Molecular Cloning and Expression Analysis of NteIF2α In Response to Stress in Nicotiana tabacum Zhaoqi, Li sibin, Li ning, Guo hao, Long yue, Cui hong, Yang yongxia, Jia hongfang, Zhang hongying, Zhang songtao*,

Henan agricultural university, College of tobacco science, Tobacco Cultivation Key Laboratory of China Tobacco, Zhengzhou 450002, China

* Corresponding Author: zhangsongzi@163.com

Abstract

eIF2α (α subunite eukaryotic translation initiation factor 2) plays an important role in the regulation of

protein synthesis. The phosphorylation of eIF2α could lead to down-regulate global protein synthesis. To

investigate the function of eIF2α and explore its roles in plant stress response, the ORF (Opening Read

Frame) of NteIF2α was cloned from Nicotiana tabacum L cv. K326 by RT-PCR and the mRNA expression

level in different tissues and stress conditions were analyzed by qRT-PCR method. Our results showed that

there were 2 copies of NteIF2α in N. tabacum K326, NteIF2α-1(GenBank accession number: KR184725)

and NteIF2α-2(GenBank accession number: KR184726). The nucleotide sequences shows 98.3%

similarity, while the protein sequences show 99.7% similarity to each other. Also, NteIF2α contains the

conserved domain of eIF2α which includes kinase interaction site, phosphorylation site and eIF2B

interaction site. Further, phylogenetic analysis revealed that NteIF2α-1 and NteIF2α-2 might be derived

from its progenitor Nicotiana sylvestris and Nicotiana tomentosiformis, respectively. Twenty-four

phosphorylation sites were predicted in the protein sequence. Among them, the Ser56 which was the

phosphorylated site of protein kinases were highly conserved from animals to plants. In addition, the

expression pattern was detected in different organs of N. tabacum K326. The results showed NteIF2α-1

and NteIF2α-2 were expressed in all organs examined and the expression profiles in N. tabacum displayed

differently, because the expression of NteIF2α-2 was higher than that of NteIF2α-1, which indicates the

function of the eIF2α family members were different in the organs. Finally, the activation of NteIF2α by

SA(salicylic acid) and MeJA(methyl jasmonate) suggests that NteIF2α participates in the plant defense

response to insect. Our results provides an important basis for further studying the function of eIF2α and

its roles in plant stress response.

Key Words: Nicotiana tabacum; eIF2α; gene cloning; gene expression

Introduction Eukaryotic translation initiation factor (eukaryotic translation initiation factor 2, eIF2) plays an important role during

the protein synthesis process. In the initiation of protein translation, eIF2 coupled with GTP (guanosine triphosphate)

and initial methionine-tRNA (Met-tRNAimet) to form eIF2·GTP·Met-tRNAimet Triplet complex, and then the

complex interacts with eIF1, eIF1A and eIF3 to form the 43s pre-initiation complexes. EIF2 consists of three subunits

heterologous trimer- α、β、γ. Serine56 of α-subunit could be phosphorylated by eIF2α kinase, such as GCN2 (general

controlnon derepressible-2), HRI (heme-regulated inhibitor), PERK (interferon inducible protein) and PKR (PKR-like

endoplasmic reciculum-resident protein kinase). Thus, leading to the suspension of translation initiation and down-

regulation of global protein synthesis.

Phosphorylation of eIF2α by eIF2α kinase to down-regulate protein synthesis are widespread in eukaryotic cells. In

mammalian cells, the phosphorylation of serine at site 51 of eIF2a is mediated by four protein kinases, each of which

respond to different stress stimuli. For example, in the absence of heme, HRI is activated to regulate the synthesis of

erythrocyte globulin. GCN2 kinases are activated by uncharged tRNAs in the absence of amino acids. PERK is activated

when the endoplasmic reticulum protein misfolded. All these kinases contain a typical protein kinase domain that could

activate the phosphorylation of eIF2a. In Arabidopsis thaliana, the serine52 of AteIF2a could be phosphorylated when

Arabidopsis thaliana was treated with herbicides that may affect amino acid synthesis, and the phosphorylation is

accomplished by AtGCN2.

eIF2α contains about 300 amino acid residues with high sequence similarity from different species. About 180 amino

acids at the N-terminus of the eIF2α are necessary for the phosphorylation of serine at site 51. The N-terminal sequence

of the yeast and human eIF2α shows the similarity of 56%, while the similarity of the first 100 amino acid residues

reach 75%. Moreover, it was showed that sequences prior to Serine51 and the conserved regions KGYID83 were

important for the binding of eIF2B. The conserved KGYID83 region is also involved in the interaction of eIF2α with

kinases.

In Arabidopsis, various stresses (including amino acid deficiency, purine deficiency, UV, cold stress and injury

treatment) could activate phosphorylation of eIF2α, leading to decrease of protein synthesis. Besides, plant homorney

include methyljasmonate (MeJA) and salicylic acid (SA) could also phosphorylate eIF2α, suggesting that

phosphorylation of eIF2α might also be involved in plant defense response. However, little is known about the reseach

of eIF2α from tabacco and its roles in plant defense response.

