treatment (n 5 39)

showed that the outward current was composed of both K1-

channel types However TGF-b1 treatment significantly

decreased the percentage of cells expressing only A-type chan-

nels (IK(A)) from 297 in control cells to 36 whereas the

percentage of cells which express only delayed-rectifier chan-

nels (IK(DR)) was increased from 120 to 446 A separate

analysis of the inward and outward current densities showed a

significant higher inward current density with 440 6 36

FIGURE 2 Voltage-dependent membrane currents of rat NPCs under control conditions and after TGF-b1 treatment A The mean rest-ing membrane potential (RMP) was significantly shifted toward more hyperpolarized potentials B Whole-cell currents under control con-ditions (physiological Na1- and K1-concentrations) elicited by electrical stimulation shown in the inset from a holding potential of 280mV the cells were first depolarized by nine voltage steps of 10 mV increasing amplitude and 50 ms duration which were followed bynine voltage steps of 210 mV increasing amplitude to hyperpolarize the cells Representative current trace recorded in cells withoutTGF-b1 treatment showed mainly outwardly directed currents and no inward currents C In contrast after TGF-b1 treatment the cellsexpressed voltage-gated sodium currents Averaged IV-curves are shown in (D) and (E) for the time points indicated by the open (initialresponse) and filled circle (steady state) Error bars indicate SEM where error bars are not visible they are smaller than the symbols

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1775

pApF21 in TGF-b1-treated cells (n 5 35) than in control

cells (42 6 03 pApF21 n 5 43 P lt 00001) whereas the

maximal outward current density was with 2062 6 339

pApF21 in control cells nearly equal to that in TGF-b1-

treated cells (2189 6 171 pApF21 P 5 072 Fig 4H)

Moreover in TGF-b1-treated cells the stepwise hyper-

polarization from a holding potential of 280 to 2170 mV

(10 mV increment 50 ms duration) elicited an inwardly rec-

tifying current (n 5 35 Fig 5AB) activated at potentials

more negative than 270 mV (Fig 5C) and showing mild

inactivation at very low potentials In contrast no inward rec-

tifier current was detected in any of the cells without TGF-

b1 treatment (n 5 43) As shown in Fig 5D 30 of the

TGF-b1-treated cells showed a combination of inward recti-

fier currents with delayed rectifier potassium current only

whereas 63 of the cells showed a combination with A-type

and delayed-rectifier K1-currents

VOLTAGE-GATED Ca21 CHANNEL CURRENTS To inves-

tigate the expression of voltage-dependent Ca21 channels as

an additional neuronal marker whole-cell recordings were

performed under extra- and intracellular K1-free conditions

with cells from both experimental groups As a standard set-

ting the cells were stimulated by stepwise depolarization

from a holding potential of 280 mV (110 mV increment

50 ms duration) Currents were measured with 10 mM Ba21

as charge carrier as well as 10 nM TTX in the bath solution

to inhibit superimposed sodium currents We found the

expression of Ca21 channels only after treatment with TGF-

b1 Depolarizing voltage pulse elicited fast activating inward

currents that showed little inactivation during the voltage

stimulus (Fig 6A) The currents which reached a steady state

within 5 ms got activated at potentials higher than 240 6

22 mV (n 5 7 Fig 6B) and reached a maximal current den-

sity of 124 6 19 pApF21 (n 5 7) at 110 mV The

voltage-dependent activation was calculated using the Boltz-

mann equation to fit the activation curve The Ba21-currents

were sensitive to dihydropyridine derivatives Application of

the enantiomer (1)BayK8644 (2 lM) a blocker of voltage-

dependent L-type Ca21 channels reduced the currents to

361 6 32 of the control values (peak current amplitude

n 5 7) These currents showed a voltage dependence

FIGURE 3 Voltage-gated sodium currents To measure currents through voltage-dependent Na1 channels whole-cell recordings wereperformed under extra- and intracellular K1-free conditions membrane voltage was clamped at a holding potential of 280 mV and thecells were depolarized to 10 mV in 10 mV steps in 50 ms followed by 210 mV steps to 2170 mV A Representative voltage-clamprecording of voltage-gated Na1 current (INa) from TGF-b1-treated cells using potassium-free solution B Fast inward currents could becompletely blocked by application of TTX (10 nM) C Normalized currentndashvoltage relationship of the peak INa shown in (A) and afteraddition of 10 nM TTX Addition of 10 nM tetrodotoxin (TTX) in the bath solution blocked INa completely INa displayed the characteris-tic IndashV relationship of voltage-gated sodium currents with a peak close to 210 mV and an activation threshold close to 250 mV D Dia-gram showing the effect of TGF-b1 treatment on the rise in sodium current density [INa] (P lt 0001)

1776 Volume 61 No 11

pharmacological and kinetic characteristics for L-type calcium

currents The properties of calcium channel currents in TGF-

b1-treated cells are summarized in Table 3

TGF-b1-treated cells show APs

We then determined whether the activity of voltage-activated

sodium conductance in TGF-b1-treated cells is strong enough

to allow the generation of APs Depolarizing current steps

(01ndash1 nA) were applied in the current-clamp mode Without

TGF-b1 treatment none of the progenitor cells (n 5 48)

fired APs in response to current injections In contrast 42

out of 50 tested cells with TGF-b1 treatment showed after 1

s of depolarization at least one AP that could be reversibly

blocked by TTX (10 nM Fig 7) The threshold for AP ini-

tiation was 2303 6 04 mV (n 5 15) to generate a TTX-

sensitive AP with a duration of 51 6 02 ms (n 5 15) and a

short after-hyperpolarization APs reached an amplitude of

4278 6 047 mV (n 5 15) The length of the after-

hyperpolarization was 219 6 11 ms with a maximal ampli-

tude of 139 6 05 mV (n 5 15) The properties of APs are

summarized in Table 4

TGF-b1-treated cells form synapses

To further study neuronal differentiation on the functional

level the expression of neurotransmitter receptor and the for-

mation of synapses was analyzed Whole-cell currents were

measured from TGF-b1-treated cells using K1 containing

control solutions and membrane conductance was monitored

by electrical stimulation from a holding potential of 270 mV

by 5 voltage steps of 50 ms duration and 20 mV increment

to depolarize the cells and five voltage steps of 50 ms dura-

tion and 220 mV increment to hyperpolarize the cells

Application of 1 mM GABA led to an increase in the mem-

brane conductance which resulted in an inwardly rectifying

conductance with a reversal potential of 261 6 02 mV (n5 3) close to the Nernst potential for K1 at our recording

conditions of 274 mV (Fig 8A) which is consistent with the

activation of a K1-conductance The TGF-b1-treated cells

FIGURE 4 Voltage-gated outward potassium currents Outward currents were evoked in response to membrane voltage steps from2130 mV to 140 mV at 10 mV intervals from a holding potential of 240 mV Data illustrate the classification of cells according to theirresponses to current steps and the corresponding IndashV plots Analysis of voltage-dependent activation steady-state current amplitudeswere plotted against the membrane potentials of the electrical stimulation Three major cell types were identified A Type I cells exhib-ited delayed rectifier potassium current only C Type II cells expressing only A-type potassium currents and Type III cells exhibited botha fast inactivating A-type potassium current and a noninactivating delayed rectifier potassium current E) Averaged IV-curves of eachtype are shown in (B D and F) G Data illustrate the relative contributions of the different potassium currents (stimulation 240 mV) inthe population of cells examined The percentage of cells expressing delayed rectifier potassium currents only (IK(DR)) increased signifi-cantly after TGF-b1 treatment In contrast the total outward current density (IK(DR1A)) remained relatively constant H Comparison ofthe maximal outward current density of cells measured under control conditions and after TGF-b1 treatment

