ORIGINAL PAPER

Synthetic lethality of PARP inhibition in BRCA-networkdisrupted tumor cells is associated with interferon pathwayactivation and enhanced by interferon-c

Paul Warrener • Sammy Kim • Sybil M. G. Williams •

Matthew Biery • Marcia Gordon • Carlo Toniatti •

Michele A. Cleary • Peter S. Linsley • Michael Carleton

Published online: 6 March 2012

� Springer Science+Business Media, LLC 2012

Abstract Tumor suppressor genes BRCA1 and BRCA2

function in a complex gene network that regulates

homologous recombination and DNA double-strand break

repair. Disruption of the BRCA-network through gene

mutation, deletion, or RNAi-mediated silencing can sen-

sitize cells to small molecule inhibitors of poly (ADP-

ribose) polymerase (PARPi). Here, we demonstrate that

BRCA-network disruption in the presence of PARPi leads

to the selective induction and enhancement of interferon

pathway and apoptotic gene expression in cultured tumor

cells. In addition, we report PARPi cytotoxicity in BRCA1-

deficient tumor cells is enhanced[10-fold when combined

with interferon-c. These findings establish a link between

synthetic lethality of PARPi in BRCA-network disrupted

cells and interferon pathway activation triggered by genetic

instability.

Keywords PARP inhibition � BRCA1 � Synthetic

lethality � Apoptosis � Interferon response

Introduction

The search for targeted cancer therapies has benefited

from approaches that permit genome-scale assessment of

tumor context. A targeted therapy that has generated

significant interest is the selective cytotoxicity of poly

(ADP ribose) polymerase (PARP) inhibition in tumor

cells with a deficit in homologous recombination (HR)

resulting from mutation, deletion or RNAi-mediated

silencing of BRCA-network genes [1–3]. PARPs consti-

tute a multi-gene family of enzymes catalyzing the

polymerization and attachment of ADP-ribose units from

NAD? onto specific amino acid residues of selected

protein substrates [4]. PARP-1 and PARP-2 are DNA

repair proteins whose catalytic activity is stimulated by

DNA damage and required for repair of DNA single-

strand breaks (SSBs) by way of base excision repair [5].

Inhibition of PARP activity causes an accumulation in

SSBs resulting in stalled replication forks, and generation

of DNA double-strand breaks (DSBs) at the site of the

original DNA lesion [2]. Tumor suppressor genes BRCA1

and BRCA2 function within a multi-protein network that,

in response to DSBs, plays a role in activating DNA

damage responses, cell cycle checkpoints, and DSB repair

[6]. SHFM1 (also referred to as DSS1) is a member of the

BRCA-network, and its interaction with BRCA2 is

required for recruitment of RAD51 to DNA damage foci

[7, 8]. Cells harboring a functional BRCA-network can

repair DSBs formed in response to PARP inhibition

through HR in a RAD51-dependent manner [9]. However,

PARP inhibition in the context of HR deficiency caused

by BRCA-network disruption is synthetically lethal. This

synthetic lethal phenotype results in part from replication

fork collapse, accumulation of DSBs, cell cycle arrest [1,

2] and aberrant activation of nonhomologous end joining

Electronic supplementary material The online version of thisarticle (doi:10.1007/s10495-012-0707-4) contains supplementarymaterial, which is available to authorized users.

P. Warrener � S. Kim � M. Biery � M. Gordon �P. S. Linsley � M. Carleton (&)

Rosetta Inpharmatics LLC, A Wholly Owned Subsidiary

of Merck & Co., Inc, Seattle, WA 98109, USA

e-mail: mcarleton@targetedgrowth.com

S. M. G. Williams � C. Toniatti

Merck Research Laboratories, Boston, MA 02115, USA

M. A. Cleary

Merck & Co., Inc, West Point, PA 19486, USA

123

Apoptosis (2012) 17:691–701

DOI 10.1007/s10495-012-0707-4

(NHEJ), an error-prone means of DNA repair that drives

greater genomic instability [10].

A small molecule PARP inhibitor (PARPi) has been

used in the clinic for treatment of BRCA1 and BRCA2

mutant ovarian and breast cancer patients [11]. As BRCA

mutations are rare (*5 to 10% of all breast and ovarian

cancers are hereditary with a majority attributable to germ-

line mutations in either BRCA1 or BRCA2 [12]), there

exists a growing effort to precisely define the molecular

basis of PARPi cytotoxicity in the context of HR defi-

ciency. Notably, the application of the PARPi iniparib to

triple negative breast cancer, hypothesized to contain

tumors exhibiting a ‘‘BRCAness’’ phenotype [13, 14], has

yielded mixed clinical results [15, 16] underscoring ques-

tions around the exact mechanism of action for this com-

pound. Despite the emerging importance of PARPi as

therapeutic agents, the mechanism(s) by which they kill

tumor cells remains poorly understood. Moreover, emerg-

ing PARPi clinical data suggest that expansion of PARPi

responder populations will require a more precise under-

standing of the molecular context that sensitizes HR-defi-

cient tumors to PARPi.

To elucidate PARPi-dependent transcriptional changes

triggered specifically in HR-deficient tumor cells, we

employed lentiviral vector-directed expression of tetracy-

cline-inducible shRNAs to disrupt BRCA-network function

in HT-29 and HeLa cells [17]. We report here that shRNA-

mediated BRCA-network disruption can modify a cells

PARPi phenotype from one of resistance to sensitivity. In

addition, we establish a link between sensitivity to PARPi

and induction of interferon and apoptosis gene expression.

Furthermore, we demonstrate that recombinant IFN-cenhances the cytotoxicity of PARPi in BRCA1-deficient

cells.

