Cell Reports, Volume 7

Supplemental Information

Growth of the Developing Cerebral Cortex

Is Controlled by MicroRNA-7 through the p53 Pathway

Andrew Pollock, Shan Bian, Chao Zhang, Zhengming Chen, and Tao Sun

Supplemental figures:

Figure S1. A miR-7 sponge system is able to block miR-7 function in vitro. Related to

Figure 1.

(A) A model in which miRNA sponges are able to sequester a specific endogenous miRNA away

from their endogenous targets, generating loss-of-function phenotypes.

(B) miR-7 sponge (7-sp), but not mutations of miR-7 sponge (M7-sp) and control scrambled

sponge (Scr-sp), was able to block silencing of the Luciferase due to miR-7 targeting effects.

Data are presented as mean ± SEM; n≥3; p values in relation to control (**: p < 0.01, ***: p <

0.001).

Figure S2. A sensor system to detect miR-9 function. Related to Figure 2.

(A) A scheme describing the two-color sensor plasmids assay for detection of miR-9 function.

(B) Electroporated cortical cells expressed eGFP, and nearly all cells expressed functioning miR-

9, preventing mRFP expression. Activation of miR-7 sponge (7-sp) could not block the function

of miR-9, compared to controls (Ctrl).

(C) There was no significant increase in the percentage of electroporated cells without miR-9

function.

Scale bars are labeled. Data are presented as mean ± SEM; n≥3 in all genotypes; p values in

relation to control (p > 0.7).

Figure S3. Expression of a scrambled miRNA sponge causes no changes in neuronal

production. Related to Figure 3.

(A-H) Scrambled sponge (Scr-sp) caused no change in the number of neurons labeled by Tbr1

(A,E), Ctip2 (B,F), Cux1 (C,G), and NeuN (D,H), compared to controls (Ctrl).

Scale bar = 100μM. Data are presented as mean ± SEM; n≥3 in all genotypes; p values in

relation to control (p > 0.48).

Figure S4. Radial glial cells (RGCs) are unaffected by scrambled sponge throughout

development. Related to Figure 4.

(A-C) Scrambled sponge (Scr-sp) expression did not affect the number of Ki67+ progenitors or

30 minute BrdU incorporation at E12.5, compared to controls (Ctrl).

(D) The cell cycle labeling index (LI) was also unchanged at E12.5.

(E,F) The number of cells expressing phospho-histone 3 was unchanged at E12.5.

(G,H) The number of RGCs expressing Pax6 was unchanged at E12.5.

(I-K) At E15.5, the number of Ki67+ cells and 30 minute BrdU incorporation were unchanged.

(L) The cell cycle LI was unchanged at E15.5.

(M,N) The number of cells expressing phospho-histone 3 was unchanged at E15.5.

(O,P) The number of RGCs expressing Pax6 was unchanged at E15.5.

Scale bar = 50μM. Data are presented as mean ± SEM; n≥3 in all genotypes; p values in relation

to control (p > 0.3).

Figure S5. Expression of Scrambled sponge (Scr-sp) causes no changes to intermediate

progenitors (IPs) in the subventricular zone (SVZ). Related to Figure 5.

(A,B) The number of Tbr2+ IPs in control (Ctrl) and Scr-sp cortices at E12.5 was unchanged.

(C) At E12.5, no significant TUNEL staining was seen due to scrambled sponge expression.

Tbr2 staining of an adjacent section is shown as a reference for the SVZ region and ventricular

zone (VZ).

(D,E) The number of Tbr2+ IPs remained unchanged at E15.5.

(F) At E15.5, no significant TUNEL staining for apoptotic cells was seen due to scrambled

sponge expression. Tbr2 staining of an adjacent section is shown as a reference for the SVZ

region.

Scale bar = 50μM. Data are presented as mean ± SEM; n≥3 in all genotypes; p values in relation

to control (p > 0.6).