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1777

showed in the presence of GABA an increase in the mem-

brane current at a holding potential of 2150 mV from

2176 6 47 pA (n 5 3) to 21080 6 142 pA (n 5 3 P 5

0004) Nontreated NPCs showed no changes in the mem-

brane conductance after application of GABA

As the TGF-b1-treated cells showed expression of

GABA receptors the possible formation of synapses was stud-

ied For this purpose long-time recordings of the holding

current at 270 mV were performed (Fig 8B) At higher

amplification current fluctuations were measured with ampli-

tudes of 32 6 27 pA (n 5 4) Application of 100 lM picro-

toxine led to a decrease in these current fluctuations to 119

6 11 pA (n 5 4 P 5 00005 Fig 8CD) In some cells

we observed a shift of the base-line currents toward 0 pA

Thus we cannot exclude that some of the cells showed tonic

receptor activation

Summary of TGF-b1 effects on NPCs

To give an overview on the TGF-b1-induced functional

effects the number of cells which show different aspects of

functional neuronal differentiation was compared between

TGF-b1 and control groups (Fig 9) Among the nontreated

cells there were no cells showing Na1 channel currents APs

or GABAergic currents In contrast to that the TGF-b1-

FIGURE 5 Inward rectifier potassium currents in TGF-b1-treated cells A Hyperpolarizing voltage steps from a holding potential of 280to 2170 mV (10 mV increment 50 ms duration) induced an inwardly rectifying current as shown here in a representative trace for TGF-b1-treated cell B Inward rectifier K1-component of the total current C Corresponding currentvoltage relationship of the current Thecurrents activate at potentials more negative than 270 mV D Frequency distribution of inwardly rectifying K1 currents expression incontrol cells and in cells after TGF-b1 treatment In control cells no inward inwardly rectifying current was detected in any of the cellsexamined In TGF-b1-treated cells 94 of the cells showed inwardly rectifying currents (n 5 35) In brief 63 of these showed a combi-nation with A-type and delayed rectifier K1-currents whereas only 30 with delayed rectifier currents

FIGURE 6 Voltage-gated Ca21 channel currents A Currentswere activated by voltage steps from 2170 mV to 110 mV for50 ms from a holding potential of 280 mV Experiments weredone under extra- and intracellular K1-free conditions in thepresence of 10 nM TTX in the bath solution to inhibit sodiumcurrents and with Ba21 as the charge carrier Normalized cur-rentndashvoltage relationships fitted with Boltzmann function areshown in (B) The kinetic properties of calcium channel currentsare summarized in Table 3

1778 Volume 61 No 11

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

examined whether density of INa would increase with days of

TGF-b1 treatment Indeed the average measured INa density

in the TGF-b1-treated cells more than doubled from Day 9

(865 6 47 pApF21 n 5 19) to Day 11 (2238 6 131

pApF21 n 5 18 P lt 00001 Fig 3D)

VOLTAGE-GATED K1-CURRENTS TGF-b1 treatments also

induced differences in outwardly rectifying ion currents

resembling rectifying potassium channels These outwardly

rectifying currents disappeared under K1-free conditions

strongly substantiating that they were mediated through

voltage-dependent K1-channels Therefore the characteriza-

tion of voltage-dependent K1-channels was performed in

more detail To avoid the recording of super-imposed Na1

channel currents the cells were voltage clamped to 240 mV

and stepped to potentials ranging from 2130 to 140 mV

using 10-mV increments for 50 ms whereas corresponding

currents were recorded Outward currents were observed in

all cells To analyze the presence of currents from different

K1-channels currents evoked by stepwise depolarization from

240 mV holding potential were subtracted from those

evoked from 280 mV holding potential In the TGF-b1-

treated cells we demonstrated that the outward currents result

from the coordinated activity of two K1-channel populations

First a noninactivating delayed-rectified current (IK(DR))

obtained from the 240 mV holding potential constituted

most of the total K1-current Second a fast-inactivating A-

type K1-current (IK(A)) was revealed by the subtraction proto-

col Both current components had activation thresholds

between 230 and 240 mV and both types of currents con-

tributed in different proportions to whole-cell currents in

morphologically identical cells In the majority of cells the

presence of the two different outward potassium currents

could be observed (Fig 4E) Furthermore some cells were

found to express only A-type (Fig 4C) or only delayed-

rectifier currents (Fig 4A) In the next step the relative con-

tribution of the three potassium channel combinations was

compared in control and TGF-b1-treated cells (Fig 4G) As

shown in Fig 4G 583 of the control cells (n 5 48) and

similarly 518 of the cells with TGF-b1 treatment (n 5 39)

showed that the outward current was composed of both K1-

channel types However TGF-b1 treatment significantly

decreased the percentage of cells expressing only A-type chan-

nels (IK(A)) from 297 in control cells to 36 whereas the

percentage of cells which express only delayed-rectifier chan-

nels (IK(DR)) was increased from 120 to 446 A separate

analysis of the inward and outward current densities showed a

significant higher inward current density with 440 6 36

FIGURE 2 Voltage-dependent membrane currents of rat NPCs under control conditions and after TGF-b1 treatment A The mean rest-ing membrane potential (RMP) was significantly shifted toward more hyperpolarized potentials B Whole-cell currents under control con-ditions (physiological Na1- and K1-concentrations) elicited by electrical stimulation shown in the inset from a holding potential of 280mV the cells were first depolarized by nine voltage steps of 10 mV increasing amplitude and 50 ms duration which were followed bynine voltage steps of 210 mV increasing amplitude to hyperpolarize the cells Representative current trace recorded in cells withoutTGF-b1 treatment showed mainly outwardly directed currents and no inward currents C In contrast after TGF-b1 treatment the cellsexpressed voltage-gated sodium currents Averaged IV-curves are shown in (D) and (E) for the time points indicated by the open (initialresponse) and filled circle (steady state) Error bars indicate SEM where error bars are not visible they are smaller than the symbols

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1775

pApF21 in TGF-b1-treated cells (n 5 35) than in control

cells (42 6 03 pApF21 n 5 43 P lt 00001) whereas the

maximal outward current density was with 2062 6 339

pApF21 in control cells nearly equal to that in TGF-b1-

treated cells (2189 6 171 pApF21 P 5 072 Fig 4H)

Moreover in TGF-b1-treated cells the stepwise hyper-

polarization from a holding potential of 280 to 2170 mV

(10 mV increment 50 ms duration) elicited an inwardly rec-

tifying current (n 5 35 Fig 5AB) activated at potentials

more negative than 270 mV (Fig 5C) and showing mild

inactivation at very low potentials In contrast no inward rec-

tifier current was detected in any of the cells without TGF-

b1 treatment (n 5 43) As shown in Fig 5D 30 of the

TGF-b1-treated cells showed a combination of inward recti-

fier currents with delayed rectifier potassium current only

whereas 63 of the cells showed a combination with A-type

and delayed-rectifier K1-currents

VOLTAGE-GATED Ca21 CHANNEL CURRENTS To inves-

tigate the expression of voltage-dependent Ca21 channels as

an additional neuronal marker whole-cell recordings were

performed under extra- and intracellular K1-free conditions

with cells from both experimental groups As a standard set-

ting the cells were stimulated by stepwise depolarization

from a holding potential of 280 mV (110 mV increment

50 ms duration) Currents were measured with 10 mM Ba21

as charge carrier as well as 10 nM TTX in the bath solution

to inhibit superimposed sodium currents We found the

expression of Ca21 channels only after treatment with TGF-

b1 Depolarizing voltage pulse elicited fast activating inward

currents that showed little inactivation during the voltage

stimulus (Fig 6A) The currents which reached a steady state

within 5 ms got activated at potentials higher than 240 6

22 mV (n 5 7 Fig 6B) and reached a maximal current den-

sity of 124 6 19 pApF21 (n 5 7) at 110 mV The

voltage-dependent activation was calculated using the Boltz-

mann equation to fit the activation curve The Ba21-currents

were sensitive to dihydropyridine derivatives Application of

the enantiomer (1)BayK8644 (2 lM) a blocker of voltage-

dependent L-type Ca21 channels reduced the currents to

361 6 32 of the control values (peak current amplitude

n 5 7) These currents showed a voltage dependence

FIGURE 3 Voltage-gated sodium currents To measure currents through voltage-dependent Na1 channels whole-cell recordings wereperformed under extra- and intracellular K1-free conditions membrane voltage was clamped at a holding potential of 280 mV and thecells were depolarized to 10 mV in 10 mV steps in 50 ms followed by 210 mV steps to 2170 mV A Representative voltage-clamprecording of voltage-gated Na1 current (INa) from TGF-b1-treated cells using potassium-free solution B Fast inward currents could becompletely blocked by application of TTX (10 nM) C Normalized currentndashvoltage relationship of the peak INa shown in (A) and afteraddition of 10 nM TTX Addition of 10 nM tetrodotoxin (TTX) in the bath solution blocked INa completely INa displayed the characteris-tic IndashV relationship of voltage-gated sodium currents with a peak close to 210 mV and an activation threshold close to 250 mV D Dia-gram showing the effect of TGF-b1 treatment on the rise in sodium current density [INa] (P lt 0001)