Materials and methods Plant materials

Nicotiana tabacum K326 plants were grown in soil in a growth chamber with a temperature/light setting of 28 ℃/16 h.

Preparation of cDNA

Total RNA was isolated from leaf material using RNeasy Plant Mini Kit (Qiagen), then the cDNA was prepared by

using the random primers and obtained RNA as template.

Molecular Clone of NteIF2α

Using the prepared cDNA as a template, primers were shown as following: NteIF2α-ORF-F: 5'-

CGCGCGGCAGCCATATGGCGACCAACTCCCCAAACCTC-3’ and NteIF2α-ORF-R: 5'-

CCATGCATGGTCGACTTACTCTCTAATTCCAGCTCCTG-3’. PCR was performed with 50 μl PCR reaction

mixture that included 1 μL template, 5 μL each of the upstream and downstream primers, 1 μL of DNA polymerase, 5

μL of dNTP, and 33 μL of ddH2O. PCR program: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 1 min,

annealing at 58 ℃ for 45 s and extension at 72 ℃ for 1 min for 30 cycles,Then extended at 72 ℃ for 1 min, and

stored at 4 ℃. PCR products were purified and ligated into pMD19-T, then transformed into E. coli. Positive clones

were sequenced.

Bioinformatics Analysis

Clustal W 1.83 was used for Multiple alignment analysis and phylogenetic tree construction. Protein hydrophobicity

Analysis and transmembrane prediction were performed using ProtScale (http: // web.

Expasy.org/protscale/ ,TMpred(http://embnet.vitAl-it.Ch/software/TMPRED_form.Html) and Phosphorylation site

prediction was analyzed by the online tools (http://www.cbs.dtu.dk/services/Net-Phos /).The secondary structure is

predicted using online tools SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.Pl? Page = npsa_sopma.html).

Amino acid sequences were submitted to the Swiss Bioinformatics Institute website(Http://swissmodel.expasy.org/)

for homology modeling. Three-dimensional structure was displayed by PyMol software.

Real-time quantitative RT-PCR

RNA was extracted from the middle leaves, roots, stems and flowers of N.tabacum K326. qRT-PCR was performed

with 20 μl PCR reaction mixture that contained 2 μl of cDNA, 10 μl of 2 × LightCycler® 480 SYBR Green I Master

(Roche, Swiss), 0.4 μl of primers (Table 1), and 7.2 μl of nuclease-free water. The mixure was incubated at 95℃ for

10 min, followed by 40 cycles of 95℃ for 10 s, 60℃ for 30 s ,72℃ for 30 s. Each sample was run in triplicate for

analysis. The expression levels of mRNAs were normalized to tobacco ribosome gene L25(L18908) and were

calculated using the 2-ΔΔCt method (Livak and Schmittgen, 2001).

Stress treatment

The seedlings of N.tabaccum K326 was grown on MS medium, and were sprayed with 2 mmol·L-1 salicylic acid (SA)

or 100 μmol·L-1 methyl jasmonate (MeJA) after grown for 1 month. 200 mg samples were taken at 0,3,6,12,24,48 and

72 h after SA treatment and 0, 3, 6, 24, 48 and 72 h for MeJA treatment.

A

B

D

Results and discussion

1.Molecular clone of NteIF2a from N.tabacum

The K326 cDNA was used as template to amplify the PCR fragment. The PCR product was ligated into the

pMD19-T vector and tranformed into E.coli. The resulted recombinant plasmid verified and The fragment was

about 1000 bp(Fig. 1). The results showed that there were 2 copies of NteIF2α in N. tabacum K326, Named

NteIF2α-1(GenBank accession number: KR184725) and NteIF2α-2(GenBank accession number: KR184726),

respectively.

Fig.1 Clony PCR identification of the NteIF2α

from N. tabacum K326

2.Homologous alignment and phylogenetic analysis of NteIF2α

The obtained eIF2α nucleotide was translated into amino acid sequence and used for alignment analysis (Figure 2).

The results showed that NteIF2α-1 and NteIF2α-2 was showed 99.7% similarity in amino acid sequence, and

NteIF2α contains the conserved domain of eIF2α which includes kinase interaction site, phosphorylation site and

eIF2B interaction site.

In addition, these plant-derived eIF2α sequences showed high similarity over 76.1%, while the NteIF2α showed

low similarity with human (45.5%) and yeast (45.1%). The results showed that the NteIF2α sequence was the

coding sequence of Nicotiana tabacum eIF2α and the typical domain was identical to that of human and yeast

eIF2α, which suggest the conserved regulation mechanism of protein synthesis among animal and plant.

The phylogenetic tree was constructed according to the nucleotide sequence of eIF2α(Fig 3). The

phylogenetic analysis revealed that NteIF2α-1 and NteIF2α-2 might be derived from its progenitor

Nicotiana sylvestris and Nicotiana tomentosiformis, respectively.