Figure S6. Genes in the p53 pathway are targets for miR-7. Related to Figures 6 and 7.

(A) Signaling pathway analyses of the 162 genes upregulated by loss of miR-7 function in E12.5

7-sp cortex.

(B) Expression of genes of predicted miR-7 targets in the p53 pathway was increased by loss of

miR-7 function in miR-7 sponge mice (7-sp) compared to wild-type controls (WT). Increased

transcript abundance measured during total RNA sequencing is shown using sequencing reads

per kilobase of transcript/million reads (RPKM).

Data are presented as mean ± SEM; n≥3 in all genotypes; p values in relation to control (**: p <

0.01, ***: p < 0.001).

Table S1. Primers used for analyses.

Sponge generation oligos Forward miR-7 sponge Oligo

(98nt)

GCTAactagtACAACAAAATCAggGTCTTCCAgttatcACAACAAAATCAggGTCTTCCAgttat

cACAACAAAATCAggGTCTTCCAtctagaGATC

Reverse miR-7 sponge Oligo

(98nt)

GATCtctagaTGGAAGACccTGATTTTGTTGTgataacTGGAAGACccTGATTTTGTTGTgataa

cTGGAAGACccTGATTTTGTTGTactagtTAGC

Forward miR-7 sponge-MUT

target oligo (98nt)

GCTAactagtACAACAAAATCAggCTGTTGCAgttatcACAACAAAATCAggCTGTTGCAgttat

cACAACAAAATCAggCTGTTGCAtctagaGATC

Reverse miR-7 sponge-MUT

target oligo (98nt)

GATCtctagaTGCAACAGccTGATTTTGTTGTgataacTGCAACAGccTGATTTTGTTGTgataa

cTGCAACAGccTGATTTTGTTGTactagtTAGC

Forward Scrambled sponge

Oligo (95nt)

GCTAactagtGGAGCTCCACCGCGGTGGCATgttatcGGAGCTCCACCGCGGTGGCATgttatc

GGAGCTCCACCGCGGTGGCATtctagaGATC

Reverse Scrambled sponge Oligo

(95nt)

GATCtctagaATGCCACCGCGGTGGAGCTCCgataacATGCCACCGCGGTGGAGCTCCgataa

cATGCCACCGCGGTGGAGCTCCactagtTAGC

Forward miR-7 Sensor Binding

Sites

TAAgaattcTAACAACAAAATCACTAGTCTTCCAGGCGCGCCCACAACAAAATCACTA

GTCTTCCAGGCCGGgcggccgcAAT

Reverse miR-7 Sensor Binding

Sites

ATTgcggccgcCCGGCCTGGAAGACTAGTGATTTTGTTGTGGGCGCGCCTGGAAGACTA

GTGATTTTGTTGTTAgaattcTTA

Genotyping primers

Cre:

F 5'-TAAAGATATCTCACGTACTGACGGTG-3'

R 5'- TCTCTGACCAGAGTCATCCTTAGC-3' (product size: 350

bp)

Neo:

F 5’- CAGATCATCCTGATCGACAAG

R 5’- GACCTGCAGCCAATATGGGATC (product size: 497bp)

D2eGFP:

F 5’- TATATCATGGCCGACAAGCA

R 5’- ATCATCCTGCTCCTCCACCT (product size: 308bp)