Materials and methods

Cell lines and chemicals

Colon carcinoma HT-29 and cervical carcinoma HeLa S3

(HeLa) cells were obtained from the American Type Cul-

ture Collection, Rockville, MD. Cell lines were maintained

in exponential growth in Dulbecco’s modified Eagle’s

medium supplemented with 10% fetal bovine serum

(Invitrogen, Carlsbad, CA). The BRCA1 and SHFM1

inducibly silenced cell lines (HT-29 tts BRCA1 3484,

HT-29 tts BRCA1 1768, HT-29 tts SHFM1 208, HeLa tts

BRCA1 1768) were generated by transduction of cells with

lentiviral vectors expressing one of three shRNA sequen-

ces: BRCA1-3484 (GATCCCCGAAGTAGTTCAGACTG

TTATTCAAGAGATAACAGTCTGAACTACTTCTTTT

TGGAAGCTT), BRCA1-1768 (GATCCCCGGTCAA

GTGATGAATATTATTCAAGAGATAATATTCATCA

CTTGACCTTTTTGGAAGCTT) or SHFM1-208 (GGC

TGGCTTAGATGAAGATTTCAAGAGAATCTTCATCT

AAGCCAGCC) under control of KRAB-tTR [17].

Silencing was induced in these cells by treatment with

500 ng/ml doxycycline (DOX). PARPi compounds were

synthesized according to published reports and are referred

to herein as PARPi-A (#45) [18], PARPi-B (AG14361)

[19] and PARPi-C (KU0058684) [2]. Recombinant inter-

feron-c was purchased from R&D Systems (Cat # 285-IF).

Caspase 3/7 assay

Trypsinized cells were plated ± DOX. 24 h later, cells

were treated with either DMSO or 2uM PARPi-C. 72 h

after addition of PARPi-C, cells were treated with Caspase

Glo 3/7 according to manufacturer’s instructions (Pro-

mega) and read on a luminometer.

Cell proliferation and EC50 determination

Each PARPi was titrated across a nine point, fourfold

dilution series on HT-29 tts BRCA1-3484 cells cultured in

the presence or absence of DOX. Cell growth was deter-

mined by use of Alamar Blue according to manufacturer

specifications (BioSource International, Camarillo, CA.) as

described previously [20], and EC50 values for PARPi

were determined by use of GraphPad Prism software and a

non-linear curve fitting function.

Cell cycle analysis

Cell cycle profiles were generated with a FACS Calibur

flow cytometer (Becton–Dickinson) as described previously

[21].

c-H2AX assays

BRCA1 silencing was induced by DOX treatment of HT-

29 tts BRCA1 3484 cells. After 24 h, DOX (?) and DOX

(-) cells were treated with or without PARPi-C (10 lM)

for 72 h. Cells were then harvested, pelleted, and total cell

lysates extracted. Western immunoblots were performed

with 10 lg protein/lane and probed with anti-c-H2A.X

monoclonal antibody (H2A.X Ser139, Millipore cat#

05-636). Immunoblots were then stripped and re-probed

with polyclonal anti-H2A.X (Millipore cat# 07-627). Pro-

tein levels were normalized to H2A.X signal and quantified

by use of the DC protein assay kit (BioRad, Hercules, CA)

in conjunction with infrared imaging (LI-COR Biosci-

ences, Lincoln, NE).

692 Apoptosis (2012) 17:691–701

123

Gene expression analysis

Cell lysates were homogenized by QIAshredder spin col-

umns and total cellular RNA isolated with the RNAeasy

mini kit (QIAGEN). RNA amplification, labeling and

hybridization to human ink-jet DNA microarrays was

carried out as described previously [22]. Transcript regu-

lations are presented as PARPi (?)/PARPi (-) ratios in

1-dimensional hierarchical clusters in which experimental

samples are ordered and transcripts are clustered. mRNA

levels for BRCA1, SHFM1, MX1, MX2, 2,5 OASL, 2,5

OAS2 and IRF1 were quantified by PCR by use of an ABI

PRISM 7900HT sequence detection system and Assays-on-

Demand gene expression products (Applied Biosystems,

Foster City, CA). mRNA values were normalized relative

to human GUSB (catalogue no. 431088E) mRNA levels.

Drug titration and drug synergy determination

PARPi/IFN-c synergy was assessed according to the

method of Chou-Talalay method [23], and data was ana-

lyzed by CalcuSyn dose effect analyzer software.

Results

Induced repression of BRCA-network genes sensitizes

HT-29 colon adenocarcinoma cells to PARPi

To establish a cell culture model in which the transcrip-

tional basis for PARPi cytotoxicity in BRCA-network

disrupted tumor cells could be investigated, we used len-

tiviral vector-directed expression of tetracycline-inducible

shRNAs to silence BRCA-network transcripts [17].

Quantitative PCR revealed that DOX induction of lentiviral

vector-directed BRCA1 or SHFM1 shRNA in HT-29

repressed targeted transcript levels by C 85% compared to

DOX (-) controls (Supplemental Figure 1). DOX induced

transcript repression combined with PARPi treatment

resulted in a sustained accumulation of cells in G2/M

indicative of DNA damage induced cell cycle arrest

(Fig. 1). In addition, PARPi treatment caused a selective

two to threefold increase in caspase 3/7 activity in shRNA

expressing cells (Fig. 2). Furthermore, using c-H2A.X as a

marker for the accumulation of DSBs and apoptosis [24],

PARPi treatment selectively triggered a threefold increase

in phosphorylation of histone H2A.X (c-H2A.X) in shRNA

expressing cells (Supplemental Figure 2 and data not

shown), and PARPi induced the formation of c-H2A.X foci

in the nucleus of BRCA1 siRNA transfected cells

(unpublished data). Taken together these data demonstrate

that PARPi-mediated cell cycle arrest, DSB accumula-

tion and apoptosis can be induced by repression of

BRCA-network genes repeating, in HT-29, the reported

effect of PARPi in BRCA mutant cells [1, 2].

