SAR and ISR - Iowa State Universityswhitham/WWW/plp692/1017_sar_ISR...PR (Pathogenesis-Related)...

SAR and ISR

SA Biosynthesis

Walley et al, COPB 2013

18:1 & 8:2 & 18:3

Membrane Lipids

Lipase

Lipoxygenase

Hydroperoxy Fatty Acids

AOS

AOC

12-OPDA

12-OPDA Reductase

OPC-8:0

OPC-8:0-CoA Ligase

OPC-8:0-CoA

β-oxidation x3

JA

JA-Amino Acid Synthetase

JA-Ile

Azelaic Acid

RES

Non-Enzymatic

Reaction(s)

Non-Enzymatic

Reaction(s)

Plastid

Peroxisome

Cytosol

HPL

cis-3-Hexenal

cis-3-Hexenol

cis-3-Hexenyl

Acetate

trans-2-Hexenal

Oxylipin Biosynthesis Overview

Walley et al, PLoS Path 08

SA-JA Crosstalk

Systemic acquired resistance (SAR)

Background on SAR

Molecular changes associated with SAR

Role of SA and other signaling molecules

Role of NPR1 (non-expresser of pathogenesis related genes 1)

Roles of TGA and WRKY transcription factors

Role of chromatin modification in SAR

What do we know about SAR?

Systemic acquired resistance

Baker et al. 1997. Science. 276:726

Systemic acquired resistance

Systemic acquired resistance was first recognized as a significant phenomenon in the early 1900s.

At that time, it was recognized that infection of plants with “necrotizing” pathogens (causing HR)

often results in enhanced resistance to subsequent infections by a variety of fungal, bacterial and

viral pathogens. This physiological immunity was termed systemic acquired resistance (SAR).

SAR confers a broad spectrum type of resistance

SAR is effective against some but not all pathogens:

Tobacco: Phytophthora parasitica, Cercospora nicotianae, Peronospora tabacina

Tobacco mosaic virus, Tobacco necrosis virus,

Pseudomonas syringae pv. tabaci, Erwinia carotovora

Not effective against: Botrytis cinerea or Alternaria alternata

Arabidopsis: Phytophthora parasitica

Turnip crinkle virus

Pseudomonas syringae pv. tomato DC3000

Systemic acquired resistance was associated with the coordinated induction of a set of SAR genes

encoding proteins known as Pathogenesis-related (PR) proteins (Van Loon and Gianinazzi (early 1970s).

(1979) White found that acetyl salicylic acid application sufficient to induce PR gene expression

and enhanced resistance to tobacco mosaic virus in tobacco plant. Discovery came out the

interest in developing chemical control methods for viral infection. After that several groups went

on to show that salicylic acid application on tobacco leaves mimics pathogen induced expression

of PR genes and pathogen resistance in treated tissues.

(1990) Two groups one led by Klessig and Raskin and another led by Metraux

found that salicylic acid accumulates in cucumber and tobacco plants prior to pathogen infection, but

before the onset of resistance.

The work by these and many others led to the hypothesis that salicylic acid (SA) is the endogenous

signal molecule that is required for the induction of systemic acquired resistance.

(1993/1994) The group headed by Ryals made tobacco plants that could not accumulate SA and found

that these plants were defective in their ability to develop systemic acquired resistance.

This work demonstrated a central role for SA in establishing systemic acquired resistance.

The group also demonstrated that these tobacco plants were defective in their ability to

accumulate PR proteins.

(1997) Cloning of NPR1, a key regulator of SAR

Some key events in understanding regulation of SAR

PR (Pathogenesis-Related) proteins

Proteins secreted predominantly into intercellular

spaces in response to wounding or infection.

Soluble at pH 3

Basic homologs also found (in vacuole).

Proteinase resistant (but not proteinase inhibitors).

Some are developmentally expressed as part of

normal plant development in absence of wound or

infection (e.g. flowering).

PR proteins first identified as major proteins induced by necrotizing pathogens

(pathogens that induced the hypersensitive response)

Acidic gel Basic gel

Tobacco

PR proteins

PR proteins

Proteins first isolated

from apoplast of

TMV-infected

tobacco.

Induced by many

other pathogens.

Some PR proteins

are also induced by

abiotic stresses.

Traditional

PR protein gels

old

no

me

ncla

ture

PR genes induced after HR or SA treatment

What do PR proteins do?