RT-PCR primers

pri-miR-7a-1

F: 5’- ggtgaaaactgctgccaaa

R: 5’- tccacacagaactaggccaac

pri-miR-7a-2

F: 5’-tacaggagtgtccggctgat

R: 5’- caaaatcactagtcttccaaacg

pri-miR-7b

F: 5’- tgagtggggtttgttatgctc

R: 5’- acgtactccgctcctcgtc

u6

F: 5’- cgcttcggcagcacatatac

R: 5’- gtgtcatccttgcgcaggg

Cloning Primers

Pmaip1 595bp

F: 5'- AATtctagaGTTCTTCCAAAGCTTTTGCA

R: 5'- AATtctagaTTTGACTGGCACCTACTGACC

Ak1 757bp

F: 5'- TATtctagaAATTGCCAAGGAGGGTTAGG

R: 5'- GCCTGGCAGGTCTATACCAA

Klf4 922bp

F: 5'- CACtctagaAGTGGATGTGACCCACACTG

R: 5'- TGCAAAATACAAACTCCACAAAA

Ccng1 589bp

F: 5’- ATTtctagaTTTGTCAGAACTGCTGCTTCA

R: 5’-TGGTAGTTGGTTAGTTAACTTCTGTCC

P21 996bp

F: 5’- ATTtctagaCTCTTCTGCTGTGGGTCAGG

R: 5’-CTGGCTCCTTGTACAACTGCT

Pre-Mmu-miR-7a-1 F: 5’- gtgctcgagtcacttggggaatctaacttctaaata

R: 5’- ctcgcggccgcgttaatagacagtagtagtgcagggt

Pre-Mmu-miR-7a-2 F: 5’- aatctcgagactctagggaactgtatgagcaggg

R: 5’- agagcggccgcatcctgtcccctgtcccactctaga

Pre-Mmu-

miR-7b

F: 5’- cagctcgagaatgaatcttgcctgtgtctcagggg

R: 5’- aaggcggccgctgtgacccagggccctgaggttgtg

Mut-miR-7a-2 seed

mutation primer F: 5'-cgggccagccccgtttgcaacagtagtgattttgttgttgt

R: 5'-acaacaacaaaatcactactgttgcaaacggggctggcccg

Mut-miR-7a-2 opposite

seed mutation primer F: 5'-ccaacaacaagtcccactgtggcacatggtgctggtca

R: 5'-tgaccagcaccatgtgccacagtgggacttgttgttgg

Supplemental experimental procedures:

RNA sequencing and analysis

The dorsal cortices were dissected from three non-littermate wild-type and three non-

littermate miR-7 sponge E12.5 embryos and total RNA was extracted and purified using RNeasy

mini kit with optional on-column DNAse digestion (Qiagen). Whole RNA sequencing was

performed at the Weill Cornell Genomics Core Facility using an Illumina Hiseq 1000.

Sequencing results were analyzed using GobyWeb 1.7 (Dorff, 2012). ~14,000 genes had >1

reads per kB/million reads (RPKM) and were considered to be expressed. Upregulated genes

were genes with a fold change >1.25 and false discovery rate (FDR) q<0.25.

GO analysis was performed with Gorilla (Eden et al., 2007; Eden et al., 2009). miRNA

targeting predictions were compiled by miR-walk using predictions from miRwalk, Targetscan,

miRanda, miRDB and RNA22 (Betel et al., 2010; Betel et al., 2008; Dweep et al., 2011; Enright

et al., 2003; Friedman et al., 2009; Garcia et al., 2011; Grimson et al., 2007; John et al., 2004;

Lewis et al., 2005; Miranda et al., 2006; Wang, 2008; Wang and El Naqa, 2008).

Tissue preparation and immunohistochemistry

Mouse brains were fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline

(PBS) overnight at 4°C, then incubated in 30% sucrose in PBS overnight at 4°C, embedded in

OCT and stored at –80°C until use. Brains were sectioned (14 µm) using a cryostat. For antigen

recovery, sections were incubated in heated (95-100°C) antigen recovery solution (1 mM EDTA,

5 mM Tris, pH 8.0) for 20 minutes, and cooled down for 20-30 minutes. Before applying

antibodies, sections were blocked in 10% normal goat serum (NGS) in PBS with 0.1% Tween-20

(PBT) for 1 hour. Sections were incubated with primary antibodies at 4°C overnight and

visualized using goat anti-rabbit IgG–Alexa-Fluor-488, goat anti-chicken IgG-Alexa-Fluor-488,

and/or goat anti-mouse or anti-rabbit IgG–Alexa-Fluor-546 (1:300, Molecular Probes) for 1.5

hours at room temperature. Images were captured using a Leica digital camera under a

fluorescent microscope (Leica DMI6000B) or a Zeiss LSM510 confocal microscope.