Isolation of a PARPi induced gene signature

that correlates with increasing PARPi potency

and disruption of BRCA-network function

Distinct changes in gene expression are known to accom-

pany cell cycle disruption and apoptosis. In addition, cell

cycle and apoptotic phenotypes induced by pharmacologi-

cal inhibition can be associated with both mechanism-based

and compound-specific changes in gene expression that

when segregated provide important molecular information

about cellular responses triggered by small molecule-target

engagement. To identify a PARPi mechanism-based gene

signature(s) that exhibits BRCA-network selectivity, we

assembled a panel of three PARPi that differed by potency,

structural class and EC50 in HT-29 tts BRCA1 3484

(Fig. 3) [2, 18, 19]. Each inhibitor was titrated on the HT-29

tts BRCA1 3484 cell line in the presence or absence of

DOX, and full genome transcript profiles were generated

from PARPi treated and untreated cells using Agilent 25K

ink-jet DNA microarrays. All samples were fluor-reversed

and subjected to competitive hybridization against DOX-

matched, PARPi negative controls in order to identify

transcripts whose expression was PARPi-dependent and

DOX-independent. P values were assigned to each gene

represented on the 25K array using a ratio error model for

two-color microarrays [25].

To identify only those genes whose expression was

dependent upon the activity of all three PARPi tested, we

focused our gene expression analysis on transcripts that

displayed each of the following three characteristics: (1)

PARPi dose-dependent expression, (2) altered expression

in response to multiple PARPi, and (3) altered expression

dependent upon BRCA1 transcript repression. Using this

approach we identified an induced set of genes that fulfilled

all three criteria and varied in size depending upon inhib-

itor potency (Fig. 3). Notably, for the least potent inhibitor

tested, PARPi-A, only the strongest signature genes were

induced in BRCA1- cells generating a profile in the 1 lLsample whose magnitude of induction fell between that of

the 10 and 100 nm samples for the 10–60 fold more potent

PARPi-B and C (Fig. 3). Exposure of BRCA1? cells to

1 lM of the more potent inhibitors (PARPi-B, C) triggered

induction of a subset of signature genes observed in the

BRCA1- cells, but the magnitude of induction did not

approach that observed in BRCA1- cells (Fig. 3).

To gain functional insight into PARPi-dependent gene

expression we grouped all signature genes on the basis of

their Gene Ontology (GO) annotation. We defined the

PARPi signature for this analysis as all HT-29 tts BRCA1

3484 transcripts that exhibited PARPi dose dependence

Apoptosis (2012) 17:691–701 693

123

between 1 nM and 1 lM PARPi-C and a C1.5 fold

PARPi-C dependent change in expression (p B 0.01) at the

highest PARPi-C dose (1 lM) in DOX treated cells

(Supplemental Table T1). Using as background all tran-

scripts represented on the microarray, E values were calcu-

lated for GO terms associated with PARPi signature genes.

Fig. 1 Induced silencing of

BRCA1 or SHFM1 triggers cell

cycle arrest in response to

PARPi. HT-29 tts BRCA1 3484

and SHFM1 208 cells were

cultured in the presence

(DOX?, BRCA1-) or absence

(DOX-, BRCA1?) of

500 ng/ml DOX. After 24 h,

both BRCA1? and BRCA1-

cells were treated with 10 lM

of PARPi-C followed by flow

cytometry to generate cell cycle

profiles at the indicated times

post treatment. Data are

presented as the % of total

fluorescence detected with the

mean G2/M population and

standard deviation (SD)

provided for each sample

derived from three separate

experiments

694 Apoptosis (2012) 17:691–701

123

The top GO hits were enriched with multiple immune

response and apoptosis terms. The term ‘‘Response to virus’’

(interferon pathway) was the top overall GO hit (E \ 1e-18),

and ‘‘Positive regulation of apoptosis’’ (E \ 8.2e-11) was

the top apoptosis term. An ordered cluster of interferon

pathway (IFN) annotated signature genes is provided in

Fig. 4 and a list of all IFN and apoptosis annotated genes

derived from the HT-29 tts BRCA1 3484 PARPi signature is

provided in Supplemental Tables T2, T3.

Quantitative PCR was used to confirm changes in

expression for a subset of PARPi-responsive, interferon

pathway annotated transcripts selected from the HT-29

derived gene signature. This analysis demonstrated that

transcript induction in BRCA1- cells occurred at PARPi-C

concentrations 100-fold lower than that of BRCA1? cells,

with maximal transcript expression detected at lower

PARPi concentrations and at fold changes two to threefold

higher in BRCA1- cells (Fig. 5a–e). In addition, transcript

induction was not a shRNA artifact as transcript levels

were unaltered in response to BRCA1 shRNA expression

in the absence of PARPi (Fig. 5f). Moreover, transcript

induction was dependent upon BRCA1-network disruption

and was not shRNA or BRCA1 shRNA specific, as

expression profiles generated from HT-29 tts BRCA1 1768

and HT-29 tts SHFM1-208 cell lines produced gene sig-

natures highly similar to that of HT-29 tts BRCA1-3484

(Fig. 6).

Induction of IFN/Apoptosis gene expression is not cell

type selective

Closer examination of the IFN pathway genes contained

within the HT-29 PARPi-C signature revealed three

members (IRF-1, IRF-2, IRF-7) of the Interferon Respon-

sive transcription Factor (IRF) Family (Fig. 4). This family

contains nine genes (IRF-1-9) that regulate expression of

RL

U

BRCA1 +

BRCA1 -

0

1

2

3

DMSO

PARPi-C

RL

U

BRCA1 +

BRCA1 -

0

1

2

3

RL

U

SHFM1 +

SHFM1 -

0

1

2

3

4

Fig. 2 Induced silencing of

BRCA1 or SHFM1 triggers

apoptosis in response to PARPi

treatment of HT-29. HT-29 tts

BRCA1 3484, BRCA1 1768,

and SHFM1 208 cells were

cultured in the presence

(DOX?, BRCA1-) or absence

(DOX-, BRCA1?) of

500 ng/ml DOX. After 24 h,

both BRCA1? and BRCA1-

cells were treated with or

without 2 lM of PARPi-C and

maintained in culture for 72 h.

