of May 10, 2018.This information is current as

γProtein in Response to IFN-Expression and Release of IL-18 Binding

Stefan Zeuzem, Josef Pfeilschifter and Heiko MühlGarkisch, Heiko Kämpfer, Stefan Frank, Jochen Raedle, Jens Paulukat, Markus Bosmann, Marcel Nold, Stefanie

http://www.jimmunol.org/content/167/12/7038doi: 10.4049/jimmunol.167.12.7038

2001; 167:7038-7043; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/167/12/7038.full#ref-list-1

, 18 of which you can access for free at: cites 41 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2001 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on May 10, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on May 10, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Expression and Release of IL-18 Binding Protein in Responseto IFN-�1

Jens Paulukat,* Markus Bosmann,2* Marcel Nold, 2* Stefanie Garkisch,* Heiko Kampfer,*Stefan Frank,* Jochen Raedle,† Stefan Zeuzem,† Josef Pfeilschifter,* and Heiko Muhl3*

IL-18 and IL-18 binding protein (IL-18BP) are two newly described opponents in the cytokine network. Local concentrations ofthese two players may determine biological functions of IL-18 in the context of inflammation, infection, and cancer. As IL-18appears to be involved in the pathogenesis of Crohn’s disease and may modulate tumor growth, we investigated the IL-18/IL-18BPa system in the human colon carcinoma/epithelial cell line DLD-1. In this study, we report that IFN-� induces expression andrelease of IL-18BPa from DLD-1 cells. mRNA induction and secretion of IL-18BPa immunoreactivity were associated with anactivity that significantly impaired release of IFN-� by IL-12/IL-18-stimulated PBMC. Inducibility of IL-18BPa by IFN- � was alsoobserved in LoVo, Caco-2, and HCT116 human colon carcinoma cell lines and in the human keratinocyte cell line HaCaT.Induction of IL-18BPa in colon carcinoma/epithelial cell lines was suppressed by coincubation with sodium butyrate. IFN-�-mediated IL-18BPa and its suppression by sodium butyrate were confirmed in organ cultures of intestinal colonic biopsy speci-mens. In contrast, sodium butyrate did not modulate expression of IL-18. The present data suggest that IFN-� may limit biologicalfunctions of IL-18 at sites of colonic immune activation by inducing IL-18BPa production. Down-regulation of IL-18BPa bysodium butyrate suggests that reinforcement of local IL-18 activity may contribute to actions of this short-chain fatty acid in thecolonic microenvironment. The Journal of Immunology, 2001, 167: 7038–7043.

I nterleukin-18 has been introduced as a novel member of theIL-1 family of cytokines. As opposed to IL-1, IL-18 appearsto be a pivotal mediator of the Th1 cytokine response (1–3).

However, both cytokines also share a variety of functions such asinduction of inflammatory cytokines (4). Recent data imply thatIL-18, in the absence of IL-12, may also facilitate the developmentof Th2 responses (5). Biological activities of IL-1 are controlled byendogenous inhibitory proteins such as IL-1R antagonist or thetype II IL-1R (2). With the discovery of IL-18 binding proteins(IL-18BP)4 (6–9), functional equivalents of soluble type II IL-1Rshave been identified for the IL-18 system. Of the isolated isoformsof human IL-18BP, IL-18BPa and IL-18BPc are able to neutralizeIL-18 biological activity with high efficacy. IL-18BPa apparentlyis the most abundant splice variant in human cDNA libraries (6, 8).In mice, injection of human IL-18BPa inhibits LPS-induced cir-culating IFN-� by �90% (6). Serum levels of IL-18BP are up-regulated in patients with septic shock (10). The significance ofIL-18BP in pathophysiology is further underscored by the obser-vation that the poxvirus family of DNA viruses secretes activeviral forms of IL-18BP besides soluble receptors for IL-1�, IFNs,and certain chemokines (6, 11).

Colon epithelial cells have been identified as a potential sourceof IL-18, and expression of this cytokine is up-regulated inCrohn’s disease (12, 13). Interestingly, reduction of IL-18 bioac-tivity by neutralizing Abs is protective in murine experimentalcolitis (14). In addition, IL-18 appears to be modulated in colo-rectal cancer (15). In the present study, we investigated expressionof IL-18BPa in the colon carcinoma/epithelial cell line DLD-1.

Materials and MethodsMaterials

IFN-� and IL-18 were from PeproTech (Frankfurt, Germany). Brefeldin A(BFA), sodium butyrate, and actinomycin D were from Sigma (Deisenhofen,Germany). IL-12 was purchased from R&D Systems (Wiesbaden, Germany),and okadaic acid was from Calbiochem-Novabiochem (Bad Soden, Germany).

Cultivation of DLD-1, Caco-2, LoVo, HCT116, and HaCaT cells

Human DLD-1 (Center for Applied Microbiology and Research, Salisbury,U.K.), HCT116 (American Type Culture Collection, Manassas, VA),Caco-2 (German Collection of Microorganisms and Cell Cultures, Braun-schweig, Germany), colon carcinoma cells, and HaCaT keratinocytes (pro-vided by N. E. Fusenig, Deutsches Krebsforschungszentrum, Heidelberg,Germany) (16) were grown in DMEM supplemented with 100 U/ml pen-icillin, 100 �g/ml streptomycin, and 10% heat-inactivated FCS (Life Tech-nologies, Eggenstein, Germany). LoVo (American Type Culture Collec-tion) colon carcinoma cells were maintained in RPMI 1640 supplementedwith 100 U/ml penicillin, 100�g/ml streptomycin, and 10% heat-inacti-vated FCS (Life Technologies). For the experiments, cells on polystyreneplates (Greiner, Frickenhausen, Germany) were washed twice with PBSand incubated in the aforementioned DMEM medium without FCS. Cellviability was determined by a lactate dehydrogenase (LDH) activity assay,according to the manufacturer’s instructions (Roche Molecular Biochemi-cals, Mannheim, Germany). All cultures were incubated for the indicatedtime periods at 37°C in a humidified atmosphere containing 5% CO2.