Sels et al. (2008) Plant Physiol. Biochem. 46:941-950

Also van Loon et al. (2006) Annu. Rev. Phytopathol. 44:135-162

Constitutive expression of chitinase PR protein confers

resistance to Rhizoctonia solani

Brogue et al. (1991) Science 254, 1194-1196

Control Line 373

230238329373

548

18 days after growth in R. solani-laden sand 11 d.a.g. in R. solani sand

Application of salicylic acid mimics SAR

(1979) White found that the application of aspirin, salicylic acid, and benzoic acid

resulted in enhanced resistance to TMV. Used 3 tobacco cultivars that contained

the N resistance gene that confers HR to TMV. Found > 90% reduction in lesion

number in treated leaves versus water control.

Lesi

ons

obta

ined a

fter

second inocula

tion

SA

SA accumulation is associated with acquisition of resistance

Science (1993) 261, 754-756.

Central role of SA in SAR

PR-1

PR-2

PR-3

PR-1 mRNA

Central role for SA in defense continued

Enhanced susceptibility

Loss of resistance

INA induces resistance

in presence of nahG

Mobile inducers of SAR

Kachroo. 2013. Curr. Opin. Plant Biol. 16:527

What is the mobile systemic signal(s) for SAR?

Methylsalicylate – meSA

SABP2 (meSA esterase) is required for SAR

S = silenced SABP2

Park et al. Science 318:113-116



SAMT1 (SA methyltransferase) is required for SAR




meSA induces SAR in systemic tissues expressing SABP2 (MeSA esterase)


A role of glycerol-3-phosphate in SAR

Reduced SAR in gly1 and gli1 mutants G3P levels increase in response to pathogen

in local and systemic tissues

Chanda et al. (2011) Nat. Genet. 43:421-427

Exogenous G3P restores SAR in gli1 and gly1 plants

A role of glycerol-3-phosphate in SAR


G3P conferred SAR is dependent on DIR1

DIR1 is a proposed lipid transporter protein


DIR1 is needed for G3P transport

Azeleic acid

Model for azeleic acid induced systemic acquired resistance

Yu et al. 2013. Cell Rep. 3:1266

Abietaine diterpenoid, dehydroabietinal (DA)

Chaturvedi et al. 2012. Plant J. 71:161

ROS function early in SAR signaling

Wendehenne et al. 2014. Curr. Opin. Plant Biol. 20:127

Interactions between SAR signals

Wendehenne et al. 2014. Curr. Opin. Plant Biol. 20:127

Signaling steps between SA and PR protein expression

and disease resistance.

The Arabidopsis NPR1 Gene That Controls

Systemic Acquired Resistance Encodes

a Novel Protein Containing Ankyrin RepeatsHui Cao, Jane Glazebrook, Joseph D. Clarke,

Sigrid Volko, and Xinnian Dong (1997) Cell 88, 57–63,

Previously: Linked a PR protein promoter called BGL2 to GUS.

Screened thousands of mutant transgenic BGL2-GUS plants for

ABSENCE of GUS activity induced by SA treatment.

Using standard Arabidopsis genetic mapping methods, identified a

single mutant gene, npr1. Phenotype:

Complete absence of GUS activity in response to SA

Absence of PR-1, PR-5, BGL2 expression in response to SA

Is now susceptible to Peronospora parasitica and to

Pseudomonas syringae pv maculicola (Psm).

Cao et al. (1997) Cell 88, 57–63,

Cloned NPR1 by standard

1990’s methods.

Chromosome walking,

YAC library…

Proof of cloning by

transgenic comple-

mentation of mutants

w/ wildtype NPR1.

wt

nonenon-compl. NPR1

npr1-2

NPR1

genotype:

transgene: none

wt npr1-1 npr1-1 +

NPR1P

sm

inocula

ted

GU

Ssym

pto

ms

Cao et al. (1997) Cell 88, 57–63,

Cao et al. (1997) Cell 88, 57–63,

NPR1 has ankyrin repeats

Ankyrin repeats are

in lots of different

proteins.

Involved in protein-

protein interactions.

Especially in proteins

that control trans-

cription.