Cells were then treated with

Caspase Glo and relative

luminescence (RLU) was

measured by luminometer

Fig. 3 Induction of HT-29 gene signature is dependent on PARPi

potency and BRCA1 depletion. HT-29 tts BRCA1 3484 cells were

cultured in the presence of DOX (BRCA1-) or absence of DOX

(BRCA1?). After 24 h, increasing concentrations (10 nM, 10 nM,

1 lL) of three different PARP inhibitors (PARPi-A, B, C) were

added to BRCA1? and BRCA1- cells, and the cells were cultured

for an additional 72 h. Total cellular RNA was then isolated and

subjected to competitive hybridization with DOX-matched, PARPi

negative controls. Samples were ordered by PARPi potency and

concentration. The EC50 values determined for each PARPi in HT-29

BRCA1- cells are provided. Genes up-regulated C2 fold (p B 0.01)

in any single experiment are clustered. Scale bar is Log10

Apoptosis (2012) 17:691–701 695

123

transcripts involved with anti-viral responses, cell cycle

regulation, and apoptosis [26]. IRF-1 is a critical regulator

of cellular responses induced by IFN-c, and its activation in

response to DNA damage involves an ATM-dependent

signaling pathway [27]. IRF-1 and IRF-5 may function as

tumor suppressor genes [28, 29], and transcription of these

two IRF family members along with IRF-3 and IRF-7 is

stimulated in response to DNA damage [30–33].

The established link between IRF expression and DNA

damage induced apoptosis led us to speculate that inter-

feron pathway gene expression could extend to PARPi

treatment of additional tumor cell types modified to repress

BRCA1. To test this hypothesis, we generated the tetra-

cycline-inducible BRCA1 shRNA cell line, HeLa tts

BRCA1 1768. Treatment of this cell line to DOX caused a

75% reduction in BRCA1 mRNA as determined by quan-

titative PCR (Supplemental Figure 1), and BRCA1

silencing increased HeLa sensitivity to PARPi-C (Supple-

mental Figure 3). In addition, PARPi-C treatment selec-

tively triggered G2/M cell cycle arrest in BRCA1-depleted

HeLa (Supplemental Figure 4) and caused the formation of

gamma H2AX nuclear foci (unpublished data). Expression

profiles of PARPi treated HeLa tts BRCA1 1768 yielded a

DOX-dependent PARPi gene signature that, like HT-29,

was enriched with transcripts having IFN pathway or

apoptosis GO annotation (Fig. 7, Supplemental Tables

T4-7). In addition, 88% of the IFN/apoptosis annotated

transcripts induced by PARPi in BRCA1-deficient HeLa

were contained in the HT-29 signature indicating that

PARPi-dependent IFN/apoptosis gene expression in the

context of BRCA-network disruption is not cell type

specific (Fig. 7, Supplemental Table T7). Furthermore,

40% of the HeLa PARPi-C signature was contained within

the larger HT-29 signature with 17% of both signatures

associated with IFN pathway or apoptosis annotation

(Fig. 7, Supplemental Table T7). The PARPi-dependent

signature in BRCA1-depleted HeLa is one-fourth the size of

the HT-29 PARPi signature generated with the same con-

centration of inhibitor (PARPi-C). This is likely a function

of gene dosage as silencing of BRCA1 mRNA is less in the

HeLa line (75%) compared to that of both HT-29 BRCA1

shRNA lines ([85%). This is consistent with a [50-fold

reduction of PARPi-C potency in HeLa tts BRCA1 1768

compared to HT-29 tts BRCA1 lines and HeLa cells in

which BRCA1 mRNA is suppressed in excess of 85% by

siRNA transfection (unpublished data), and the reduced

potency of PARPi-C in all shRNA expressing cell lines

when compared to PARPi-C potency in BRCA1 mutant

cells (Fig. 3, Supplemental Figure 3) [2].

IFN-c enhances the cytoxicity of PARPi in BRCA1-

depleted cells

Because IRF family members regulate growth inhibitory

and apoptotic responses triggered by DNA damage, we

hypothesized that recombinant IFNs might enhance the

cytotoxicity of PARPi. In preliminary HT-29 experiments,

we found that recombinant IFN-c enhanced PARPi cyto-

toxicity in BRCA1-depleted cells. Recombinant IFN-b had

a smaller effect and recombinant IFN-a had no effect

(unpublished data). Therefore, IFN-c was chosen for a

detailed assessment of Type II IFN pathway activation on

Fig. 4 PARPi triggers

enhanced IFN pathway gene

induction in BRCA1-depleted

cells. HT-29 tts BRCA1 3484

were cultured and treated with

increasing concentrations of

PARPi-C (1, 10, 100,

1,000 nM) as described in

Fig. 3. Total cellular RNA was

isolated and subjected to

competitive hybridization

versus DOX-matched, PARPi

negative controls All transcripts

associated with GO Biological

Process term ‘‘Response to

virus’’ (interferon pathway) that

were up-regulated C1.5 fold

(p B 0.01) in any single

experiment were used to cluster

samples ordered by BRCA1

status. Scale bar is Log10

696 Apoptosis (2012) 17:691–701

123

A B

C D

E F

Fig. 5 Selective induction of

interferon pathway genes in

BRCA1-depleted cells treated

with PARPi. HT-29 tts BRCA1

3484 were cultured and treated

with increasing concentrations

of PARPi-C (1, 10, 100, 1,000,

10,000 nM) or untreated as

described in Fig. 3. Total

cellular RNA was isolated,

converted to cDNA, and the

relative transcript abundance for

the interferon pathway genes

specified was assessed by

quantitative PCR. All gene

expression was normalized to

the human housekeeping gene

GUSB. Data are presented as

the fold change in expression in

PARPi-C treated compared with

untreated samples (a–e) or DOX

treated compared with No DOX

samples in the absence of

PARPi-C (f)