Isolation and cultivation of PBMC

The study protocol and consent documents were approved by the EthikKommission of the Klinikum der Johann Wolfgang Goethe-Universita¨t(Frankfurt am Main, Germany). Informed consent was obtained from vol-unteers. Healthy donors abstained from using any drugs during the 2 wkbefore the study. PBMC were isolated as previously described (17). PBMC

*Pharmazentrum Frankfurt and†Second Department of Medicine, Klinikum der Jo-hann Wolfgang Goethe-Universitat, Frankfurt am Main, Germany

Received for publication July 19, 2001. Accepted for publication October 11, 2001.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby markedadvertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by the Riese-Stiftung and the Klein-Stiftung.2 M.B. and M.N. contributed equally to this work.3 Address correspondence and reprint requests to Dr. Heiko Muhl, PharmazentrumFrankfurt, Klinikum der Johann Wolfgang Goethe-Universitat Frankfurt am Main,Theodor-Stern-Kai 7, D-60590 Frankfurt am Main, Germany. E-mail address: H.Muehl@em.uni-frankfurt.de4 Abbreviations used in this paper: IL-18BP, IL-18 binding protein; BFA, brefeldin A;LDH, lactate dehydrogenase.

Copyright © 2001 by The American Association of Immunologists 0022-1767/01/$02.00

by guest on May 10, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

were resuspended in conditioned media from DLD-1 cell cultures supple-mented with 1% (v/v) heat-inactivated human AB serum (Sigma) andseeded at 2 � 106 cells/ml in round-bottom polypropylene tubes (Greiner).

IFN-� production by IL-12/IL-18-stimulated PBMC cultivated inDLD-1 cell-derived conditioned media

To investigate whether conditioned medium from IFN-�-stimulated DLD-1cells may contain IL-18BPa activity, the following experimental protocol wasperformed: DLD-1 cells were kept as unstimulated control, or were stimulatedwith IFN-� (20 ng/ml), with sodium butyrate alone (5 mM), or with IFN-�plus sodium butyrate for 14 h using DMEM medium (containing 10% FCS) toinduce expression of IL-18BPa. Thereafter, cultures were thoroughly washedthree times with PBS. After an additional 48-h incubation period in controlDMEM without FCS, cells were lysed for isolation of total RNA (see alsoscheme of experimental design in Fig. 6A). Cell-free culture supernatants wereeither TCA precipitated (for SDS-PAGE) or concentrated 5-fold using Ultra-free-4 Biomax 10K centrifugal filters (Millipore, Bedford, MA). Concentratedconditioned media were preincubated for 30 min without stimuli or with IL-12(20 ng/ml)/IL-18 (20 ng/ml) at 37°C. PBMC were then resuspended in theseconditioned media and, after an additional 24 h of incubation, IFN-� produc-tion was assessed by ELISA.

Cultures of colonic intestinal biopsy specimens

The study protocol and consent documents were approved by the EthikKommission of the Klinikum der Johann Wolfgang Goethe-Universitat.Informed consent was obtained from the donors. All patients required acolonoscopy for medical reasons. For the experiments, a macroscopicallynondiseased biopsy site was chosen. Cultivation was performed as recentlydescribed (18). Within a maximal lag of 0.5 h after biopsy, specimens werewashed carefully in PBS (Life Technologies). Thereafter, tissues wereplaced in 24-well tissue culture plates (Greiner) and maintained in DMEMwithout phenol red (Life Technologies; 1 ml/well) supplemented with 100U/ml penicillin, 100 �g/ml streptomycin (Life Technologies), and 1% (v/v)heat-inactivated human AB serum (Sigma). Stimuli were added and, afterthe indicated incubation periods, cells were harvested for RNA isolation.

Analysis of mRNA for IL-18BPa, IL-18, and GAPDH

Total RNA was isolated using TRIzol reagent according to the manufac-turer’s instructions (Life Technologies). One microgram of RNA was usedfor RT-PCR (GeneAmp RNA PCR kit, Amplitaq Gold; Perkin-Elmer,Weiterstadt, Germany), as described previously (19). Primers: IL-18BPa(forward), cctctactggctgggcaatgg; IL-18BPa (reverse), ttaaccctgctgctgtggac(annealing temperature, 58°C; number of cycles, 31); IL-18 (forward),accaagttctcttcattgacc; IL-18 (reverse), ttgcatcttattatcatgtcc (annealing temper-ature, 58°C; number of cycles, 30); GAPDH (forward), accacagtccatgccatcac;GAPDH (reverse), tccaccaccctgttgctgta (annealing temperature, 60°C; numberof cycles, 23 for DLD-1, 28 for organ cultures). Identity of PCR products(length: 295 bp for IL-18BPa; 293 bp for IL-18; 452 bp for GAPDH) wasconfirmed by sequencing (310 Genetic Analyzer; Perkin-Elmer). RNaseprotection assay was performed as previously described: 20 �g total RNAwas used. Human IL-18, IL-18BPa, and GAPDH probes were cloned byPCR. The cloned fragments correspond to nt 335–627 for IL-18, 457–644for IL-18BPa, and 148–302 for GAPDH (19, 20).