1776 Volume 61 No 11

pharmacological and kinetic characteristics for L-type calcium

currents The properties of calcium channel currents in TGF-

b1-treated cells are summarized in Table 3

TGF-b1-treated cells show APs

We then determined whether the activity of voltage-activated

sodium conductance in TGF-b1-treated cells is strong enough

to allow the generation of APs Depolarizing current steps

(01ndash1 nA) were applied in the current-clamp mode Without

TGF-b1 treatment none of the progenitor cells (n 5 48)

fired APs in response to current injections In contrast 42

out of 50 tested cells with TGF-b1 treatment showed after 1

s of depolarization at least one AP that could be reversibly

blocked by TTX (10 nM Fig 7) The threshold for AP ini-

tiation was 2303 6 04 mV (n 5 15) to generate a TTX-

sensitive AP with a duration of 51 6 02 ms (n 5 15) and a

short after-hyperpolarization APs reached an amplitude of

4278 6 047 mV (n 5 15) The length of the after-

hyperpolarization was 219 6 11 ms with a maximal ampli-

tude of 139 6 05 mV (n 5 15) The properties of APs are

summarized in Table 4

TGF-b1-treated cells form synapses

To further study neuronal differentiation on the functional

level the expression of neurotransmitter receptor and the for-

mation of synapses was analyzed Whole-cell currents were

measured from TGF-b1-treated cells using K1 containing

control solutions and membrane conductance was monitored

by electrical stimulation from a holding potential of 270 mV

by 5 voltage steps of 50 ms duration and 20 mV increment

to depolarize the cells and five voltage steps of 50 ms dura-

tion and 220 mV increment to hyperpolarize the cells

Application of 1 mM GABA led to an increase in the mem-

brane conductance which resulted in an inwardly rectifying

conductance with a reversal potential of 261 6 02 mV (n5 3) close to the Nernst potential for K1 at our recording

conditions of 274 mV (Fig 8A) which is consistent with the

activation of a K1-conductance The TGF-b1-treated cells

FIGURE 4 Voltage-gated outward potassium currents Outward currents were evoked in response to membrane voltage steps from2130 mV to 140 mV at 10 mV intervals from a holding potential of 240 mV Data illustrate the classification of cells according to theirresponses to current steps and the corresponding IndashV plots Analysis of voltage-dependent activation steady-state current amplitudeswere plotted against the membrane potentials of the electrical stimulation Three major cell types were identified A Type I cells exhib-ited delayed rectifier potassium current only C Type II cells expressing only A-type potassium currents and Type III cells exhibited botha fast inactivating A-type potassium current and a noninactivating delayed rectifier potassium current E) Averaged IV-curves of eachtype are shown in (B D and F) G Data illustrate the relative contributions of the different potassium currents (stimulation 240 mV) inthe population of cells examined The percentage of cells expressing delayed rectifier potassium currents only (IK(DR)) increased signifi-cantly after TGF-b1 treatment In contrast the total outward current density (IK(DR1A)) remained relatively constant H Comparison ofthe maximal outward current density of cells measured under control conditions and after TGF-b1 treatment

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1777

showed in the presence of GABA an increase in the mem-

brane current at a holding potential of 2150 mV from

2176 6 47 pA (n 5 3) to 21080 6 142 pA (n 5 3 P 5

0004) Nontreated NPCs showed no changes in the mem-

brane conductance after application of GABA

As the TGF-b1-treated cells showed expression of

GABA receptors the possible formation of synapses was stud-

ied For this purpose long-time recordings of the holding

current at 270 mV were performed (Fig 8B) At higher

amplification current fluctuations were measured with ampli-

tudes of 32 6 27 pA (n 5 4) Application of 100 lM picro-

toxine led to a decrease in these current fluctuations to 119

6 11 pA (n 5 4 P 5 00005 Fig 8CD) In some cells

we observed a shift of the base-line currents toward 0 pA

Thus we cannot exclude that some of the cells showed tonic

receptor activation

Summary of TGF-b1 effects on NPCs

To give an overview on the TGF-b1-induced functional

effects the number of cells which show different aspects of

functional neuronal differentiation was compared between

TGF-b1 and control groups (Fig 9) Among the nontreated

cells there were no cells showing Na1 channel currents APs

or GABAergic currents In contrast to that the TGF-b1-

FIGURE 5 Inward rectifier potassium currents in TGF-b1-treated cells A Hyperpolarizing voltage steps from a holding potential of 280to 2170 mV (10 mV increment 50 ms duration) induced an inwardly rectifying current as shown here in a representative trace for TGF-b1-treated cell B Inward rectifier K1-component of the total current C Corresponding currentvoltage relationship of the current Thecurrents activate at potentials more negative than 270 mV D Frequency distribution of inwardly rectifying K1 currents expression incontrol cells and in cells after TGF-b1 treatment In control cells no inward inwardly rectifying current was detected in any of the cellsexamined In TGF-b1-treated cells 94 of the cells showed inwardly rectifying currents (n 5 35) In brief 63 of these showed a combi-nation with A-type and delayed rectifier K1-currents whereas only 30 with delayed rectifier currents

FIGURE 6 Voltage-gated Ca21 channel currents A Currentswere activated by voltage steps from 2170 mV to 110 mV for50 ms from a holding potential of 280 mV Experiments weredone under extra- and intracellular K1-free conditions in thepresence of 10 nM TTX in the bath solution to inhibit sodiumcurrents and with Ba21 as the charge carrier Normalized cur-rentndashvoltage relationships fitted with Boltzmann function areshown in (B) The kinetic properties of calcium channel currentsare summarized in Table 3

1778 Volume 61 No 11

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

pApF21 in TGF-b1-treated cells (n 5 35) than in control

cells (42 6 03 pApF21 n 5 43 P lt 00001) whereas the

maximal outward current density was with 2062 6 339

pApF21 in control cells nearly equal to that in TGF-b1-

treated cells (2189 6 171 pApF21 P 5 072 Fig 4H)