Primary antibodies against the following antigens were used: phospho-histone H3 (PH3)

(1:1000, Upstate), bromodeoxyuridine (BrdU) (1:50, DSHB), Ki67 (1:500, Abcam), Pax6

(1:500, Covance), Pax6 (1:15 DSHB), Tbr1 (1:500, Abcam), Tbr2 (1:500, Abcam), activated

Caspase 3 (1:1000 R&D), NeuN (1:300, Chemicon), Ctip2 (1:1000 Abcam) and Cux1 (1:200,

Santa Cruz).

Cell counting in the mouse cortical tissue was performed on a fixed width representative

column of the cortical wall. All sections analyzed were selected from a similar medial point on

the anterior-posterior axis in the cortex.

Quantitative Real-time reverse transcription PCR (qRT-PCR)

Total RNA was isolated from the dorsal cortex of E15.5 mice using RNeasy® Mini kit

(Qiagen) according to manufacturer’s instructions, and all samples were treated with DNase to

remove genomic DNA. Reverse transcription was performed using Random Hexamer primer

(Roche). The qRT-PCR was performed using Power SYBR® Green PCR Master Mix (Life

Science) on an Mx4000™ Multiplex Quantitative PCR System (Stratagene) according to

manufacturer’s instructions. The RT primers to detect primary transcripts for miR-7a-1, miR-7a-

2, and miR-7b, as well as the inner control U6 are in Table S1.

Cell cycle labeling index (LI)

Timed-pregnant female mice were injected intraperitoneally (i.p.) with a single pulse of

5-bromodeoxyuridine (BrdU, 50 μg/g body weight) 30 minutes before tissue collection and

followed with antibody staining against BrdU and one of Ki67, Pax6, or Tbr2 antigens. The LI

for each progenitor pool was calculated as the ratio of double-labeled BrdU+ and progenitor

marker+ cells versus total progenitor marker

+ cells in a column of the cortical wall.

TUNEL Assay

To identify apoptotic cells in the cortex, we performed a TUNEL assay using the Apop

Tag Fluorescein in situ Apoptosis detection kit (Chemicon) on 14 µm frozen sections. After

permeabilization with acetic acid and ethanol as per the manufacturer’s instructions, slides were

immunostained as outlined above. After completion of antibody staining, the remaining

instructions for TUNEL staining were followed.

miR-7 in situ hybridization

in situ hybridization for miRNA expression was performed on frozen sections according

to previously published methods with modifications using locked nucleic acid (LNA) probes

(Obernosterer et al., 2007). Briefly, after fixation with 4% paraformaldehyde (PFA), acetylation

with acetylation buffer (13.33% Triethanolamine, 2.5% Acetic anhydride, 20 mM HCl),

treatment with proteinase K (10 mg/ml, IBI Scientific) and pre-hybridization (1×SSC, 50%

Formamide, 0.1 mg/ml Salmon Sperm DNA Solution, 1×Denhart, 5 mM EDTA, pH7.5), brain

sections were hybridized with DIG-labeled LNA probes at Tm-22ºC (49ºC for LNA-7a)

overnight. After washing with pre-cooled wash buffer (1×SSC, 50% Formamide, 0.1% Tween-

20) and 1×MABT, sections were blocked with blocking buffer (1x MABT, 2% Blocking

solution, 20% heat-inactived sheep serum) and incubated with anti-DIG antibody (1:1,500,

Roche) at 4°C overnight. Brain sections were washed with 1×MABT and Staining buffer (0.1 M

NaCl, 50 mM MgCl2, 0.1 M Tris-HCl, pH9.5), stained with BM purple (Roche) at room

temperature until ideal intensity was reached. The miR-7a LNA probes (Exiqon) were 3’ and 5’

end labeled with DIG–ddUTP.