Detection of IL-18BPa and IL-18 by immunoblotting

Cell-free supernatants (5 ml/PS-10 plate) were TCA precipitated, as pre-viously described (20). Briefly, 1/10 vol of TCA was added to cell-freesupernatants. After 30 min at 0°C and a 30-min centrifugation step at13,000 � g, pellets were washed in acetone and resuspended in Laemmlibuffer. Unless otherwise indicated, TCA-precipitated proteins from 3.5 mlwere separated by 10% SDS-PAGE. After blotting, IL-18BPa was detected bya rabbit polyclonal antiserum (immunizing peptide, TQEALPSSHSSPQQQG;Eurogentec, Seraing, Belgium). For detection of intracellular IL-18 and IL-18BPa, cells were lysed in 300 mM NaCl, 50 mM TrisCl, pH 7.6, and 0.5%Triton X-100, supplemented with protease inhibitor mixture (Roche Mo-lecular Biochemicals). Protein (40 �g) and a 12% SDS-PAGE were usedfor analysis of IL-18 using rabbit polyclonal Abs (PeproTech). A total of100 �g protein was used for analysis of IL-18BPa.

Transient expression of human IL-18BPa in DLD-1 cells

DLD-1 cells cultivated on six-well plates in DMEM medium containing10% FCS were transiently transfected with pORF-hil18bpa (InvivoGen,San Diego, CA) using Fugene (Roche Diagnostics, Mannheim, Germany),according to the manufacturer’s instructions. A total of 3 �l Fugene and2.25 �g DNA was used per well. After 30 h, cells were washed with PBS

and incubated for 30 h in DMEM without FCS (2 ml/well). Supernatants(6 ml) were TCA precipitated and used in Fig. 2A.

Detection of cytokines by ELISA

Levels of IFN-� in cell-free culture supernatants of PBMC cultures weredetermined by ELISA according to the manufacturer’s instructions (BDPharMingen, Heidelberg, Germany).

Statistical analysis

Data are shown as mean � SD (experiments using DLD-1 cells), ormean � SEM (experiments using PBMC), and are presented as percentageof viability, as percentage of inhibition, or as picograms per milliliter. Datawere analyzed by unpaired Student’s t test on raw data using Sigma Plot(Jandel Scientific, San Rafael, CA).

ResultsIFN-� induces expression and release of IL-18BPa in the coloncarcinoma cell lines DLD-1 and Caco-2, as well as in HaCaTkeratinocytes

We recently reported on induction of IL-18BPa gene expression byIFN-� in human nonleukocytic cells (19). In the present study, wefocused on the colon carcinoma/epithelial cell line DLD-1 and soughtto extend the abovementioned observations by including the level ofIL-18BPa protein release and function. IFN-�-induced IL-18BPamRNA (Fig. 1A, lower panel) was paralleled by secretion of the cor-responding protein, as detected by immunoblotting analysis of TCA-precipitated cell culture supernatants (Fig. 1, A and B). IL-18BPa ap-peared as IFN-�-inducible immunoreactivity in the expectedmolecular mass range between 40 and 50 kDa (6, 8). This heteroge-neity in the molecular mass agrees with a high degree of glycosyla-tion, as has been reported (6). Strong immunoreactivity was observedwhen human IL-18BPa was transiently expressed in DLD-1 cells(Fig. 2A). In contrast, control transfection with empty vector did notresult in any immunoreactivity (data not shown). IL-18BPa immuno-reactivity induced by IFN-� consisted of two major bands. This wasparticularly evident when lower amounts of proteins were separatedon a 12% SDS-PAGE (Figs. 1A and 2B, lane 2). The doublet was alsoobserved when lower amounts of IL-18BPa transiently expressed inDLD-1 cells were subjected to SDS-PAGE (data not shown). Addi-tion of immunizing peptide to the antiserum impaired immunodetec-tion of IL-18BPa (Fig. 2C). No immunoreactivity was detectable

FIGURE 1. Time course and dose-response analysis of IFN-�-inducedIL-18BPa. A, DLD-1 cells were kept as controls or stimulated with IFN-�(20 ng/ml) for the indicated time periods. TCA-precipitated supernatantswere analyzed by immunoblotting. Lower panel, IL-18BPa mRNA wasevaluated by RT-PCR in these same experiments. One representative offour independently performed experiments is shown. B, DLD-1 cells werekept as controls or stimulated for 24 h with the indicated concentrations ofIFN-�. TCA-precipitated supernatants were analyzed by immunoblotting.Membranes were stained by Ponceau S (A and B).

7039The Journal of Immunology

by guest on May 10, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

when preimmune serum was used (data not shown). To exclude thateffects of IFN-� were due to endotoxin that is heat stable, IFN-� washeat inactivated by boiling (99°C, 30 min) before use. Immunoreac-tivity disappeared after heat inactivation of IFN-� (Fig. 2D). In addi-tion, LPS (10 �g/ml) did not induce IL-18BPa in DLD-1 cells (datanot shown). IL-18BP is synthesized with a 28-residue signal peptide,

and is supposed to be secreted via the endoplasmatic/Golgi pathway(6). Accordingly, BFA abrogated release of IL-18BPa (Fig. 2E).However, despite readily detectable immunoreactivity of IL-18BPa insupernatants of IFN-�-treated cells, we could not demonstrate intra-cellular IL-18BPa by immunoblotting when whole cell lysates wereanalyzed from IFN-�-treated cells (Fig. 2F) or from cells treated withIFN-�/BFA (data not shown). This discrepancy between cell lysatesand TCA-precipitated supernatants is likely to be due to the hugeenrichment factor immanent to the method of TCA precipitation.