In NF-kB and I-kB in

mammals. Induced

by many pathogens,

stresses…

NPR1 is reduced to a monomer during plant defense

Mou et al., (2003) Cell, 113:935–944

Expression of PR-1 is associated with NPR1 monomerization

Mou et al., (2003) Cell, 113:935–944

Monomeric NPR1 localizes to the nucleus

Mou et al., (2003) Cell, 113:935–944

Zhou et al. (2000) MPMI 13:191–202

NPR1 interacts with TGA transcription factors in yeast two-hybrid assays

TGA transcription factors bind to TGACG sequences found in the promoter of genes

such as PR-1

NPR1 enhances TGA1 binding to the as-1 element under

reducing conditions

Despres et al. (2003) Plant Cell. 15:2181–2191,

Recognize the motif: (T)(T)TGAC(C/T).

Have the conserved WRKYGQK at N-terminal end.

Have a novel zinc-finger-like motif.

Bind DNA via divalent cation (probably zinc).

Approx. 100 members of WRKY family in Arabidopsis.

NPR1 has 3 WRKY motifs in its promoter:

TTGACTTGACTTGGCTCTGCTCGTCAA

WRKY transcription factors: another key group of transcription

factors that regulate plant defense responses

The WRKY superfamily of plant transcription factors

Thomas Eulgem, Paul J. Rushton, Silke Robatzek and Imre E. Somssich

(2000) Trends Plant Sci 5, 199-205.

Conserved amino acids

in WRKY proteins of

Arabidopsis (red).

Putative Zn-finger ligands

are highlighted in black.

Eulgem et al. (2000) TIPS 5, 199-205.

Wang et al. (2006) PLoS Pathogens 2:1042-1050

Identification of direct transcriptional targets of NPR1

WRKY54, WRKY38, WRKY59, WRKY18, WRKY70, WRKY66, and WRKY53

are induced directly by NPR1.

Evidence that WRKY58 negatively regulates plant defense


WRKY70 and 54 negatively

regulate SA biosynthesis and

positively regulate SAR


Identification and Cloning of a Negative Regulator

of Systemic Acquired Resistance, SNI1,

through a Screen for Suppressors of npr1-1Xin Li, Yuelin Zhang, Joseph D. Clarke, Yan Li,†

and Xinnian Dong* Cell, 98, 329–339, 1999.

Screened for EMS mutants of npr1-1 plants containing BGL2-GUS

reporter.

Look for plants that turn blue in response to INA (SA analog)

like NPR1 wild type plants.

But which, of course still harbor the npr1-1 mutation.

Found 11 loci that gave increased GUS, out of 7000 plants screened.

Li et al., Cell 98, 329–339.

Li et al., Cell 98, 329–339.

SNI1 is similar to mouse Retinoblastoma (Rb). Rb is a tumor suppressor

that represses function of E2F transcription factor

Li et al., Cell 98, 329–339.

93-95% of genes upregulated in sni1 mutants are induced by BTH

SNI1 represses transcription in yeast

Mosher et al. (2006) Plant Cell, 18:1750–1765

sni1 mutation alters gene expression – most genes also induced by BTH

Chromatin modifications at the PR-1 promoter in sni1 mutants

Mosher et al. (2006) Plant Cell, 18:1750–1765

Model for signal transduction in SAR

Fu. 2013. Annu. Rev. Plant Biol. 64:839

Induced Systemic Resistance

(ISR)

- Plant responses to plant growth promoting rhizobacteria

- Herbivore induced resistance

Pieterse et al. (2014) Annu. Rev. Phytopathol. 52:347-75

Biologically induced systemic resistance

Root colonization by beneficial soil bacteria


Plant growth-promoting effects of P. fluorescens WCS417r


Systemic protection against Cucumber mosaic virus

Kloepper. 2004. Phytopathology. 94:1259-1266

Bacillus pumulis strain SE34Nonbacterized

P. fluorescens WCS417r and iron deficiency induce MYB72


Properties of PGPR

- Stimulate growth

• N fixation

• Increase solubility of limiting nutrients (siderophores)

• Stimulate nutrient delivery and uptake

• Production of phytohormones

• Modulation of plant development (e.g. reduce ethylene

enhances root growth)

- Plant-mediated disease suppression

• Non-pathogens antagonize pathogens (competition,

antibiotics, lytic enzymes)

• Activating plant to better defend itself (ISR)