Moreover in TGF-b1-treated cells the stepwise hyper-

polarization from a holding potential of 280 to 2170 mV

(10 mV increment 50 ms duration) elicited an inwardly rec-

tifying current (n 5 35 Fig 5AB) activated at potentials

more negative than 270 mV (Fig 5C) and showing mild

inactivation at very low potentials In contrast no inward rec-

tifier current was detected in any of the cells without TGF-

b1 treatment (n 5 43) As shown in Fig 5D 30 of the

TGF-b1-treated cells showed a combination of inward recti-

fier currents with delayed rectifier potassium current only

whereas 63 of the cells showed a combination with A-type

and delayed-rectifier K1-currents

VOLTAGE-GATED Ca21 CHANNEL CURRENTS To inves-

tigate the expression of voltage-dependent Ca21 channels as

an additional neuronal marker whole-cell recordings were

performed under extra- and intracellular K1-free conditions

with cells from both experimental groups As a standard set-

ting the cells were stimulated by stepwise depolarization

from a holding potential of 280 mV (110 mV increment

50 ms duration) Currents were measured with 10 mM Ba21

as charge carrier as well as 10 nM TTX in the bath solution

to inhibit superimposed sodium currents We found the

expression of Ca21 channels only after treatment with TGF-

b1 Depolarizing voltage pulse elicited fast activating inward

currents that showed little inactivation during the voltage

stimulus (Fig 6A) The currents which reached a steady state

within 5 ms got activated at potentials higher than 240 6

22 mV (n 5 7 Fig 6B) and reached a maximal current den-

sity of 124 6 19 pApF21 (n 5 7) at 110 mV The

voltage-dependent activation was calculated using the Boltz-

mann equation to fit the activation curve The Ba21-currents

were sensitive to dihydropyridine derivatives Application of

the enantiomer (1)BayK8644 (2 lM) a blocker of voltage-

dependent L-type Ca21 channels reduced the currents to

361 6 32 of the control values (peak current amplitude

n 5 7) These currents showed a voltage dependence

FIGURE 3 Voltage-gated sodium currents To measure currents through voltage-dependent Na1 channels whole-cell recordings wereperformed under extra- and intracellular K1-free conditions membrane voltage was clamped at a holding potential of 280 mV and thecells were depolarized to 10 mV in 10 mV steps in 50 ms followed by 210 mV steps to 2170 mV A Representative voltage-clamprecording of voltage-gated Na1 current (INa) from TGF-b1-treated cells using potassium-free solution B Fast inward currents could becompletely blocked by application of TTX (10 nM) C Normalized currentndashvoltage relationship of the peak INa shown in (A) and afteraddition of 10 nM TTX Addition of 10 nM tetrodotoxin (TTX) in the bath solution blocked INa completely INa displayed the characteris-tic IndashV relationship of voltage-gated sodium currents with a peak close to 210 mV and an activation threshold close to 250 mV D Dia-gram showing the effect of TGF-b1 treatment on the rise in sodium current density [INa] (P lt 0001)

1776 Volume 61 No 11

pharmacological and kinetic characteristics for L-type calcium

currents The properties of calcium channel currents in TGF-

b1-treated cells are summarized in Table 3

TGF-b1-treated cells show APs

We then determined whether the activity of voltage-activated

sodium conductance in TGF-b1-treated cells is strong enough

to allow the generation of APs Depolarizing current steps

(01ndash1 nA) were applied in the current-clamp mode Without

TGF-b1 treatment none of the progenitor cells (n 5 48)

fired APs in response to current injections In contrast 42

out of 50 tested cells with TGF-b1 treatment showed after 1

s of depolarization at least one AP that could be reversibly

blocked by TTX (10 nM Fig 7) The threshold for AP ini-

tiation was 2303 6 04 mV (n 5 15) to generate a TTX-

sensitive AP with a duration of 51 6 02 ms (n 5 15) and a

short after-hyperpolarization APs reached an amplitude of

4278 6 047 mV (n 5 15) The length of the after-

hyperpolarization was 219 6 11 ms with a maximal ampli-

tude of 139 6 05 mV (n 5 15) The properties of APs are

summarized in Table 4

TGF-b1-treated cells form synapses

To further study neuronal differentiation on the functional

level the expression of neurotransmitter receptor and the for-

mation of synapses was analyzed Whole-cell currents were

measured from TGF-b1-treated cells using K1 containing

control solutions and membrane conductance was monitored

by electrical stimulation from a holding potential of 270 mV

by 5 voltage steps of 50 ms duration and 20 mV increment

to depolarize the cells and five voltage steps of 50 ms dura-

tion and 220 mV increment to hyperpolarize the cells

Application of 1 mM GABA led to an increase in the mem-

brane conductance which resulted in an inwardly rectifying

conductance with a reversal potential of 261 6 02 mV (n5 3) close to the Nernst potential for K1 at our recording

conditions of 274 mV (Fig 8A) which is consistent with the

activation of a K1-conductance The TGF-b1-treated cells

FIGURE 4 Voltage-gated outward potassium currents Outward currents were evoked in response to membrane voltage steps from2130 mV to 140 mV at 10 mV intervals from a holding potential of 240 mV Data illustrate the classification of cells according to theirresponses to current steps and the corresponding IndashV plots Analysis of voltage-dependent activation steady-state current amplitudeswere plotted against the membrane potentials of the electrical stimulation Three major cell types were identified A Type I cells exhib-ited delayed rectifier potassium current only C Type II cells expressing only A-type potassium currents and Type III cells exhibited botha fast inactivating A-type potassium current and a noninactivating delayed rectifier potassium current E) Averaged IV-curves of eachtype are shown in (B D and F) G Data illustrate the relative contributions of the different potassium currents (stimulation 240 mV) inthe population of cells examined The percentage of cells expressing delayed rectifier potassium currents only (IK(DR)) increased signifi-cantly after TGF-b1 treatment In contrast the total outward current density (IK(DR1A)) remained relatively constant H Comparison ofthe maximal outward current density of cells measured under control conditions and after TGF-b1 treatment

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1777

showed in the presence of GABA an increase in the mem-

brane current at a holding potential of 2150 mV from

2176 6 47 pA (n 5 3) to 21080 6 142 pA (n 5 3 P 5

0004) Nontreated NPCs showed no changes in the mem-

brane conductance after application of GABA

As the TGF-b1-treated cells showed expression of

GABA receptors the possible formation of synapses was stud-

ied For this purpose long-time recordings of the holding

current at 270 mV were performed (Fig 8B) At higher

amplification current fluctuations were measured with ampli-

tudes of 32 6 27 pA (n 5 4) Application of 100 lM picro-

toxine led to a decrease in these current fluctuations to 119

6 11 pA (n 5 4 P 5 00005 Fig 8CD) In some cells

we observed a shift of the base-line currents toward 0 pA

Thus we cannot exclude that some of the cells showed tonic

receptor activation

Summary of TGF-b1 effects on NPCs

To give an overview on the TGF-b1-induced functional

effects the number of cells which show different aspects of

functional neuronal differentiation was compared between

TGF-b1 and control groups (Fig 9) Among the nontreated

cells there were no cells showing Na1 channel currents APs

or GABAergic currents In contrast to that the TGF-b1-

FIGURE 5 Inward rectifier potassium currents in TGF-b1-treated cells A Hyperpolarizing voltage steps from a holding potential of 280to 2170 mV (10 mV increment 50 ms duration) induced an inwardly rectifying current as shown here in a representative trace for TGF-b1-treated cell B Inward rectifier K1-component of the total current C Corresponding currentvoltage relationship of the current Thecurrents activate at potentials more negative than 270 mV D Frequency distribution of inwardly rectifying K1 currents expression incontrol cells and in cells after TGF-b1 treatment In control cells no inward inwardly rectifying current was detected in any of the cellsexamined In TGF-b1-treated cells 94 of the cells showed inwardly rectifying currents (n 5 35) In brief 63 of these showed a combi-nation with A-type and delayed rectifier K1-currents whereas only 30 with delayed rectifier currents

FIGURE 6 Voltage-gated Ca21 channel currents A Currentswere activated by voltage steps from 2170 mV to 110 mV for50 ms from a holding potential of 280 mV Experiments weredone under extra- and intracellular K1-free conditions in thepresence of 10 nM TTX in the bath solution to inhibit sodiumcurrents and with Ba21 as the charge carrier Normalized cur-rentndashvoltage relationships fitted with Boltzmann function areshown in (B) The kinetic properties of calcium channel currentsare summarized in Table 3