BRCA1 3484

BRCA1 1768

SHFM1 208

DOX

(-)

(-)

(-)

(+)

(+)

(+)

Fig. 6 Induction of HT-29 PARPi gene signature is enhanced by

BRCA-network disruption. HT-29 tts BRCA1 3484, BRCA1 1768

and SHFM1 208 were cultured in the presence (DOX?) or absence

(DOX-) of 500 ng/ml DOX. After 24 h, all cells were treated with

1 lM of PARPi-C. Total cellular RNA was isolated at 72 h after

PARPi-C treatment and subjected to competitive hybridization versus

DOX-matched, PARPi-C negative controls. Genes up-regulated C2

fold (p B 0.01) in any single sample were used to cluster the six

different profiles. Scale bar is Log10

Apoptosis (2012) 17:691–701 697

123

PARPi cytotoxicity in BRCA1-depleted cells. IFN-c was

titrated on HT-29 cells to identify a dose that would not

reduce cell viability over a 6 days treatment. A concen-

tration of 25 U/ml (1.25 ng/ml) was selected (Fig. 8 and

data not shown), which is 2–5 times the clinically relevant

plasma concentration of IFN-c reported in a colon cancer

phase I trial [34]. The effect on cell viability of increasing

concentrations of PARPi-C on BRCA1? or BRCA1-

HT-29 cells cultured in the presence or absence of 25 U/ml

IFN-c was then tested (Fig. 8). PARPi-C had no effect on

BRCA1? cell viability in this assay in the absence of

IFN-c, but BRCA1- cells were clearly sensitive (EC50

*25 nM). Addition of IFN-c reduced viability of BRCA1

?cells at the higher concentrations of PARPi-C and

increased PARPi-C potency by[10 fold in BRCA1- cells

(Fig. 8). Qualitatively similar results were obtained with

less potent PARPi, although the lower potency of these

compounds meant higher concentrations of inhibitor were

required to achieve comparable reductions in cell viability

observed with PARPi-C (unpublished data). Furthermore,

when the Chou and Talalay method was employed to

assess the combination of PARPi-C and IFN-c, it was

determined that the combination exhibited moderate syn-

ergism in BRCA1- cells (combination index \0.85) at

PARPi-C concentrations at or below its EC50 (Supple-

mental Figure 5) [23]. These data underscore a functional

connection between BRCA-network-PARPi synthetic

lethality and activation of the IFN/DNA damage pathway.

Discussion

The specific molecular mechanisms that link increased

genetic instability and cytotxicity in PARPi treated HR-

deficient cells are not well defined. Notably, attenuation of

NHEJ rescues the synthetic lethality of PARPi in HR-defi-

cient cells, indicating PARPi-stimulated NHEJ activity is a

critical component driving the increased genetic instability

observed in HR-deficient cells exposed to PARPi [10].

We generated a panel of tetracycline-inducible shRNA

expressing tumor cell lines to serve as tools for character-

izing transcriptional responses triggered by PARPi in the

context of BRCA-network disruption. While there will

likely be cell-type specific differences in transcript reg-

ulation associated with PARPi synthetic lethality (Fig. 7),

we have demonstrated an IFN/apoptotic transcriptional

response coincides with PARPi cytotoxicity in BRCA-net-

work-disrupted tumor cells. It is evident from data reported

here that sensitization of BRCA1? cells to elevated doses of

PARPi can be achieved in combination with recombinant

IFN-c. Moreover, the cytotoxicity of lower PARPi doses in

BRCA1-depleted HT-29 cells can be increased[10-fold if

used in combination with recombinant IFN-c. These results

are consistent with induction of IFN responsive transcripts at

low PARPi doses in BRCA-network disrupted cells and at

elevated PARPi doses in BRCA? cells. Taken together

these results provide evidence that IFN pathway activation

can be associated with and can enhance PARPi cytotoxicity.

It will be important to expand observations reported here to

additional tumor cell types, in vivo models and PARPi-

sensitizing genes [3, 35].

ATM is a PI3 kinase family member that plays a central

role in DSB repair through its phosphorylation of key

substrates involved in DNA repair and cell cycle control

Fig. 7 The PARPi-dependent gene signature exhibits BRCA-net-

work context selectivity and is enriched with interferon pathway and

apoptosis genes. HT-29 and HeLa PARPi-dependent signature genes

were defined by identifying all transcripts that exhibited PARPi dose

dependence between 1 nM and 1 lM PARPi-C and a C1.5 fold

PARPi-C dependent change in expression (p B 0.01) at the PARPi-C

dose (1 lM) in DOX treated cells. The size and overlap of the PARPi-

specific signatures identified in HT-29 and HeLa is presented along

with the overlap of ‘‘Response to virus’’ (interferon response) and

‘‘Positive regulation of apoptosis’’ GO annotated transcripts contained

within each cell line’s PARPi gene signature. Gene signature lists are

provided in Supplemental Tables T1-T7

Fig. 8 IFN-c increases PARPi cytotoxicity. HT-29 tts BRCA1 3484

cells were cultured in the presence (DOX?, BRCA1-) or absence

(DOX-, BRCA1?) of DOX. After 24 h, PARPi-C was added across

a 9-point, fourfold dilution series in the presence or absence of

25 U/ml IFN-c. Cells were cultured for an additional 6 days prior to

analysis of cell proliferation with Alamar Blue. Dose titration curves

were generated and EC50 values for a given condition calculated and

reported in nM concentrations. Conditions for which the EC50 could

not be determined are noted as ND. Data are expressed as percent

proliferation of the no drug control. Data are representative of

multiple experiments in which the presence of IFN-c was observed to

increase PARPi potency C10 fold

698 Apoptosis (2012) 17:691–701

123

[36, 37]. ATM is required to prevent DSB accumulation

during DNA replication as it functions in concert with ATR to

promote repair and restart of collapsed replication forks [38].