There was no induction of cytotoxicity in IFN-�-treated cultures asexamined by determination of LDH activity in culture supernatants:viability was 98.3 � 0.4% vs 97.5 � 0.4% for control vs IFN-�-treated cells (20 ng/ml, 42 h, n � 3). Ponceau S staining of mem-branes after blotting revealed no differences in the total amounts ofproteins loaded onto the gels (Fig. 1, A and B). Moreover, inductionof cell death by okadaic acid did not result in release of immunore-activity, despite a 36.7% loss of cell viability (Fig. 2G). Altogether,these observations argue against IFN-�-induced cytotoxicity, withpassive release of cellular proteins as the driving force behind IL-18BPa immunoreactivity in TCA-precipitated supernatants.

To investigate whether IFN-�-induced secretion of IL-18BPa isrestricted to DLD-1 cells or is of more general relevance, experimentswere performed using additional colon carcinoma/epithelial cell lines.As shown in Fig. 3, IFN-�-induced IL-18BPa mRNA accumulation(A and B, left panel) was associated with secreted IL-18BPa immu-noreactivity (A and B, right panel) in the respective culture superna-tants of LoVo (A) and Caco-2 (B) colon carcinoma cells. Similar data

FIGURE 2. IL-18BPa immunoreactivity as detected using the poly-clonal antiserum. A, DLD-1 cells were transiently transfected with pORF-hil18bpa. TCA-precipitated supernatants of IFN-�-stimulated (20 ng/ml)cells were run in parallel. B, DLD-1 cells were stimulated with IFN-� (50ng/ml) for the indicated time periods. TCA-precipitated supernatants wereanalyzed by immunoblotting. Arrows indicate IL-18BPa immunoreactivity(lane 2). C, DLD-1 cells were kept as controls or stimulated with IFN-� (20ng/ml) for 24 h. TCA-precipitated supernatants were analyzed by immuno-blotting. One-half of the blot was stained with IL-18BPa antiserum, the otherwith IL-18BPa antiserum plus immunizing peptide (2.5 �g/ml). D, DLD-1cells were kept as controls, stimulated with IFN-� (20 ng/ml), or with IFN-�(20 ng/ml), which had been inactivated by boiling. After 42 h, TCA-precipitated supernatants were analyzed by immunoblotting. E, DLD-1 cellswere kept as controls, stimulated with IFN-� (20 ng/ml) alone, with BFA (1�g/ml), or with IFN-� (20 ng/ml)/BFA (1 �g/ml). After 24 h, TCA-precipitated supernatants were analyzed by immunoblotting. Similar resultswere obtained using BFA at 0.25 �g/ml (data not shown). F, DLD-1 cells werekept as controls or stimulated with IFN-� (20 ng/ml) for 24 h. TCA-precipitated supernatant proteins and whole cell lysates were prepared andanalyzed by immunoblotting. G, DLD-1 cells were kept as controls, stimulatedwith IFN-� (20 ng/ml), or exposed to okadaic acid (50 nM) for 68 h.TCA-precipitated supernatants were analyzed by immunoblotting. Cell viabil-ity was determined in these same experiments by LDH activity analysis.

FIGURE 3. IFN-�-induced IL-18BPa in LoVo and Caco-2 colon carci-noma cells, as well as in HaCaT keratinocytes. LoVo cells (A), Caco-2 cells(B), or HaCaT keratinocytes (C) were kept as unstimulated controls orincubated with IFN-� (20 ng/ml). After 24 h, IL-18BPa mRNA was eval-uated by RT-PCR (left panel), and TCA-precipitated supernatants wereanalyzed by immunoblotting (right panel). One representative of two in-dependently performed experiments is shown for each cell line.

7040 IFN-�-INDUCED IL-18BP RELEASE

by guest on May 10, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

were obtained using HCT116 colon carcinoma cells (data not shown).We also investigated the keratinocyte cell line HaCaT (Fig. 3C). In-duction of IL-18BPa mRNA (Fig. 3C, left panel) was paralleled byappearance of IL-18BPa in IFN-�-conditioned culture supernatants(Fig. 3C, right panel).

Sodium butyrate inhibits IFN-�-induced IL-18BPa in coloncarcinoma cell lines

Butyrate is a short-chain fatty acid that is produced by intestinalbacteria and is supposed to be an important regulator of colonicepithelial cell biology (21). Sodium butyrate (B) at 5 mMefficiently suppressed IFN-�-induced IL-18BPa protein releaseas well as mRNA induction (Fig. 4, A and B). It is important totake into account that peak concentrations of butyrate in thecolon can reach 20 mM (21). Sodium butyrate alone did notchange background expression of IL-18BPa. Biological activityof IL-18 is supposed to be determined by local concentrationsof IL-18 vs IL-18BP. Therefore, we determined the effect ofsodium butyrate on expression of IL-18 in these same experi-ments. Notably, sodium butyrate (5 mM) did not change IL-18expression in DLD-1 cells exposed to IFN-� (Fig. 4C). Sodiumbutyrate is supposed to trigger apoptosis in colon carcinomacells (21). Thus, cell viability was determined in these experi-ments. Sodium butyrate at 5 mM alone or in combination withIFN-� did not modulate cell viability in DLD-1 cells during a24-h incubation period (Fig. 4D). In contrast, cell death wasdetectable when DLD-1 cells were incubated for 48 h withsodium butyrate at 25 mM. Again, cell death was not associatedwith appearance of IL-18BPa immunoreactivity in these super-natants. Inhibition of IFN-�-induced IL-18BPa expression bysodium butyrate was also observed in the colon carcinoma celllines HCT116 (Fig. 4E), LoVo, and Caco-2 (data not shown).