1778 Volume 61 No 11

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

pharmacological and kinetic characteristics for L-type calcium

currents The properties of calcium channel currents in TGF-

b1-treated cells are summarized in Table 3

TGF-b1-treated cells show APs

We then determined whether the activity of voltage-activated

sodium conductance in TGF-b1-treated cells is strong enough

to allow the generation of APs Depolarizing current steps

(01ndash1 nA) were applied in the current-clamp mode Without

TGF-b1 treatment none of the progenitor cells (n 5 48)

fired APs in response to current injections In contrast 42

out of 50 tested cells with TGF-b1 treatment showed after 1

s of depolarization at least one AP that could be reversibly

blocked by TTX (10 nM Fig 7) The threshold for AP ini-

tiation was 2303 6 04 mV (n 5 15) to generate a TTX-

sensitive AP with a duration of 51 6 02 ms (n 5 15) and a

short after-hyperpolarization APs reached an amplitude of

4278 6 047 mV (n 5 15) The length of the after-

hyperpolarization was 219 6 11 ms with a maximal ampli-

tude of 139 6 05 mV (n 5 15) The properties of APs are

summarized in Table 4

TGF-b1-treated cells form synapses

To further study neuronal differentiation on the functional

level the expression of neurotransmitter receptor and the for-

mation of synapses was analyzed Whole-cell currents were

measured from TGF-b1-treated cells using K1 containing

control solutions and membrane conductance was monitored

by electrical stimulation from a holding potential of 270 mV

by 5 voltage steps of 50 ms duration and 20 mV increment

to depolarize the cells and five voltage steps of 50 ms dura-

tion and 220 mV increment to hyperpolarize the cells

Application of 1 mM GABA led to an increase in the mem-

brane conductance which resulted in an inwardly rectifying

conductance with a reversal potential of 261 6 02 mV (n5 3) close to the Nernst potential for K1 at our recording

conditions of 274 mV (Fig 8A) which is consistent with the

activation of a K1-conductance The TGF-b1-treated cells

FIGURE 4 Voltage-gated outward potassium currents Outward currents were evoked in response to membrane voltage steps from2130 mV to 140 mV at 10 mV intervals from a holding potential of 240 mV Data illustrate the classification of cells according to theirresponses to current steps and the corresponding IndashV plots Analysis of voltage-dependent activation steady-state current amplitudeswere plotted against the membrane potentials of the electrical stimulation Three major cell types were identified A Type I cells exhib-ited delayed rectifier potassium current only C Type II cells expressing only A-type potassium currents and Type III cells exhibited botha fast inactivating A-type potassium current and a noninactivating delayed rectifier potassium current E) Averaged IV-curves of eachtype are shown in (B D and F) G Data illustrate the relative contributions of the different potassium currents (stimulation 240 mV) inthe population of cells examined The percentage of cells expressing delayed rectifier potassium currents only (IK(DR)) increased signifi-cantly after TGF-b1 treatment In contrast the total outward current density (IK(DR1A)) remained relatively constant H Comparison ofthe maximal outward current density of cells measured under control conditions and after TGF-b1 treatment

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1777

showed in the presence of GABA an increase in the mem-

brane current at a holding potential of 2150 mV from

2176 6 47 pA (n 5 3) to 21080 6 142 pA (n 5 3 P 5

0004) Nontreated NPCs showed no changes in the mem-

brane conductance after application of GABA

As the TGF-b1-treated cells showed expression of

GABA receptors the possible formation of synapses was stud-

ied For this purpose long-time recordings of the holding

current at 270 mV were performed (Fig 8B) At higher

amplification current fluctuations were measured with ampli-

tudes of 32 6 27 pA (n 5 4) Application of 100 lM picro-

toxine led to a decrease in these current fluctuations to 119

6 11 pA (n 5 4 P 5 00005 Fig 8CD) In some cells

we observed a shift of the base-line currents toward 0 pA

Thus we cannot exclude that some of the cells showed tonic

receptor activation

Summary of TGF-b1 effects on NPCs

To give an overview on the TGF-b1-induced functional

effects the number of cells which show different aspects of

functional neuronal differentiation was compared between

TGF-b1 and control groups (Fig 9) Among the nontreated

cells there were no cells showing Na1 channel currents APs

or GABAergic currents In contrast to that the TGF-b1-

FIGURE 5 Inward rectifier potassium currents in TGF-b1-treated cells A Hyperpolarizing voltage steps from a holding potential of 280to 2170 mV (10 mV increment 50 ms duration) induced an inwardly rectifying current as shown here in a representative trace for TGF-b1-treated cell B Inward rectifier K1-component of the total current C Corresponding currentvoltage relationship of the current Thecurrents activate at potentials more negative than 270 mV D Frequency distribution of inwardly rectifying K1 currents expression incontrol cells and in cells after TGF-b1 treatment In control cells no inward inwardly rectifying current was detected in any of the cellsexamined In TGF-b1-treated cells 94 of the cells showed inwardly rectifying currents (n 5 35) In brief 63 of these showed a combi-nation with A-type and delayed rectifier K1-currents whereas only 30 with delayed rectifier currents

FIGURE 6 Voltage-gated Ca21 channel currents A Currentswere activated by voltage steps from 2170 mV to 110 mV for50 ms from a holding potential of 280 mV Experiments weredone under extra- and intracellular K1-free conditions in thepresence of 10 nM TTX in the bath solution to inhibit sodiumcurrents and with Ba21 as the charge carrier Normalized cur-rentndashvoltage relationships fitted with Boltzmann function areshown in (B) The kinetic properties of calcium channel currentsare summarized in Table 3

1778 Volume 61 No 11

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

showed in the presence of GABA an increase in the mem-

brane current at a holding potential of 2150 mV from

2176 6 47 pA (n 5 3) to 21080 6 142 pA (n 5 3 P 5

0004) Nontreated NPCs showed no changes in the mem-

brane conductance after application of GABA

As the TGF-b1-treated cells showed expression of

GABA receptors the possible formation of synapses was stud-

ied For this purpose long-time recordings of the holding

current at 270 mV were performed (Fig 8B) At higher

amplification current fluctuations were measured with ampli-

tudes of 32 6 27 pA (n 5 4) Application of 100 lM picro-

toxine led to a decrease in these current fluctuations to 119

6 11 pA (n 5 4 P 5 00005 Fig 8CD) In some cells

we observed a shift of the base-line currents toward 0 pA

Thus we cannot exclude that some of the cells showed tonic

receptor activation

Summary of TGF-b1 effects on NPCs

To give an overview on the TGF-b1-induced functional

effects the number of cells which show different aspects of

functional neuronal differentiation was compared between

TGF-b1 and control groups (Fig 9) Among the nontreated

cells there were no cells showing Na1 channel currents APs

or GABAergic currents In contrast to that the TGF-b1-

FIGURE 5 Inward rectifier potassium currents in TGF-b1-treated cells A Hyperpolarizing voltage steps from a holding potential of 280to 2170 mV (10 mV increment 50 ms duration) induced an inwardly rectifying current as shown here in a representative trace for TGF-b1-treated cell B Inward rectifier K1-component of the total current C Corresponding currentvoltage relationship of the current Thecurrents activate at potentials more negative than 270 mV D Frequency distribution of inwardly rectifying K1 currents expression incontrol cells and in cells after TGF-b1 treatment In control cells no inward inwardly rectifying current was detected in any of the cellsexamined In TGF-b1-treated cells 94 of the cells showed inwardly rectifying currents (n 5 35) In brief 63 of these showed a combi-nation with A-type and delayed rectifier K1-currents whereas only 30 with delayed rectifier currents

FIGURE 6 Voltage-gated Ca21 channel currents A Currentswere activated by voltage steps from 2170 mV to 110 mV for50 ms from a holding potential of 280 mV Experiments weredone under extra- and intracellular K1-free conditions in thepresence of 10 nM TTX in the bath solution to inhibit sodiumcurrents and with Ba21 as the charge carrier Normalized cur-rentndashvoltage relationships fitted with Boltzmann function areshown in (B) The kinetic properties of calcium channel currentsare summarized in Table 3