Stable siRNA-mediated silencing of ATM in HeLa cells

induced the expression of a thirty-five gene signature con-

taining IFN response genes IRF-7, OASL, OAS1, IFITM1

and STAT1 [39]. These transcripts were also upregulated in

ATM mutant cells derived from ataxia telangiectasia patients

[39]. There is overlap between the HeLaATM601 gene sig-

nature and the PARPi-dependent signature detected in HeLa

and HT-29 (Supplemental Table T8). This overlap in gene

expression is interesting when considered in the context of

recent reports demonstrating ATM deficiency sensitizing

tumor cells to PARPi [40, 41]. Taken together, these data

support the conclusion that PARPi-induced activation of the

interferon pathway is not a cell-type specific effect, but is a

general response to increased genetic instability resulting

from the accumulation of DSBs.

Our observation that PARPi cytotoxicity in BRCA-net-

work disrupted cells corresponds with induction of IRF

family member transcripts suggests that these transcription

factors may be driving apoptosis in our culture models. IRF

family members were originally identified as regulators of

IFN pathway gene expression. IRFs 1, 3, 5 and 7 are

activated in response to DNA damage [30–33], and IRF-1

has been shown to regulate TP53-independent DNA dam-

age-induced apoptosis [31]. In addition, BRCA1 can indi-

rectly increase IRF-7 expression by way of its regulation of

STAT1 transcriptional activity and the expression of type I

interferons [42]. However, the increased expression of

IRF-7 in BRCA1-depleted HT-29 and HeLa cells in response

to PARPi indicates an alternative mechanism is responsible

for elevated IRF-7 expression reported here. It should be

possible to evaluate the role of IRF family members and

other IFN-responsive genes in regulating PARPi cytotoxic-

ity by use of targeted siRNA libraries to screen for PARPi

suppressor genes whose depletion reduces or eliminates

PARPi cytotoxicity. In addition, HR-deficient cells in which

the IFN response has been attenuated either through RNAi-

mediated silencing or pharmacological inhibition could be

used to further define a requirement for IFN pathway acti-

vation in triggering PARPi cytotoxicity.

Interferons are important modulators of innate and

adaptive immune responses as they possess antiviral and

anti-proliferative activity in addition to being able to trigger

apoptosis [43]. Type I (IFN-a/b), type II (IFN-c) and type III

(IL-28A, IL-28B, and IL-29) interferons are grouped in part

on the basis of their distinct receptor complexes [44, 45]. The

utility of interferons as therapeutics for a whole host of

diseases, ranging from autoimmune disorders, viral infection

and cancer has and continues to be explored. Notably, IFN-chas been used clinically in combination with certain che-

motherapeutic regimes [34, 46], and it was recently shown

that IFN-c but not IFN-a/b could restore the responsiveness

of an anti-estrogen-resistant ER-positive breast cancer cell

line to fulvestrant through the induction of IRF-1 [47]. There

is also increasing interest in the therapeutic potential of type

III interferons, because their receptor expression is restricted

primarily to cells of epithelial origin, suggesting clinical use

of type III interferons, unlike IFN-a, may not be plagued by

systemic toxicity [45]. Signaling through type III receptors

was reported to produce more robust apoptosis in HT-29

cells than signaling through either type I or type II receptors,

and IFN-c treatment further sensitized HT-29 cells to type III

mediated apoptosis [48]. PARPi treatment of BRCA-net-

work disrupted HT-29 caused elevation in transcript levels

for all type III interferons, and this may in part explain the

IFN-c sensitization of HT-29 to PARPi. Furthermore, we

found that type I and type II interferons exhibited differences

in their ability to enhance PARPi cytotoxicity in BRCA-

network disrupted HT-29. This could be a cell type specific

effect or a more general phenomenon resulting from dif-

ferences in how type I and type II mediated responses

interact with PARPi-dependent IFN pathway activation. It

will be important to extend the observations reported here to

combinations of PARPi and type III interferons in addition to

defining molecular differences between various PARPi/IFN

combinations.

Our findings suggest several avenues for continued

investigation in pre-clinical animal models with the potential

to impact clinical application of PARPi. Detection of IFN

pathway activation may be a useful biomarker for assessing

in vivo responses to PARPi. Several cytokine transcripts are

contained within the PARPi signature (Fig. 5, Supplemental

Table T1, T4) suggesting PARPi-dependent elevation of

these cytokines in plasma might correlate with PARPi

response. Alternatively, interferon gene expression analysis

of circulating tumor cells or pre- and post dose tumor

biopsies, when retrievable, could be utilized to assess PARPi

response. Our observation that IFN-c can enhance PARPi

toxicity in BRCA1-deficient cells, while not predictive of

clinical benefit, does identify a possible therapeutic method

for increasing PARPi efficacy. Realization of any clinical

benefit from the combination of selected interferons with

PARPi will likely depend upon tumor type, genetic context,

and limiting interferon associated toxicity. In this context,

maturation of methods being developed to target cytokine

secreting dendritic cells directly to solid tumors could pro-

vide a more precise, less toxic method for enhancing PARPi

efficacy [49, 50].

Acknowledgments We wish to thank our colleagues at Rosetta and

Merck for support and stimulating discussions. We thank Kenzie

MacIsaac for help with GO annotation of PARPi signature gene lists.

We thank Jim Roberts, David Wiest, and Brett Kaiser for critical

reading of this manuscript. The authors state that there exists no

conflict of interest with the publication of this manuscript.