IFN-�-stimulated DLD-1 cells release an activity that impairsIFN-� production by IL-12/IL-18-stimulated PBMC

As shown in Fig. 5A, compared with conditioned media ob-tained from unstimulated cells, conditioned media from IFN-�-stimulated DLD-1 cells impaired production of IFN-� in PBMCexposed to IL-12/IL-18. To confirm that IL-18BPa is actually detect-able in these conditioned media, immunoblot analysis was performed.As shown in Fig. 5B, a 14-h stimulation with IFN-� was sufficient totrigger detectable release of IL-18BPa during an additional 48-hincubation period in control medium. Notably, in these DLD-1 cells,augmented levels of IL-18BPa mRNA were still detectable after this48-h incubation in control medium. This is consistent with a long t1/2

(�8 h) of IFN-�-induced IL-18BPa mRNA in DLD-1 cells, asdetected in actinomycin D experiments (data not shown). We alsoinvestigated effects of sodium butyrate using this experimentalprotocol. However, conditioned media from DLD-1 cells stimu-lated with sodium butyrate alone significantly reduced later IFN-�production of IL-12/IL-18-activated PBMC by 60.1 � 12.4% (n �3, p � 0.05). This indirect inhibitory effect of sodium butyrateinterfered with efficient recovery of IL-12/IL-18-induced IFN-� inPBMC by use of conditioned media from DLD-1 cells exposed tothe combination IFN-� plus sodium butyrate (data not shown).

IFN-� mediates gene expression of IL-18BPa in organ culturesof colonic intestinal biopsy specimens

Colonic intestinal biopsy specimens obtained from five differentdonors were cultivated as unstimulated control, or exposed to ei-ther IFN-� alone, or the combination IFN-�/sodium butyrate. Up-regulation of IL-18BPa mRNA by IFN-� was observed after an8-h incubation period (Fig. 6). Transcripts sustained elevatedfor at least another 15 h of stimulation (data not shown). In

FIGURE 4. Sodium butyrate suppresses IFN-�-induced IL-18BPa expression, but not expression ofIL-18. DLD-1 cells were kept as controls, stimu-lated with sodium butyrate (B) (5 mM), with IFN-�(20 ng/ml), or with IFN-� (20 ng/ml) plus the in-dicated concentrations of sodium butyrate. After24 h, TCA-precipitated supernatants were analyzedby immunoblotting (A), and IL-18BPa mRNA wasevaluated by RNase protection assay (B). One rep-resentative of three independently performed ex-periments is shown. C, DLD-1 cells were kept ascontrol, stimulated with IFN-� (20 ng/ml), with so-dium butyrate (5 mM), or with IFN-� (20 ng/ml)/sodium butyrate (5 mM). After 24 h, cell lysateswere analyzed for IL-18 by immunoblotting. IL-18mRNA expression was evaluated by RNase protec-tion assay. One representative of three indepen-dently performed experiments is shown. D, In theseexperiments, viability was determined by LDH ac-tivity analysis. Percentage of viability � SD isshown (n � 3). E, HCT116 colon carcinoma cellswere kept as unstimulated control, or stimulatedwith IFN-� (20 ng/ml), with sodium butyrate (5 mM),or with the combination IFN-� plus sodium butyrate.After 24 h, IL-18BPa mRNA expression was evalu-ated by RT-PCR. One representative of two indepen-dently performed experiments is shown.

7041The Journal of Immunology

by guest on May 10, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

accordance with data obtained using colon carcinoma cell lines,sodium butyrate suppressed IFN-�-induced IL-18BPa expres-sion in all organ culture experiments performed (n � 5). Incontrast, expression of IL-18 mRNA in these same IFN-�-treated organ cultures was not modulated by coincubation withsodium butyrate (Fig. 6).

DiscussionIn this study, we demonstrate that IL-18BPa is released by IFN-�-activated DLD-1 colon carcinoma/epithelial cells. IFN-� induc-tion of IL-18BPa was not restricted to DLD-1 cells, but was con-firmed using LoVo, Caco-2, and HCT116 colon carcinoma cells,as well as HaCaT keratinocytes. Secretion of IL-18BPa immuno-reactivity coincided with induction of IL-18BPa mRNA and withappearance of an activity associated with IFN-�-treated DLD-1cells that was able to impair IL-12/IL-18-induced IFN-� in PBMC.Gene induction of IL-18BPa by IFN-� was also observed in cul-tures of colonic biopsy specimens. These latter results demonstrateup-regulation of IL-18BPa gene expression in an ex vivo setting,and underscore the potential significance of the data obtained usingcolon carcinoma/epithelial cell lines. The present data are consis-tent with work by Fantuzzi et al. (22) demonstrating reduced ex-pression of IL-18BP in IFN regulatory factor-1-deficient mice.These observations may have important implications for the actionof IFN-� and IL-18 under pathophysiological conditions. By in-ducing IL-18BP, IFN-� appears to trigger a negative feedback loopthat limits IFN-�-dependent and IFN-�-independent actions of IL-18. Accordingly, overproduction of IFN-� has been observed inIFN-� receptor-deficient mice used in models of hapten-inducedcolitis (23) and collagen-induced arthritis (24). The present dataare compatible with data on IL-18BP expression in graft vs hostdisease, in which production of IL-18BP increases in parallel withIFN-� (25). Moreover, in adult Still’s disease, serum levels ofIL-18 correlate with the presence of an inhibitory activity thatimpairs binding of IL-18 to its membrane receptor (26). Up-reg-ulation of IL-18BP might also be involved in the diminished ca-pability of IFN-� production in ex vivo whole blood cultures ob-tained from patients with septic shock (27). In fact, Novick et al.(10) recently demonstrated augmented serum levels of IL-18BP inseptic shock patients. Therapeutic use of IL-18BPa may restore a