In utero electroporation

In utero electroporation was performed as described (Saito, 2006). Briefly,

electroporation was conducted at E13.5 and the brain tissues were harvested 24 or 48 hr later.

Plasmid DNA was prepared using the EndoFree Plasmid Maxi Kit (QIAGEN) according to

manufacturer’s instructions, and diluted to 2 μg/μl. DNA solution was injected into the lateral

ventricle of the cerebral cortex, and electroporated with five 50-ms pulses at 35V using an

ECM830 electrosquareporator (BTX). Target site blocker oligos were electroporated in a

solution containing 2 μg/μl pCAGIG plasmid and 50 μM oligo.

Electroporation constructs

Sensor constructs were used as described (De Pietri Tonelli et al., 2006). Oligos including

two miR-7 binding sites of similar design were synthesized and subcloned into the 3’UTR of

mRFP in the sensor construct. miR-9 sensor construct was used as described (De Pietri Tonelli et

al., 2006). Moreover, fully sequenced mouse cDNA for Ak1 (clone 5346232) and Cdkn1a (p21)

(clone BC002043) were ordered and subcloned into the pCAGIG expression vector for

electroporation (Thermo/Open Biosystems).

To block miR-7 binding sites on Ak1 and p21 3’-UTRs, miRCURY LNA™ microRNA

protectors (Target Site Blockers, Exiqon) were used. The 3’-UTR sequences submitted for

blocker design were

Ak1-miR7: agggcaaccttaatccttctgcctccacttgtcttcctgtgtgctgagattacaggtgtgtgtgtgg

Ak1-ctrl: gctcaccagctggggccacgtggtcactgggtgccaaggagctgtgcaatgggcatacagctaggtg

p21-miR-7: ctcttctgctgtgggtcaggaggcctcttccccatcttcggccttagccctcactctgtgt

Cloning of constructs

Cloning of constructs was done by standard PCR based methods. cDNA from E15.5

C57Bl/6J mice was used to clone 3’UTR fragments, and miR-7 isoform precursors were cloned

into pGEM-T (Promega) using the primers in Table S1. 3’UTR fragments were subcloned into

pGL4.13 vector (Promega) while miR-7 precursors were subcloned into pCDNA3.1- for

expression. Non-functional mutant-miR-7a-2 was generated from the pre-miR-7a-2 construct

using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) using primers in

Table S1. Mutations were made at 3 bases within the seed sequence of the miRNA using the first

primer set, followed by 3 corresponding mutations on the opposite side of the hairpin using the

second primer set to preserve hairpin function. Pre-miR-17 pCDNA3.1- was used as previously

described (Otaegi et al., 2011).

Northern blot analysis

Total RNA was isolated from the dorsal cortex of wild-type mice using Trizol reagent

(Invitrogen) according to modified manufacturer’s instructions. Small RNAs were precipitated

by tripling the isopropanol and adding a 20 minute incubation at -80ºC before RNA precipitation.

Northern blot analysis was performed as described previously (Kawase-Koga et al., 2010).

Briefly, 12 μg of total RNA was loaded onto 13% denatured polyacrylamide gel, separated at

room temperature, and transferred onto nitrocellulose membrane using a semi-dry transfer

system overnight. After cross-linking for at least 4 hours at 80ºC, membrane was hybridized at

Tm-22ºC overnight using anti-sense oligo probes for miR-7a, and U6, which were 3’-end labeled

with digoxigenin (DIG)-ddUTP using DIG-3’-end labeling kit (Roche). After washing and

blocking, anti-DIG antibody (Roche) was applied for 1 hour, washed again in MABT and

staining buffer (100mM Tris HCl pH9.5, 100mM NaCl) and signals were detected using the

CDP-star chemiluminescent substrate (Roche).