Apoptosis (2012) 17:691–701 699

123

References

1. Bryant HE, Schultz N, Thomas HD, Parker KM, Flower D, Lopez

E et al (2005) Specific killing of BRCA2-deficient tumours with

inhibitors of poly(ADP-ribose) polymerase. Nature 434(7035):

913–917

2. Farmer H, McCabe N, Lord CJ, Tutt AN, Johnson DA, Richardson

TB et al (2005) Targeting the DNA repair defect in BRCA mutant

cells as a therapeutic strategy. Nature 434(7035):917–921

3. McCabe N, Turner NC, Lord CJ, Kluzek K, Bialkowska A, Swift

S et al (2006) Deficiency in the repair of DNA damage by

homologous recombination and sensitivity to poly(ADP-ribose)

polymerase inhibition. Cancer Res 66(16):8109–8115

4. Kim MY, Zhang T, Kraus WL (2005) Poly(ADP-ribosyl)ation by

PARP-1: ‘PAR-laying’ NAD? into a nuclear signal. Genes Dev

19(17):1951–1967

5. Schreiber V, Dantzer F, Ame JC, de Murcia G (2006) Poly(ADP-

ribose): novel functions for an old molecule. Nat Rev Mol Cell

Biol 7(7):517–528

6. O’Donovan PJ, Livingston DM (2010) BRCA1 and BRCA2:

breast/ovarian cancer susceptibility gene products and partici-

pants in DNA double-strand break repair. Carcinogenesis 31(6):

961–967

7. Marston NJ, Richards WJ, Hughes D, Bertwistle D, Marshall CJ,

Ashworth A (1999) Interaction between the product of the breast

cancer susceptibility gene BRCA2 and DSS1, a protein func-

tionally conserved from yeast to mammals. Mol Cell Biol 19(7):

4633–4642

8. Gudmundsdottir K, Lord CJ, Witt E, Tutt AN, Ashworth A

(2004) DSS1 is required for RAD51 focus formation and geno-

mic stability in mammalian cells. EMBO Rep 5(10):989–993

9. Arnaudeau C, Lundin C, Helleday T (2001) DNA double-strand

breaks associated with replication forks are predominantly

repaired by homologous recombination involving an exchange

mechanism in mammalian cells. J Mol Biol 307(5):1235–

1245

10. Patel AG, Sarkaria JN, Kaufmann SH (2011) Nonhomologous

end joining drives poly(ADP-ribose) polymerase (PARP) inhib-

itor lethality in homologous recombination-deficient cells. Proc

Natl Acad Sci USA 108(8):3406–3411

11. Yap TA, Sandhu SK, Carden CP, de Bono JS (2011) Poly(ADP-

ribose) polymerase (PARP) inhibitors: exploiting a synthetic

lethal strategy in the clinic. CA Cancer J Clin 61(1):31–49

12. Zhang J, Powell SN (2005) The role of the BRCA1 tumor sup-

pressor in DNA double-strand break repair. Mol Cancer Res

3(10):531–539

13. Turner N, Tutt A, Ashworth A (2004) Hallmarks of ‘BRCAness’

in sporadic cancers. Nat Rev Cancer 4(10):814–819

14. Rastelli F, Biancanelli S, Falzetta A, Martignetti A, Casi C,

Bascioni R et al (2010) Triple-negative breast cancer: current

state of the art. Tumori 96(6):875–888

15. O’Shaughnessy J, Osborne C, Pippen JE, Yoffe M, Patt D, Rocha

C et al (2011) Iniparib plus chemotherapy in metastatic triple-

negative breast cancer. N Engl J Med 364(3):205–214

16. Guha M (2011) Parp inhibitors stumble in breast cancer. Nat

Biotechnol 29(5):373–374

17. Wiznerowicz M, Trono D (2003) Conditional suppression of

cellular genes: lentivirus vector-mediated drug-inducible RNA

interference. J Virol 77(16):8957–8961

18. Pescatore G, Branca D, Fiore F, Kinzel O, Bufi LL, Muraglia E et al

(2010) Identification and SAR of novel pyrrolo[1,2-a]pyrazin-

1(2H)-one derivatives as inhibitors of poly(ADP-ribose) poly-

merase-1 (PARP-1). Bioorg Med Chem Lett 20(3):1094–1099

19. Smith LM, Willmore E, Austin CA, Curtin NJ (2005) The novel

poly(ADP-Ribose) polymerase inhibitor, AG14361, sensitizes

cells to topoisomerase I poisons by increasing the persistence of

DNA strand breaks. Clin Cancer Res 11(23):8449–8457

20. Bartz SR, Zhang Z, Burchard J, Imakura M, Martin M, Palmieri

A et al (2006) Small interfering RNA screens reveal enhanced

cisplatin cytotoxicity in tumor cells having both BRCA network

and TP53 disruptions. Mol Cell Biol 26(24):9377–9386

21. Carleton M, Mao M, Biery M, Warrener P, Kim S, Buser C et al

(2006) RNA interference-mediated silencing of mitotic kinesin

KIF14 disrupts cell cycle progression and induces cytokinesis

failure. Mol Cell Biol 26(10):3853–3863

22. Hughes TR, Mao M, Jones AR, Burchard J, Marton MJ, Shannon

KW et al (2001) Expression profiling using microarrays fabri-

cated by an ink-jet oligonucleotide synthesizer. Nat Biotechnol

19(4):342–347

23. Chou TC, Talalay P (1984) Quantitative analysis of dose-effect

relationships: the combined effects of multiple drugs or enzyme

inhibitors. Adv Enzyme Regul 22:27–55

24. Kinner A, Wu W, Staudt C, Iliakis G (2008) Gamma-H2AX in

recognition and signaling of DNA double-strand breaks in the

context of chromatin. Nucleic Acids Res 36(17):5678–5694

25. Weng L, Dai H, Zhan Y, He Y, Stepaniants SB, Bassett DE

(2006) Rosetta error model for gene expression analysis. Bioin-

formatics 22(9):1111–1121

26. Tanaka N, Taniguchi T (2000) The interferon regulatory factors

and oncogenesis. Semin Cancer Biol 10(2):73–81

27. Pamment J, Ramsay E, Kelleher M, Dornan D, Ball KL (2002)

Regulation of the IRF-1 tumour modifier during the response to

genotoxic stress involves an ATM-dependent signalling pathway.