hypothetically disturbed IL-18/IL-18BP balance in diseases thatare associated with augmented production of Th1 cytokines, suchas Crohn’s disease. In addition, induction of IL-18BP may con-tribute to protective functions of IFN-�, as seen in murine modelsfor rheumatoid and septic arthritis (28, 29), and in rheumatoidarthritis patients (30).

Evidence suggests that IL-18 is an inhibitor of tumor growth. Inthis context, suppression of a proposed IL-18BP activity should bebeneficial. IL-18 acts as inhibitor of angiogenesis (31) and aug-ments Fas/Fas ligand-dependent CD4� T cell and NK cell cyto-toxicity (32–34). Previous reports demonstrate that butyrate canprotect against the development of colon cancer (21). The present

FIGURE 5. IFN-�-stimulated DLD-1 cells release an activity that impairs IFN-� production by IL-12/IL-18-stimulated PBMC. A, Control-conditionedand IFN-�-conditioned media from DLD-1 cell cultures (generated as outlined in Materials and Methods; see also scheme of experimental design in A)were used to resuspend control PBMC and IL-12 (20 ng/ml)/IL-18 (20 ng/ml)-stimulated PBMC, respectively. After a 24-h incubation period, IFN-�production was determined by ELISA. Data are mean � SEM (n � 3); ��, p � 0.01 vs use of conditioned media from IFN-�-treated DLD-1 cells. B,Control-conditioned and IFN-�-conditioned media from DLD-1 cell cultures (generated as outlined in Materials and Methods) were TCA precipitated andanalyzed for IL-18BPa expression by immunoblotting. IL-18BPa mRNA of this same experiment was evaluated by RT-PCR analysis.

FIGURE 6. Induction of IL-18BPa by IFN-� in cultures of colonic bi-opsy specimens: modulation by sodium butyrate. Cultures of colonic bi-opsy specimens from five different donors were kept as unstimulated con-trol, or stimulated with IFN-� (40 ng/ml) alone, or in combination withsodium butyrate (10 mM) for different time periods (8, 16, and 22 h).Thereafter, IL-18BPa and IL-18 mRNA expression was evaluated by RT-PCR. No differences dependent on the duration of stimulation (8-, 16-, and22-h incubation) were observed. One representative experiment is shown(8-h stimulation).

7042 IFN-�-INDUCED IL-18BP RELEASE

by guest on May 10, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

data imply that intestinal butyrate may have the capability tostrengthen the bioactivity of IL-18 at the colonic microenviron-ment by modulating IL-18BPa expression. Taking into account theantitumor functions of IL-18, this is in accordance with the tumor-suppressive potential of butyrate. Actually, sodium butyrate aug-ments the sensitivity of colon carcinoma cells toward Fas-medi-ated apoptosis (35), and Fas-related CD4� T cell and NK cellcytotoxicity is characteristically enhanced by IL-18 (32–34). Al-though IFN-� should contribute to tumor-suppressive actions ofIL-18 in vivo, antitumor functions of IL-18 have been observed inan IFN-�-independent manner (31, 32, 34). It is noteworthy thatunder defined conditions, IFN-� in fact appears to be capable ofenhancing growth of colon carcinomas (36). Induction of IL-18BPby IFN-� might contribute to this observation. Altogether, sodiumbutyrate appears to shift the IL-18/IL-18BP balance in colon car-cinoma cells in favor of IL-18, which may contribute to local tu-mor protection by this compound, most likely via IFN-�-indepen-dent tumor-suppressive actions of IL-18. However, IL-18 may alsoaugment expression of genes that have been associated with cancerprogression. For example, IL-18 can up-regulate hepatic mela-noma metastasis via induction of VCAM-1 expression (37). Inaddition, IL-18 can mediate production of NO (38, 39), which hasbeen shown to facilitate growth of certain tumors, among themmelanoma (40) and colorectal cancer (41). The role of IL-18 intumor biology might depend on the particular setting. Nonetheless,in addition to IL-18, regulation of its opponent IL-18BP couldprove to be a further parameter that determines tumor growth.

References1. Dinarello, C. A., D. Novick, A. J. Puren, G. Fantuzzi, L. Shapiro, H. Muhl,

D. Y. Yoon, L. L. Reznikov, S. H. Kim, and M. Rubinstein. 1998. Overview ofinterleukin-18: more than an interferon-� inducing factor. J. Leukocyte Biol. 63:658.

2. Dinarello, C. A. 1996. Biological basis for interleukin-1 in disease. Blood 87:2095.

3. Okamura, H., H. Tsutsi, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto,K. Torigoe, T. Okura, Y. Nukada, K. Hattori, et al. 1995. Cloning of a newcytokine that induces IFN-� production by T cells. Nature 378:88.