Luciferase assays

Neuro2a cells were transfected using Lipofectamine 2000 (Invitrogen) using the

manufacturer’s protocol. Plasmids were quantified by UV spectrophotometry and used for

transfection in a 2:1 ratio (miRNA: target luciferase constructs); 8:2:1 ratio

(sponge:miRNA:target luciferase constructs). pGL4.13 firefly luciferase (Promega) was used for

3’UTRs of targets. pGL4.73 renilla luciferase (Promega) was used as a transfection control.

Luciferase was measured using the Dual-Luciferase Reporter Assay kit (Promega) using the

manufacturer’s protocol and read on a Victor3 1420 multilabel counter (Perkin Elmer). All

conditions were run in triplicate, and all experiments were repeated at least once with similar

results. Raw results for each condition were normalized for transfection efficiency as the ratio of

Firefly luciferase to Renilla luciferase, normalized to the corresponding empty pGL4.13 column

to correct for DNA quantification errors, and finally for each luciferase tested, the empty vector

control experiment was set to 1 for display.

Pathway and function enrichment analysis

Mosaic version 1.1 was used to retrieve the KEGG pathway and Gene Ontology (GO)

information for all genes of the mouse genome (Zhang et al., 2012). The enrichment analyses of

biological process annotations and KEGG pathways were conducted by the ‘Node-based’

algorithm of NOA version 1.1 and DAVID version 6.7 respectively (Huang et al., 2008; Zhang

et al., 2013). All tests were based on 162 unregulated genes. In order to control the type I error

rate of multiple hypotheses testing, Benjianmini & Hochberg method was employed to adjust p-

values by using 0.05 as the level of significance, so any test was considered statistically

significant with p<0.05.

Figure 6E shows the list of enriched KEGG pathways ranked according to un-adjusted p-

value. The top four pathways in the list are still statistically significant if only considering

adjusted p-value, including p53 signaling pathway.

Large-scale literature mining

Multiples searches of the scientific literature were performed to identify known

associations between TRP53 and 162 upregulated predicted miR-7 targets. A Cytoscape plugin,

the Agilent Literature Search Software version 2.8

(http://www.agilent.com/labs/research/litsearch.html) was employed to extract the interactions

based on the PubMed information source. Out of the above searching results, 19 genes had been

manually curated to interact with TRP53 (p53). According to the GO annotations of the above

genes, most of them involved the following functions: cell cycle arrest, cell death and cell

differentiation.

Supplemental references:

Betel, D., Koppal, A., Agius, P., Sander, C., and Leslie , C. (2010). Comprehensive modeling of

microRNA targets predicts functional non-conserved and non-canonical sites. Genome Biology

11, R90.

Betel, D., Wilson, M., Gabow, A., Marks, D. S., and Sander, C. (2008). The microRNA.org

resource: targets and expression. Nucleic Acids Research 36, D149-D153.

De Pietri Tonelli, D., Calegari, F., Fei, J.-F., Nomura, T., Osumi, N., Heisenberg, C.-P., and

Huttner, W. (2006). Single-cell detection of microRNAs in developing vertebrate embryos after

acute administration of a dual-fluorescence reporter/sensor plasmid. BioTechniques 41, 727-732.

Dorff, K. C. C., Nyasha; Zeno, Zachary; Shaknovich, Rita; Campagne, Fabien (2012).

GobyWeb: simplified management and analysis of gene expression and DNA methylation

sequencing data. ARXIV eprint arXiv:1211.6666.

Dweep, H., Sticht, C., Pandey, P., and Gretz, N. (2011). miRWalk – Database: Prediction of

possible miRNA binding sites by “walking” the genes of three genomes. Journal of Biomedical

Informatics 44, 839-847.

Eden, E., Lipson, D., Yogev, S., and Yakhini, Z. (2007). Discovering Motifs in Ranked Lists of

DNA Sequences. PLoS Comput Biol 3, e39.