Oncogene 21(51):7776–7785

28. Bouker KB, Skaar TC, Riggins RB, Harburger DS, Fernandez

DR, Zwart A et al (2005) Interferon regulatory factor-1 (IRF-1)

exhibits tumor suppressor activities in breast cancer associated

with caspase activation and induction of apoptosis. Carcinogen-

esis 26(9):1527–1535

29. Hu G, Barnes BJ (2006) Interferon regulatory factor-5-regulated

pathways as a target for colorectal cancer therapeutics. Expert

Rev Anticancer Ther 6(5):775–784

30. Hu G, Mancl ME, Barnes BJ (2005) Signaling through IFN regu-

latory factor-5 sensitizes p53-deficient tumors to DNA damage-

induced apoptosis and cell death. Cancer Res 65(16):7403–7412

31. Tamura T, Ishihara M, Lamphier MS, Tanaka N, Oishi I, Aizawa

S et al (1995) An IRF-1-dependent pathway of DNA damage-

induced apoptosis in mitogen-activated T lymphocytes. Nature

376(6541):596–599

32. Kim T, Kim TY, Song YH, Min IM, Yim J, Kim TK (1999)

Activation of interferon regulatory factor 3 in response to DNA-

damaging agents. J Biol Chem 274(43):30686–30689

33. Kim TK, Kim T, Kim TY, Lee WG, Yim J (2000) Chemother-

apeutic DNA-damaging drugs activate interferon regulatory

factor-7 by the mitogen-activated protein kinase kinase-4-cJun

NH2-terminal kinase pathway. Cancer Res 60(5):1153–1156

34. Turner PK, Houghton JA, Petak I, Tillman DM, Douglas L,

Schwartzberg L et al (2004) Interferon-gamma pharmacokinetics

and pharmacodynamics in patients with colorectal cancer. Cancer

Chemother Pharmacol 53(3):253–260

35. Turner NC, Lord CJ, Iorns E, Brough R, Swift S, Elliott R et al

(2008) A synthetic lethal siRNA screen identifying genes medi-

ating sensitivity to a PARP inhibitor. EMBO J 27(9):1368–1377

36. Elson A, Wang Y, Daugherty CJ, Morton CC, Zhou F, Campos-

Torres J et al (1996) Pleiotropic defects in ataxia-telangiectasia

protein-deficient mice. Proc Natl Acad Sci USA 93(23):13084–

13089

37. Smith J, Tho LM, Xu N, Gillespie DA (2010) The ATM-Chk2

and ATR-Chk1 pathways in DNA damage signaling and cancer.

Adv Cancer Res 108:73–112

700 Apoptosis (2012) 17:691–701

123

38. Trenz K, Smith E, Smith S, Costanzo V (2006) ATM and ATR

promote Mre11 dependent restart of collapsed replication forks

and prevent accumulation of DNA breaks. EMBO J 25(8):

1764–1774

39. Chen S, Wang G, Makrigiorgos GM, Price BD (2004) Stable

siRNA-mediated silencing of ATM alters the transcriptional

profile of HeLa cells. Biochem Biophys Res Commun 317(4):

1037–1044

40. Weston VJ, Oldreive CE, Skowronska A, Oscier DG, Pratt G,

Dyer MJ et al (2010) The PARP inhibitor olaparib induces sig-

nificant killing of ATM-deficient lymphoid tumor cells in vitro

and in vivo. Blood 116(22):4578–4587

41. Williamson CT, Muzik H, Turhan AG, Zamo A, O’Connor MJ,

Bebb DG et al (2010) ATM deficiency sensitizes mantle cell

lymphoma cells to poly(ADP-ribose) polymerase-1 inhibitors.

Mol Cancer Ther 9(2):347–357

42. Buckley NE, Hosey AM, Gorski JJ, Purcell JW, Mulligan JM,

Harkin DP et al (2007) BRCA1 regulates IFN-gamma signaling

through a mechanism involving the type I IFNs. Mol Cancer Res

5(3):261–270

43. Parmar S, Platanias LC (2003) Interferons: mechanisms of action

and clinical applications. Curr Opin Oncol 15(6):431–439

44. Samuel CE (2001) Antiviral actions of interferons. Clin Micro-

biol Rev 14(4):778–809 (table of contents)

45. Donnelly RP, Kotenko SV (2010) Interferon-lambda: a new

addition to an old family. J Interferon Cytokine Res 30(8):

555–564

46. Schwartzberg LS, Petak I, Stewart C, Turner PK, Ashley J,

Tillman DM et al (2002) Modulation of the Fas signaling path-

way by IFN-gamma in therapy of colon cancer: phase I trial and

correlative studies of IFN-gamma, 5-fluorouracil, and leucovorin.

Clin Cancer Res 8(8):2488–2498

47. Ning Y, Riggins RB, Mulla JE, Chung H, Zwart A, Clarke R

(2010) IFNgamma restores breast cancer sensitivity to fulvestrant

by regulating STAT1, IFN regulatory factor 1, NF-kappaB, BCL2

family members, and signaling to caspase-dependent apoptosis.

Mol Cancer Ther 9(5):1274–1285

48. Li W, Lewis-Antes A, Huang J, Balan M, Kotenko SV (2008)

Regulation of apoptosis by type III interferons. Cell Prolif

41(6):960–979

49. Komita H, Zhao X, Katakam AK, Kumar P, Kawabe M, Okada H

et al (2009) Conditional interleukin-12 gene therapy promotes

safe and effective antitumor immunity. Cancer Gene Ther

16(12):883–891

50. Huang FP, Chen YX, To CK (2011) Guiding the ‘‘misguided’’—

functional conditioning of dendritic cells for the DC-based

immunotherapy against tumours. Eur J Immunol 41(1):18–25

Apoptosis (2012) 17:691–701 701

123