4. Puren, A. J., G. Fantuzzi, Y. Gu, M. S. Su, and C. A. Dinarello. 1998. Interleu-kin-18 (IFN�-inducing factor) induces IL-8 and IL-1� via TNF� production fromnon-CD14� human blood mononuclear cells. J. Clin. Invest. 101:711.

5. Nakanishi, K., T. Yoshimoto, H. Tsutsui, and H. Okamura. 2001. Interleukin-18is a unique cytokine that stimulates both Th1 and Th2 responses depending on itscytokine milieu. Cytokine Growth Factor Rev. 12:53.

6. Novick, D., S. H. Kim, G. Fantuzzi, L. L. Reznikov, C. A. Dinarello, andM. Rubinstein. 1999. Interleukin-18 binding protein: a novel modulator of theTh1 cytokine response. Immunity 10:127.

7. Aizawa, Y., K. Akita, M. Taniai, K. Torigoe, T. Mori, Y. Nishida, S. Ushio,Y. Nukada, T. Tanimoto, H. Ikegami, et al. 1999. Cloning and expression ofinterleukin-18 binding protein. FEBS Lett. 445:338.

8. Kim, S. H., M. Eisenstein, L. Reznikov, G. Fantuzzi, D. Novick, M. Rubinstein,and C. A. Dinarello. 2000. Structural requirements of six naturally occurringisoforms of the IL-18 binding protein to inhibit IL-18. Proc. Natl. Acad. Sci. USA97:1190.

9. Dinarello, C. A. 2000. Targeting interleukin 18 with interleukin 18 binding pro-tein. Ann. Rheum. Dis. 59(Suppl. 1):i17.

10. Novick, D., B. Schwartsburd, R. Pinkus, D. Suissa, I. Belzer, Z. Sthoeger,W. F. Keane, Y. Chvatchko, S. H. Kim, G. Fantuzzi, et al. 2001. A novel IL-18bpELISA shows elevated serum IL-18bp in sepsis and extensive decrease of freeIL-18. Cytokine 14:334.

11. Xiang, Y., and B. Moss. 1999. IL-18 binding and inhibition of interferon � in-duction by human poxvirus-encoded proteins. Proc. Natl. Acad. Sci. USA 96:11537.

12. Takeuchi, M., T. Okura, T. Mori, K. Akita, T. Ohta, M. Ikeda, H. Ikegami, andM. Kurimoto. 1999. Intracellular production of interleukin-18 in human epithe-lial-like cell lines is enhanced by hyperosmotic stress in vitro. Cell Tissue Res.297:467.

13. Pizarro, T. T., M. H. Michie, M. Bentz, J. Woraratanadharm, M. F. Smith, Jr.,E. Foley, C. A. Moskaluk, S. J. Bickston, and F. Cominelli. 1999. IL-18, a novelimmunoregulatory cytokine, is up-regulated in Crohn’s disease: expression andlocalization in intestinal mucosal cells. J. Immunol. 162:6829.

14. Siegmund, B., G. Fantuzzi, F. Rieder, F. Gamboni-Robertson, H. A. Lehr,G. Hartmann, C. A. Dinarello, S. Endres, and A. Eigler. 2001. Neutralization ofinterleukin-18 reduces severity in murine colitis and intestinal IFN-� and TNF-�production. Am. J. Physiol. 281:R1264.

15. Pages, F., A. Berger, B. Henglein, B. Piqueras, C. Danel, F. Zinzindohoue,N. Thiounn, P. H. Cugnenc, and W. H. Fridman. 1999. Modulation of interleu-

kin-18 expression in human colon carcinoma: consequences for tumor immunesurveillance. Int. J. Cancer 84:326.

16. Boukamp, P., R. T. Petrussevska, D. Breitkreutz, J. Hornung, A. Markham, andN. E. Fusenig. 1988. Normal keratinization in a spontaneously immortalized ane-uploid human keratinocyte cell line. J. Cell Biol. 106:761.

17. Muhl, H., and C. A. Dinarello. 1997. Macrophage inflammatory protein-1� pro-duction in lipopolysaccharide-stimulated human adherent blood mononuclearcells is inhibited by the nitric oxide synthase inhibitor N(G)-monomethyl-L-ar-ginine. J. Immunol. 159:5063.

18. Reimund, J. M., C. Wittersheim, S. Dumont, C. D. Muller, J. S. Kenney,R. Baumann, P. Poidron, and B. Duclos. 1996. Increased production of tumornecrosis factor-�, interleukin-1�, and IL-6 by morphologically normal intestinalbiopsies from patients with Crohn’s disease. Gut 39:684.

19. Muhl, H., H. Kampfer, M. Bosmann, S. Frank, H. Radeke, and J. Pfeilschifter.2000. Interferon-� mediates gene expression of IL-18 binding protein in nonleu-kocytic cells. Biochem. Biophys. Res. Commun. 267:960.

20. Kampfer, H., H. Muhl, M. Manderscheid, U. Kalina, D. Kauschat, J. Pfeilschifter,and S. Frank. 2000. Regulation of IL-18 expression in keratinocytes (HaCaT):implications for early wound healing. Eur. Cytokine Network 114:626.

21. Wachtershauser, A., and J. Stein. 2000. Rationale for the luminal provision ofbutyrate in intestinal diseases. Eur. J. Nutr. 39:164.

22. Fantuzzi, G., D. A. Reed, M. Qi, S. Scully, C. A. Dinarello, and G. Senaldi. 2001.Role of interferon regulatory factor-1 in the regulation of IL-18 production andactivity. Eur. J. Immunol. 31:369.