1778 Volume 61 No 11

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

treated cells were characterized by 100 Na1 channel cur-

rents 84 APs and 70 GABAergic currents

Discussion

Here we show that TGF-b1 in the presence of EGF and

bFGF primes adult NPCs toward a functional neuronal phe-

notype as demonstrated by the ability of TGF-b1-treated

cells to generate APs We observed that upon TGF-b1 appli-

cation adult NPCs developed short neuronal processes and

upregulated the expression of the neuronal marker DCX at

the mRNA as well as at the protein level Furthermore a

gene chip array revealed the increased expression of several

genes with functional relevance for neurons after TGF-b1

treatment These genes belong to the families of voltage-

dependent ion channels neurotransmitter receptors or synap-

tic proteins As there was no endogenous TGF-b1 secretion

detectable the upregulation of DCX expression was only

owing to TGF-b1 application Thus the treatment of NPCs

with TGF-b1 drives these cells into a neuronal phenotype To

demonstrate the corresponding functional neuronal pheno-

type the activities of voltage-dependent ion channels were

further investigated for these cells

TGF-b1 Promotes Electrophysiological Functionalityin NPCsNPCs from vehicle-treated neurospheres showed expression of

some voltage-dependent ion channels which are known to be

expressed in neurons and which are essential for excitability

in neurons Control cells showed voltage-dependent out-

wardly rectifying currents which disappear under extracellular

and intracellular K1-free conditions thereby demonstrating

that these are mediated through voltage-dependent K1-chan-

nels within the cell membrane Two K1-channel types were

detected in this study One is a delayed rectifier type with

slow activation no inactivation and an activation threshold at

230 mV and the other one is a fast activating and inactivat-

ing outwardly rectifying current with activation threshold

ranging between 240 and 230 mV With these properties

we conclude that outwardly rectifying delayed-rectifier K1

and fast inactivating outwardly rectifying (A-type) K1-chan-

nels are expressed Some cells expressed both types of K1-

channels whereas other cells expressed only one of these K1-

channel types The expression of these ion channels might

reflect neuronal differentiation However their expression was

also reported for embryonic stem cells (Biella et al 2007)

and rather reflects the ability of neurospheres to develop into

different cell types including neuronal cells

When NPCs were treated with TGF-b1 cells expressed

a different pattern of ion channels This resulted in a more

negative resting potential with 265 mV in TGF-b1-treated

cells compared with that in control-treated cells with 2505

mV The lower resting potential resulted from a different pat-

tern of K1-channel expression in TGF-b1-treated cells These

cells showed both outwardly rectifying and inward-rectifying

currents which disappear in the absence of intra- and extracel-

lular K1 The lower resting potential following TGF-b1 treat-

ment resulted from the expression of inward-rectifier K1-

channels which is absent in control cells In addition the

two major types of outwardly rectifying K1-currents (the

delayed-rectifier and the A-current) were observed in TGF-b1

NPCs

Comparison of K1-channel properties of vehicle- or

TGF-b1-treated cells revealed a TGF-b1-specific pattern

Although no difference between TGF-b1-treated and control

cells in the current density of outwardly rectifying currents

could be detected the distribution of the different K1-chan-

nel types was changed upon TGF-b1 treatment The majority

of vehicle-treated cells showed concomitant delayed-rectifier

and A-currents whereas only a small fraction of cells pos-

sessed either the delayed-rectifier or the A-currents alone

TABLE 3 Kinetic Properties of Calcium Channel Currents of TGF-b1-Treated NPCs

V05 (mV) kact (mV) Activation Threshold (mV) Current Density (pApF21)

1TGF-b1 31 6 13 263 6 07 240 6 22 124 6 19

n 5 7 n 5 7 n 5 7 n 5 7

Control ndash ndash ndash ndash

FIGURE 7 APs in cells after TGF-b1 treatment A representativerecording of an AP is shown in (A) and an enlargement in (B)TGF-b1-treated cells are able to react with generation of actionpotentials in response to depolarization APs were elicited bydepolarizing current injection of 1 nA for 1 s and recorded in thecurrent-clamp mode C AP suppression by TTX (10 nM) Theproperties of APs are summarized in Table 4

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1779

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

However cells treated with TGF-b1 showed a strong increase

of the fraction exhibiting only delayed-rectifier currents and a

strong reduction in the number of cells in which only A-

currents could be detected Thus TGF-b1 specifically modu-

lates ion channel expression in NPCs toward a more func-

tional neuronal phenotype

This conclusion is further substantiated by the study of

additional ion channels after TGF-b1 treatment For example

only cells treated with TGF-b1 showed voltage-dependent

Ba21 currents under K1-free conditions in the presence of

TTX These currents showed no inactivation were active at

rather positive voltages (between 240 and 120 mV) and

were sensitive to the dihydropyridine derivative BayK8644

an L-Type Ca21 channel blocker Thus only TGF-b1-treated

cells showed the expression of voltage-dependent L-type Ca21

channels As the Ca21 channel currents were blocked by

(1)BayK8644 by 74 it seems that this Ca21 channel sub-

type represents the majority of voltage-dependent Ca21-chan-

nel subtypes expressed in these cells The remaining Ba21

currents in the presence of BayK8644 were not further ana-

lyzed However based on their voltage dependence and

kinetics the BayK8644-resistant currents are likely currents of

the N- or PQ-subtype This subtype is known to trigger

neurotransmitter release at synapses Furthermore the activa-

tion of fast activating and inactivating currents was stimulated

by depolarization to voltages higher than 240 mV These

currents were blocked by 10 nM of TTX and could therefore

be identified as voltage-dependent neuronal Na1 channels

The Na1 channel currents were only observed upon TGF-b1

treatment and their current density increased with treatment

time Thus TGF-b1 treatment was very potent to differenti-

ate NPCs into functional neuronal cells

The functional neuronal nature of the TGF-b1-treated

cells was further demonstrated through the generation of APs

Membrane potentials were measured in the current-clamp

modus and APs were elicited by depolarizing current injec-

tions to generate potentials higher than 230 mV Only the

TGF-b1-treated cells had the capacity to trigger APs Further-

more the generation of APs was blocked by TTX indicating

that these APs were Na1-channel driven

At the level of ion channel expression the TGF-b1-

treated cells showed advanced functional neuronal differentia-

tion This picture could be completed by the observation that

the TGF-b1-treated cells were GABAergic cells The cells

responded to the GABA-stimulation by an increase in the

membrane conductance The reversal potential of the GABA-

induced currents indicated that these currents are K1-cur-

rents This is consistent with the potential expression of

GABA-B receptors A further analysis revealed that the TGF-

b1-treated NPCs showed spontaneous synaptic currents that

could be blocked by the GABA-A receptor antagonist picro-

toxine As some cells showed a shift in the current base-line

to 0 pA it might be possible that these cells show tonic

GABA receptor activity and do not necessarily form synapses

Summarizing observations from experiments using GABA

application we conclude that these cells not only express

GABA-A and GABA-B receptors but some of them form also

functional synapses

To our knowledge this study constitutes the first

report that TGF-b1 alone is able to promote the differentia-

tion of neurosphere-cultivated precursor cells into a func-

tional neuronal phenotype TGF-b1 leads to the de novo

expression of neuronal Na1 channels voltage-dependent

Ca21 channels and inward-rectifier K1-channels as well as

the ability to generate APs Under the influence of TGF-b1

the cells do not only show functional GABA-A receptors

but also GABAergic synapses Interestingly gene chip array

analysis showed mainly the upregulation of ion channel

genes and genes of synaptic proteins (Cadps Snap25 Grik4

Gria3 Syngr3 and Gria4) but no changes in the expression

of GABA receptors Furthermore NPCs showed extensions

of short neuronal-like processes under the influence of TGF-

b1 Thus TGF-b1 seems not only to act at the transcrip-

tional level but also at the regulation of structural properties

Nevertheless these cells cannot be regarded as fully mature

neurons yet owing to the high activation thresholds of

voltage-dependent ion channels and for triggering of APs as

well as the rather immature appearance of APs and the

inability of repetitive firing So far neuronal differentiation

of NPCs was shown in astrocyte coculture models NPCs

TABLE 4 Kinetic Properties of Action Potentials After TGF-b1 Treatment

ActionPotentialThreshold (mV)