• Induced resistance observed on spatially separated

parts of same plant

The nature of systemically induced resistance in plants

(A) Characteristics of induced systemic resistance

• The defensive capacity of the plant is enhanced through microbial stimulation or

similar stresses

• The enhanced defensive capacity is expressed systemically throughout the

plant

• Induced systemic resistance is active against fungi, bacteria, viruses and,

sometimes, nematodes and insects

• Once induced, systemic resistance is maintained for prolonged periods

(B) Mechanisms of induced systemic resistance

• Developmental, escape: linked to growth promotion

• Physiological, tolerance: reduced symptom expression

• Environmental: associated with microbial antagonism in the rhizosphere;

altered plant-insect interactions

• Biochemical, resistance: induction of cell wall reinforcement,

• Induction of phytoalexins

• Induction of pathogenesis-related proteins

• ‘Priming’ of defence responses (resistance)

From Van Loon (2007) Eur. J. Plant Pathol. 119:243-254

ISR potentiates plant defense responses

Fusarium wilt of carnation and radish

Biocontrol by P. fluorescens WCS358

• Iron competition important: sid- mutant not effective

Biocontrol by P. fluorescens WCS417

•Twice as effective

•Sid-mutant still 100% effective

•Worked when WCS417 and fusarium were spatially separated on the

plant*

•WCS417 did not trigger phytoalexin accumulation*

•WCS417 treated plants produced more phytoalexin in response to

Fusarium*

*Van Peer et al (1991) Phytopathol 81:728-734

Root rot in beanAccelerated and potentiated papilla formation

Plant-mediated*, broad-spectrum resistance response that is

activated by selected strains of saprophytic rhizosphere

bacteria. Many are PGPR. PGPR colonization non-specific;

ability to induce SR has some specificity. * Inducing bacteria and

pathogen can be spatially isolated

• ISR potentiates plant defense responses

• ISR is SA-independent

• ISR is independent of PR gene activation

• ISR requires JA and C2H4 response pathways

• ISR not associated with JA- and C2H4-responsive gene

activation

• ISR primes plant for enhanced C2H4 production?

• Summary: compare and contrast ISR and SAR

• Not covered in class:

1) bacterial determinants of ISR

2) field application of ISR

Summary of ISR molecular properties


Changes in gene expression in bacterized plants

Specificity in ISR induction by Pseudomonas spp. strains


Root colonization is similar in all cases

Model system – Arabidopsis/Pseudomonas fluorescens WCS417r

For Ps

Control

WCS417r

ISR is SA-independent

Pieterse et al. (1996) Plant Cell 8, 1225-1237

Fusarium

P. syringae

–

W

–

W

ISR is independent of PR gene activation

Pieterse et al. (1996) Plant Cell 8, 1225-1237 *just prior to challenge inoc

ISR requires JA and C2H4 response pathways


ISR requires JA and C2H4 response pathways

in that order


ISR not associated with JA- and C2H4-responsive gene

activation


But expression of this (and

not others) is potentiated in

plants undergoing ISR Van Wees et al. (1999) Plant Mol Biol

41:537-549

So ISR is associated with

potentiation of a specific

set of JA-responsive

genes?

Also, increased sensitivity

rather than increased

production of JA and

C2H4(see also Pieterse et al. 2000 Physiol.

Mol. Plant Pathol. 57:123-134)

ISR primes plant for enhanced C2H4 production?

ISR plants do not show increased levels of C2H4, or JA,

but

ISR activated plants convert more ACC to C2H4

MYC2 transcription factor involved in priming induced systemic resistance

Pozo. 2008. New Phytol. 180:511-523

Model for herbivore induced resistance in Arabidopsis

Vos. 2013. Front. Plant Sci. 4:539

Comparison of SAR, HIR, and ISR mechanisms


Discussion

1) why is it important to study ISR?

2) do differences between ISR, HIR, SAR matter?

3) selective advantage to the plant and practical

significance?

4) what role does root microbiome play in immunity

5) how might ISR be triggered?

Herbivore induce resistance

Differential JA responses in Col-0 and jin1 plants in local and systemic leaves


Production of JA, JA-Ile, OPDA, and ABA in local and systemic Col-0 leaves


Effects of P. rapae and ABA on MYC and VSP1 expression


Effect of herbivory on P. rapae performance in Col-0, aba2-1, and coi1-1 plants


SAR and ISR - Iowa State Universityswhitham/WWW/plp692/1017_sar_ISR...PR (Pathogenesis-Related)...

Documents

Transcript of SAR and ISR - Iowa State Universityswhitham/WWW/plp692/1017_sar_ISR...PR (Pathogenesis-Related)...