23. Camoglio, L., A. A. te Velde, A. de Boer, F. J. ten Kate, M. Kopf, andS. J. van Deventer. 2000. Hapten-induced colitis associated with maintained Th1and inflammatory responses in IFN-� receptor-deficient mice. Eur. J. Immunol.30:1486.

24. Matthys, P., K. Vermeire, T. Mitera, H. Heremans, S. Huang, and A. Billiau.1998. Anti-IL-12 antibody prevents the development and progression of collag-en-induced arthritis in IFN-� receptor-deficient mice. Eur. J. Immunol. 28:2143.

25. Nagler, A., D. Novick, G. Zecchina, S. Slavin, C. A. Dinarello, and V. Barak.2000. Interleukin-18 and interleukin-18 binding protein and acute graft versushost disease. Exp. Hematol. 28:72.

26. Kawashima, M., M. Yamamura, M. Taniai, H. Yamauchi, T. Tanimoto,M. Kurimoto, S. Miyawaki, T. Amano, T. Takeuchi, and H. Makino. 2001. Lev-els of interleukin-18 and its binding inhibitors in the blood circulation of patientswith adult-onset Still’s disease. Arthritis Rheum. 44:550.

27. Oberholzer, A., L. Harter, A. Feilner, U. Steckholzer, O. Trentz, and W. Ertel.2000. Differential effect of caspase inhibition on proinflammatory cytokine re-lease in septic patients. Shock 14:253.

28. Vermeire, K., H. Heremans, M. Vandeputte, S. Huang, A. Billiau, andP. Matthys. 1997. Accelerated collagen-induced arthritis in IFN-� receptor-defi-cient mice. J. Immunol. 158:5507.

29. Puliti, M., C. von Hunolstein, F. Bistoni, P. Mosci, G. Orefici, and L. Tissi. 2000.Influence of interferon-� administration on the severity of experimental group Bstreptococcal arthritis. Arthritis Rheum. 43:2678.

30. German Lymphokine Study Group. 1992. Double blind controlled phase III mul-ticenter clinical trial with interferon-� in rheumatoid arthritis. Rheumatol. Int.12:175.

31. Cao, R., J. Farnebo, M. Kurimoto, and Y. Cao. 1999. Interleukin-18 acts as anangiogenesis and tumor suppressor. FASEB J. 13:2195.

32. Dao, T., K. Ohashi, T. Kayano, M. Kurimoto, and H. Okamura. 1996. Interferon-�-inducing factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity ofmurine T helper 1 cells. Cell. Immunol. 173:230.

33. Tsutsui, H., K. Nakanishi, K. Matsui, K. Higashino, H. Okamura, Y. Miyazawa,and K. Kaneda. 1996. IFN�-inducing factor up-regulates Fas ligand-mediatedcytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.

34. Osaki, T., J. M. Peron, Q. Cai, H. Okamura, P. D. Robbins, M. Kurimoto,M. T. Lotze, and H. Tahara. 1998. IFN�-inducing factor/IL-18 administrationmediates IFN-�- and IL-12-independent antitumor effects. J. Immunol. 160:1742.

35. Bonnotte, B., N. Favre, S. Reveneau, O. Micheau, N. Droin, C. Garrido,A. Fontana, B. Chauffert, E. Solary, and F. Martin. 1998. Cancer cell sensitizationto fas-mediated apoptosis by sodium butyrate. Cell Death Differ. 5:480.

36. Ramani, P., and F. R. Balkwill. 1987. Enhanced metastasis of a mouse carcinomaafter in vitro treatment with murine interferon-�. Int. J. Cancer 40:830.

37. Vidal-Vanaclocha, F., G. Fantuzzi, L. Mendoza, A. M. Fuentes, M. J. Anasagasti,J. Martin, T. Carrascal, P. Walsh, L. L. Reznikov, S. H. Kim, et al. 2000. IL-18regulates IL-1�-dependent hepatic melanoma metastasis via vascular cell adhe-sion molecule-1. Proc. Natl. Acad. Sci. USA 97:734.

38. Zhang, T., K. Kawakami, M. H. Qureshi, H. Okamura, M. Kurimoto, andA. Saito. 1997. Interleukin-12 (IL-12) and IL-18 synergistically induce the fun-gicidal activity of murine peritoneal exudate cells against Cryptococcus neofor-mans through production of � interferon by natural killer cells. Infect. Immun.65:3594.

39. Olee, T., S. Hashimoto, J. Quach, and M. Lotz. 1999. IL-18 is produced byarticular chondrocytes and induces proinflammatory and catabolic responses.J. Immunol. 162:1096.

40. Ekmekcioglu, S., J. Ellerhorst, C. M. Smid, V. G. Prieto, M. Munsell,A. C. Buzaid, and E. A. Grimm. 2000. Inducible nitric oxide synthase and ni-trotyrosine in human metastatic melanoma tumors correlate with poor survival.Clin. Cancer Res. 6:4768.

41. Ambs, S., W. G. Merriam, W. P. Bennett, E. Felley-Bosco, M. O. Ogunfusika,S. M. Oser, S. Klein, P. G. Shields, T. R. Billiar, and C. C. Harris. 1998. Frequentnitric oxide synthase-2 expression in human colon adenomas: implication fortumor angiogenesis and colon cancer progression. Cancer Res. 58:334.

7043The Journal of Immunology

by guest on May 10, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from