ActionPotentialDuration (ms)

ActionPotentialAmplitude (mV)

ActionPotential After-hyperpolarization (mV)

After-hyperpolarizationDuration (ms)

1TGF-b1 23032 6 044 513 6 022 4278 6 074 1386 6 046 2186 6 107

n 5 15 n 5 15 n 5 15 n 5 15 n 5 15

Control ndash ndash ndash ndash ndash

1780 Volume 61 No 11

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

from these coculture models showed spontaneous activity

network formation and the ability to generate strains of APs

(Jelitai et al 2007 Johnson et al 2007 Song et al 2002

Westerlund et al 2003) Nevertheless in contrast to the

majority of NPC differentiation protocols we report here

that treatment with TGF-b1 results in a robust expression

of voltage-dependent ion channels and in the stable ability

to generate APs Thus TGF-b1 treatment appears to be a

powerful approach to prime NPCs toward a functional neu-

ronal phenotype

The Divergent Effects of TGF-b1 in the Neural StemCellNeurogenic NicheThe effects of TGF-b1 on neural stem cellneurogenic niche

are at the first glance quite opposing In rodent neurosphere

cultures after intracerebroventricular infusion in rats or upon

overexpression in transgenic mice TGF-b1 inhibits neural

progenitor proliferation and the production of new neurons

and it promotes neural stem cell quiescence (Buckwalter

et al 2006 Kandasamy et al 2010 Wachs et al 2006) In

contrast intranasal delivery of TGF-b1 was shown to increase

FIGURE 8 GABAergic and synaptic currents in TGF-b1-treated cells A Current densityvoltage plot of currents before (filled circles) andafter (open circles) the application of 1 mM GABA which results in an increase of the membrane conductance (n 5 3) A recording of aGABA-induced current elicited by a voltage step from 280 to 2140 mV for 20 ms is given in the left panel B Representative exampleof spontaneous synaptic currents (SSC) recordable in long-time recordings at a holding potential of 270 mV The upper panel shows anenlargement of the current fluctuations C Representative example of SSC duringafter application of 01 mM picrotoxine Fluctuationamplitudes were decreased D Comparison of the current fluctuations of SSC before and after application of 01 mM picrotoxine Thefluctuation amplitudes were significantly decreased by picrotoxine (P 5 00005)

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1781

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

neurogenesis in mice after stroke (Ma et al 2008) Also

adrenalectomy-associated increases in neurogenesis are par-

tially mediated through elevated levels of TGF-b1 (Battista

et al 2006) Moreover adenoviral overexpression of TGF-b1

leads to a stimulation of neurogenesis (Mathieu et al 2010)

At present we can only speculate on reasons for these

discrepancies but a unifying hypothesis could be that TGF-b1

might have differential effects depending on the actual cellular

identity and cellrsquos ontogenic stage along the developmental pro-

gram from a quiescent to a proliferating progenitor and further

to a differentiating precursor and finally to a mature neuron

Depending on the level of neuronal determination TGF-b1

might induce andor maintain a cell-cycle exit and promote

the neuronal differentiation program Alternatively TGF-b1

might also induce a cell-cycle exit in proliferating neural pro-

genitors and promote stem cell quiescence and stem cell main-

tenance Both pathways have a cell-cycle exit as common

denominator but depending on the context TGF-b1 might

drive proliferating progenitors toward a quiescent neuron or

toward a quiescent stem cell In support of the latter it has

been demonstrated that TGF-b1 induces a premature transfor-

mation of radial glia cells toward astrocytes the putative stem

cells in the adult brain (Stipursky and Gomes 2007) More-

over in the hematopoietic system it is well established that

TGF-b1 regulates quiescence maintenance proliferation and

differentiation of hematopoietic stem cells in a context-

dependent manner (Ruscetti et al 2005)

The role of TGF-b1 in neuronal differentiation is well

documented For example it supports neurite outgrowth in

hippocampal neurons in vitro (Ishihara et al 1994) increases

the expression of neuronal differentiation markers in mouse

cortical and hippocampal progenitors (Vogel et al 2010)

and promotes dopaminergic differentiation of mesencephalic

progenitors (Roussa et al 2006) In contrast to this fact

using different culture conditions to those described in this

report we did not observe a TGF-b1-induced neuronal dif-

ferentiation effect in adult NPCs in vitro in our previous

study (Wachs et al 2006) Such a proneuronal differentiation

effect might have been however masked by a strong astro-

glial inducing activity mediated by the presence of serum dur-

ing the differentiation protocol (Steffenhagen et al 2011) In

summary there is still controversy in the role of TGF-b1 in

regulating stem and progenitor activity in the neurogenic

niche Nevertheless the present data on the TGF-b1-induced

functional priming effect on NPCs under PCs might be an

important and harmonizing piece of information

Priming of NPCs Toward Neuronal Functionality AFuture Concept for Successful TransplantationTypically neuronal differentiation of transplanted NPCs in the

CNS is if at all relatively sparse (Shetty et al 2008 Shihabud-

din et al 2000 Vroemen et al 2003) Recently priming of pro-

liferating NPCs by lithium chloride was shown to reduce glial

differentiation and enhance neuronal differentiation of grafted

NPCs in a quinolinic acid-lesioned rat striatum Moreover this

treatment was much more effective in promoting functional

recovery of animals compared with the use of nonprimed NPCs

(Vazey and Connor 2009) Therefore priming of NPCs toward

neuronal functionality might be an interesting concept to follow

in the context of cell therapies and based on the present data

TGF-b1 might be a highly interesting candidate

Acknowledgment

Grant sponsors The Bavarian Elite Network the Bavarian

State Ministry of Sciences Research and Arts (ForNeuro-

Cell2) the German Federal Ministry of Education and

Research (BMBF 01GN0978) The State Government of

Salzburg (Austria) The Propter Homines Foundation The

FWF Special Research Program (SFB) F44 Cell Signaling in

Chronic CNS Disorders

The authors thank Elfriede Eckert Renate Foeckler and

Andrea Dannullis for expert technical assistance and Dietrich

Treuroumbach (Helmholz Zentrum Muenchen) for his support in

microarray statistical analyses Authors are grateful to the fruit-

ful comments from Dr Markus Ritter and Dr Martin Jakab

References

Aguirre A Rubio ME Gallo V 2010 Notch and EGFR pathway interactionregulates neural stem cell number and self-renewal Nature 467323ndash327

Aigner L Bogdahn U 2008 TGF-beta in neural stem cells and in tumors ofthe central nervous system Cell Tissue Res 331225ndash241

FIGURE 9 Event histograms to compare the occurrence of neu-ronal functional properties in untreated and TGF-b1-stimulatedNPCs A The percentage of cells exhibiting voltage-gated Na1current (INA) highly significantly increased from 0 (n 5 48) upto 100 (n 5 39) In total 82 of the cells gained the ability togenerate action potentials (n 5 50) The application of 1 mMGABA elicited GABAergic currents in 70 of the cells after TGF-b1 treatment (n 5 20) In contrast without TGF-b1 treatmentnone of the cells showed properties of functional neurons

1782 Volume 61 No 11

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l

Babu H Claasen JH Kannan S Runker AE Palmer T Kempermann G 2011A protocol for isolation and enriched monolayer cultivation of neural precur-sor cells from mouse dentate gyrus Front Neurosci 589

Battista D Ferrari CC Gage FH Pitossi FJ 2006 Neurogenic niche modula-tion by activated microglia Transforming growth factor beta increases neuro-genesis in the adult dentate gyrus Eur J Neurosci 2383ndash93

Biella G Di Febo F Goffredo D Moiana A Taglietti V Conti L Cattaneo EToselli M 2007 Differentiating embryonic stem-derived neural stem cellsshow a maturation-dependent pattern of voltage-gated sodium currentexpression and graded action potentials Neuroscience 14938ndash52

Brown JP Couillard-Despres S Cooper-Kuhn CM Winkler J Aigner L KuhnHG 2003 Transient expression of doublecortin during adult neurogenesis JComp Neurol 4671ndash10