3. Analysis of protein hydrophobicity and phosphorylation site prediction of NteIF2α

Hydrophobicity analysis showed that the maximum hydrophobicity of NteIF2α protein was 2.011 (268 amino acids)

and the maximum hydrophilicity was -3.20 (323 amino acids). Phosphorylation site prediction showed that there

are 14 potential serine (Ser) phosphorylation sites, 3 threonine (Thr) phosphorylation sites and 7 tyrosine (Tyr)

phosphorylation sites in the amino acid sequence of eIF2α protein. The 56th serine phosphorylation site score was

as high as 0.917, suggesting that the site is a potential phosphorylation site, which is involved in the regulation of

Table 1 Primer sequences of NteIF2α-1 and NteIF2α-2 used for qRT-PCR

Fig.2 Alignment of the amino acid

sequences of eIF2α (The same amino

acid residues are highlighted in black)

NteIF2a-1 and NteIF2a -2: the eIF2a sequence

of tobacco N. tabacum K326; N. sylvestris:

eIF2α sequence of tobacco Nicotiana sylvestris

(gi: 698443790); N.tomentosiformis: eIF2α

sequence of Nicotiana tomentosiformis (gi:

697118772); S. lycopersicum: eIF2α sequence

of tomato Solanum lycopersicum (gi:

460378959); Arabidopsis: eIF2α sequence of

Arabidopsis thaliana (gi: 18405334);Zea mays:

eIF2α sequence of maize (gi: 226505440);

Homo sapiens: human eIF2α sequence (gi:

4758256);S. cerevisiae: eIF2α sequence of

yeast Saccharomyces cerevisiae (gi: 903889);

The sites indicated by the arrows are the

phosphorylation site of the protein kinase (S56)

and the site of action of the kinase

(V38Y86I87D88), and the triangular symbol

represents the eIF2B interaction site

(E54K84G85).

5.Gene expression analysis of NteIF2α in different organs and under stress treatment

The gene expression of NteIF2α-1 and NteIF2α-2 were analyzed by RT-PCR(Fig 6). The results showed NteIF2α-1 and NteIF2α-2 were

expressed in all organs examined and the expression profiles in N. tabacum displayed differently, because the expression of NteIF2α-2 was

higher than that of NteIF2α-1, which indicates the function of the eIF2α family members were different in the organs.

The activation of NteIF2α by SA(salicylic acid) and MeJA(methyl jasmonate) was shown in Fig 7. These suggests that NteIF2α

participates in the plant defense response to insect.

Fig.4 Protein hydrophobicity (left) and phosphorylation sites (right) analysis of

NteIF2α

Fig.3 The phylogenetic tree of the nucleotide

sequences of eIF2α

Fig.7 RT-qPCR analysis of NteIF2α gene expression under stress treatment(A: SA treatment;

B: MeJA treatment )

A B

Table 1 Primer sequences of NteIF2α-1 and NteIF2α-2 used for qRT-PCR

Primer name Sequence (5’-3’) Purpose

NteIF2α-1-F: CTCCGAAACCCTAATAACCTTCACT Amplification of

NteIF2α-1-R: CCTTCTATGTTGTTGTACTCGAGAAGC NteIF2α-1

NteIF2α-2-F: CTCCGAAACCCTAATAACTCCCAC Amplification of

NteIF2α-2-R: CCTTCTATGTTGTTGTACTCGAGAAGT NteIF2α-2

NteIF2α-F: CCTCGAATGCCGAATGTACGAAGCC Amplification of

NteIF2α-R: CCTTCTATGTTGTTGTACTCGAGAAG NteIF2α

L25-F: GCTTTCTTCGTCCCATCA Reference gene

L25-R: CCCCAAGTACCCTCGTAT

4. Protein tertiary structure prediction

The protein secondary structure of NteIF2α-1 contained α-helix(48.98%) , β-sheet (16.33%), β-turn (10.79%) and

random coil (23.91%). In addition, the N-terminal of the protein contains five antiparallel β-sheets, which are

similar to the eIF2α spatial structure in human and yeast (Fig 5).

Fig. 5 The tertiary structure prediction of

NteIF2α-1(blue)and NteIF2α-2(green)

Fig.6 Relative expression of NteIF2α-1 and NteIF2α-2

in different organs of N. tabacum L cv. K326

Roots Stems Leaves Flowers

Conclusion 1. We clone NteIF2α from Nicotiana tabacum L cv. K326. NteIF2α-1and

NteIF2α-2 might be derived from its progenitor Nicotiana sylvestris

and Nicotiana tomentosiformis, respectively.

2. The mRNA expression level of NteIF2α-1and NteIF2α-2 in different tissues

indicates the function of the eIF2α family members were different in the organs.

3. The activation of NteIF2α by SA and MeJA suggests that NteIF2α participates

in the plant defense response to insect. The results provides an important basis

for further studying the function of eIF2α and its roles in plant protein synthesis.

2016

_AP

PO

ST

03_Z

hang

Son

gtao

.pdf

Con

gres

s201

6 -

Doc

umen

t not

pee

r-re

view

ed b

y C

OR

ES

TA