Eden, E., Navon, R., Steinfeld, I., Lipson, D., and Yakhini, Z. (2009). GOrilla: a tool for

discovery and visualization of enriched GO terms in ranked gene lists. BMC Bioinformatics 10,

48.

Enright, A., John, B., Gaul, U., Tuschl, T., Sander, C., and Marks, D. (2003). MicroRNA targets

in Drosophila. Genome Biology 5, R1.

Friedman, R. C., Farh, K. K.-H., Burge, C. B., and Bartel, D. P. (2009). Most mammalian

mRNAs are conserved targets of microRNAs. Genome Research 19, 92-105.

Garcia, D. M., Baek, D., Shin, C., Bell, G. W., Grimson, A., and Bartel, D. P. (2011). Weak

seed-pairing stability and high target-site abundance decrease the proficiency of lsy-6 and other

microRNAs. Nat Struct Mol Biol 18, 1139-1146.

Grimson, A., Farh, K. K.-H., Johnston, W. K., Garrett-Engele, P., Lim, L. P., and Bartel, D. P.

(2007). MicroRNA Targeting Specificity in Mammals: Determinants beyond Seed Pairing.

Molecular Cell 27, 91-105.

Huang, D. W., Sherman, B. T., and Lempicki, R. A. (2008). Systematic and integrative analysis

of large gene lists using DAVID bioinformatics resources. Nat Protocols 4, 44-57.

John, B., Enright, A. J., Aravin, A., Tuschl, T., Sander, C., and Marks, D. S. (2004). Human

MicroRNA Targets. PLoS Biol 2, e363.

Kawase-Koga, Y., Low, R., Otaegi, G., Pollock, A., Deng, H., Eisenhaber, F., Maurer-Stroh, S.,

and Sun, T. (2010). RNAase-III enzyme Dicer maintains signaling pathways for differentiation

and survival in mouse cortical neural stem cells. Journal of Cell Science 123, 586-594.

Lewis, B. P., Burge, C. B., and Bartel, D. P. (2005). Conserved Seed Pairing, Often Flanked by

Adenosines, Indicates that Thousands of Human Genes are MicroRNA Targets. Cell 120, 15-20.

Miranda, K. C., Huynh, T., Tay, Y., Ang, Y.-S., Tam, W.-L., Thomson, A. M., Lim, B., and

Rigoutsos, I. (2006). A Pattern-Based Method for the Identification of MicroRNA Binding Sites

and Their Corresponding Heteroduplexes. Cell 126, 1203-1217.

Obernosterer, G., Martinez, J., and Alenius, M. (2007). Locked nucleic acid-based in situ

detection of microRNAs in mouse tissue sections. Nat Protocols 2, 1508-1514.

Otaegi, G., Pollock, A., Hong, J., and Sun, T. (2011). MicroRNA miR-9 Modifies Motor Neuron

Columns by a Tuning Regulation of FoxP1 Levels in Developing Spinal Cords. Journal of

Neuroscience 31, 809-818.

Saito, T. (2006). In vivo electroporation in the embryonic mouse central nervous system. Nature

Protocols 1, 1552-1558.

Wang, X. (2008). miRDB: A microRNA target prediction and functional annotation database

with a wiki interface. Rna 14, 1012-1017.

Wang, X., and El Naqa, I. M. (2008). Prediction of both conserved and nonconserved microRNA

targets in animals. Bioinformatics 24, 325-332.

Zhang, C., Hanspers, K., Kuchinsky, A., Salomonis, N., Xu, D., and Pico, A. R. (2012). Mosaic:

making biological sense of complex networks. Bioinformatics 28, 1943-1944.

Zhang, C., Wang, J., Hanspers, K., Xu, D., Chen, L., and Pico, A. R. (2013). NOA: a cytoscape

plugin for network ontology analysis. Bioinformatics.