Buckwalter MS Yamane M Coleman BS Ormerod BK Chin JT Palmer T Wyss-Coray T 2006 Chronically increased transforming growth factor-beta1 stronglyinhibits hippocampal neurogenesis in aged mice Am J Pathol 169154ndash164

Caraci F Battaglia G Bruno V Bosco P Carbonaro V Giuffrida ML Drago FSortino MA Nicoletti F Copani A 2011 TGF-beta1 pathway as a new targetfor neuroprotection in Alzheimerrsquos disease CNS Neurosci Ther 17237ndash249

Costa MR Ortega F Brill MS Beckervordersandforth R Petrone CSchroeder T Gotz M Berninger B 2011 Continuous live imaging of adultneural stem cell division and lineage progression in vitro Development 1381057ndash1068

Dhandapani KM Brann DW 2003 Transforming growth factor-beta A neuro-protective factor in cerebral ischemia Cell Biochem Biophys 3913ndash22

Henrich-Noack P Prehn JH Krieglstein J 1996 TGF-beta 1 protects hippo-campal neurons against degeneration caused by transient global ischemiaDose-response relationship and potential neuroprotective mechanismsStroke 271609ndash1614 discussion 1615

Hsieh J Gage FH 2004 Epigenetic control of neural stem cell fate CurrOpin Genet Dev 14461ndash469

Ishihara A Saito H Abe K 1994 Transforming growth factor-beta 1 and -beta 2 promote neurite sprouting and elongation of cultured rat hippocam-pal neurons Brain Res 63921ndash25

Ito H Nakajima A Nomoto H Furukawa S 2003 Neurotrophins facilitateneuronal differentiation of cultured neural stem cells via induction of mRNAexpression of basic helix-loop-helix transcription factors Mash1 and Math1 JNeurosci Res 71648ndash658

Jelitai M Anderova M Chvatal A Madarasz E 2007 Electrophysiologicalcharacterization of neural stemprogenitor cells during in vitro differentiationStudy with an immortalized neuroectodermal cell line J Neurosci Res 851606ndash1617

Johnson MA Weick JP Pearce RA Zhang SC 2007 Functional neural devel-opment from human embryonic stem cells Accelerated synaptic activity viaastrocyte coculture J Neurosci 273069ndash3077

Kandasamy M Couillard-Despres S Raber KA Stephan M Lehner B WinnerB Kohl Z Rivera FJ Nguyen HP Riess O Bogdahn U Winkler J vonHeuroorsten S Aigner L 2010 Stem cell quiescence in the hippocampal neuro-genic niche is associated with elevated transforming growth factor-beta sig-naling in an animal model of Huntington disease J Neuropathol Exp Neurol69717ndash728

Ma M Ma Y Yi X Guo R Zhu W Fan X Xu G Frey WH 2nd Liu X 2008Intranasal delivery of transforming growth factor-beta1 in mice after strokereduces infarct volume and increases neurogenesis in the subventricularzone BMC Neurosci 9117

Mathieu P Piantanida AP Pitossi F 2010 Chronic expression of transforminggrowth factor-beta enhances adult neurogenesis Neuroimmunomodulation17200ndash201

Prehn JH Peruche B Unsicker K Krieglstein J 1993 Isoform-specific effects oftransforming growth factors-beta on degeneration of primary neuronal culturesinduced by cytotoxic hypoxia or glutamate J Neurochem 601665ndash1672

Reynolds BA Tetzlaff W Weiss S 1992 A multipotent EGF-responsive stria-tal embryonic progenitor cell produces neurons and astrocytes J Neurosci124565ndash4574

Roussa E Wiehle M Dunker N Becker-Katins S Oehlke O Krieglstein K2006 Transforming growth factor beta is required for differentiation ofmouse mesencephalic progenitors into dopaminergic neurons in vitro and invivo Ectopic induction in dorsal mesencephalon Stem Cells 242120ndash2129

Ruscetti FW Akel S Bartelmez SH 2005 Autocrine transforming growthfactor-beta regulation of hematopoiesis Many outcomes that depend on thecontext Oncogene 245751ndash5763

Shetty AK Rao MS Hattiangady B 2008 Behavior of hippocampal stempro-genitor cells following grafting into the injured aged hippocampus J Neuro-sci Res 863062ndash3074

Shihabuddin LS Horner PJ Ray J Gage FH 2000 Adult spinal cord stemcells generate neurons after transplantation in the adult dentate gyrus JNeurosci 208727ndash8735

Song HJ Stevens CF Gage FH 2002 Neural stem cells from adult hippo-campus develop essential properties of functional CNS neurons Nat Neuro-sci 5438ndash445

Steffenhagen C Kraus S Dechant FX Kandasamy M Lehner B Poehler AMFurtner T Siebzehnrubl FA Couillard-Despres S Strauss O Aigner L RiveraFJ 2011 Identity fate and potential of cells grown as neurospheres Speciesmatters Stem Cell Rev 7815ndash835

Stipursky J Gomes FC 2007 TGF-beta1SMAD signaling induces astrocyte fatecommitment in vitro Implications for radial glia development Glia 551023ndash1033

Takahashi J Palmer TD Gage FH 1999 Retinoic acid and neurotrophins col-laborate to regulate neurogenesis in adult-derived neural stem cell cultures JNeurobiol 3865ndash81

Ueberham U Ueberham E Gruschka H Arendt T 2006 Altered subcellularlocation of phosphorylated Smads in Alzheimerrsquos disease Eur J Neurosci 242327ndash2334

Unsicker K Krieglstein K 2002 TGF-betas and their roles in the regulation ofneuron survival Adv Exp Med Biol 513353ndash374

Vazey EM Connor B 2009 In vitro priming to direct neuronal fate in adultneural progenitor cells Exp Neurol 216520ndash524

Vogel T Ahrens S Buttner N Krieglstein K 2010 Transforming growth factorbeta promotes neuronal cell fate of mouse cortical and hippocampal progen-itors in vitro and in vivo Identification of Nedd9 as an essential signalingcomponent Cereb Cortex 20661ndash671

Vroemen M Aigner L Winkler J Weidner N 2003 Adult neural progenitorcell grafts survive after acute spinal cord injury and integrate along axonalpathways Eur J Neurosci 18743ndash751

Wachs FP Couillard-Despres S Engelhardt M Wilhelm D Ploetz S VroemenM Kaesbauer J Uyanik G Klucken J Karl C Tebbing J Svendsen CWeidner N Kuhn HG Winkler J Aigner L 2003 High efficacy of clonalgrowth and expansion of adult neural stem cells Lab Invest 83949ndash962

Wachs FP Winner B Couillard-Despres S Schiller T Aigner R Winkler JBogdahn U Aigner L 2006 Transforming growth factor-beta1 is a negativemodulator of adult neurogenesis J Neuropathol Exp Neurol 65358ndash370

Westerlund U Moe MC Varghese M Berg-Johnsen J Ohlsson MLangmoen IA Svensson M 2003 Stem cells from the adult human braindevelop into functional neurons in culture Exp Cell Res 289378ndash383

Wyss-Coray T 2006 Tgf-Beta pathway as a potential target in neurodegener-ation and Alzheimerrsquos Curr Alzheimer Res 3191ndash195

Zhu Y Culmsee C Klumpp S Krieglstein J 2004 Neuroprotection by trans-forming growth factor-beta1 involves activation of nuclear factor-kappaBthrough phosphatidylinositol-3-OH kinaseAkt and mitogen-activated proteinkinase-extracellular-signal regulated kinase12 signaling pathways Neuro-science 123897ndash906

Zhu X Jin S Ng YK Lee WL Wong PT 2001 Positive and negative modula-tion by AMPA- and kainate-receptors of striatal kainate injection-induced neu-ronal loss in rat forebrain Brain Res 922293ndash298

Kraus et al TGF-b1 Primes Neuronal Functionality of NCP

November 2013 1783

• l