Lactobacillus acidophilus - Clinical and Vaccine...
Transcript of Lactobacillus acidophilus - Clinical and Vaccine...
Lactobacillus acidophilus induces cytokine and chemokine 1
production via NF-κB and p38 MAPK signaling pathways 2
in intestinal epithelial cells 3
Yujun Jianga, b#*, Xuena Lüa#, Chaoxin Manb, Linlin Hana, Yi Shanb, Xingguang Qua, 4
Ying Liua, Shiqin Yanga, Yuqing Xuea and Yinghua Zhanga 5
a Key Lab of Dairy Science, Ministry of Education, College of Food Science and 6
Engineering, Northeast Agricultural University, Harbin, P. R. China, 150030 and 7
b National Research Center of Dairy Engineering and Technology, Northeast Agricultural 8
University, Harbin, P. R. China, 150086 9
Running title: Regulation of cytokine and chemokine production by probiotic bacteria 10
Key words: intestinal epithelial cells, probiotic bacteria, Toll-like receptor 2, signal 11
transduction 12
# These authors contributed equally to this study. 13
* Corresponding author. 14
Mailing address: Key Laboratory of Dairy Science, Ministry of Education, Northeast 15
Agricultural University, 59 Mucai Street, Harbin, Heilongjiang Province, China, 150030. 16
Phone : +86-451-55191842 17
Fax : +86-451-55191842 18
Email: [email protected] 19
20
21
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Clin. Vaccine Immunol. doi:10.1128/CVI.05617-11 CVI Accepts, published online ahead of print on 22 February 2012
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
2
ABSTRACT 22
Intestinal epithelial cells can respond to certain bacteria by producing an array of 23
cytokines and chemokines which are associated with host immune responses. 24
Lactobacillus acidophilus NCFM is a characterised probiotic, originally isolated from 25
human feces. This study aimed to test the ability of L. acidophilus NCFM to stimulate 26
cytokine and chemokine production in intestinal epithelial cells and to elucidate the 27
mechanisms involved in their up-regulation. In experiments using the intestinal epithelial 28
cell lines and mouse models, we observed that L. acidophilus NCFM could rapidly but 29
transiently up-regulate a number of effector genes, encoding cytokines and chemokines 30
such as IL-1α, IL-1β, CCL2 and CCL20, and that cytokines showed lower expression 31
levels with L. acidophilus NCFM treatment than chemokines. Moreover, L. acidophilus 32
NCFM could activate pathogen-associated molecular pattern receptors, TLR2, in 33
intestinal epithelial cell lines. The phosphorylation of NF-κB p65 and p38 MAPK in 34
intestinal epithelial cell lines was also enhanced by L. acidophilus NCFM. Furthermore, 35
inhibitors of NF-κB (PDTC) and p38 MAPK (SB203580) significantly reduced cytokine 36
and chemokine production in the intestinal epithelial cell lines stimulated by L. 37
acidophilus NCFM, suggesting that both NF-κB and p38 MAPK signaling pathways 38
were important for the production of cytokines and chemokines induced by L. 39
acidophilus NCFM. 40
41
42
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
3
INTRODUCTION 43
The human gastrointestinal (GI) tract, which is populated by a complex mixture of 44
more than 1014 microorganisms, is lined by a single monolayer of intestinal epithelial 45
cells (IEC) (7). IEC are recognized as immunological sentinels of the GI tract and play a 46
key regulatory role in maintaining host innate and adaptive mucosal immunity (16, 40). 47
IEC are the first line of host defense to pathogenic bacteria invasion or inflammatory 48
stimuli by secreting an array of cytokines and chemokines, which affect the immune cells 49
scattered in the GI tract and recruit immune cells to the GI tract respectively (14, 19, 25, 50
37). Because IEC are continually exposed to the GI tract microbiota, it is clear that 51
commensal bacteria should not elicit as intense an inflammatory response as pathogenic 52
bacteria (34). In addition, some investigators showed that IEC remain hypo-responsive to 53
nonpathogenic commensal bacteria (23, 31). However, it has also been reported that IEC, 54
exposed to some commensal bacteria, such as Bacillus subtilis, Bacteroides ovatus, 55
Escherichia coli, Lactobacillus rhamnosus, Bifidobacterium lactis, Lactobacillus casei or 56
Lactobacillus acidophilus, could produce inflammatory cytokines (e.g., IL-1, IL-8 and 57
TNF-α) or chemokines (e.g., CCL2 and CCL20) (4, 13, 21, 32, 40). 58
Probiotics exert beneficial effects on the host health through establishing mutualistic 59
relationships with the IEC (22). Some strains have been shown to enhance the host 60
immune responses by regulating cytokine and chemokine production (13, 18, 21, 32, 38, 61
40). Of these, the strain Lactobacillus acidophilus NCFM is a well-characterised 62
probiotic bacteria with several reports showing beneficial effects on the host (1, 10, 20, 63
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
4
36). These studies have shown that L. acidophilus NCFM is able to modulate the 64
production of inflammatory mediators such as TNF-α, IL-1β, CCL2 and IL-6 in dendritic 65
cells (DC) and IEC (10, 40). However, little is known about the basic molecular 66
mechanism of L. acidophilus NCFM regulation of the host immune responses. 67
IEC sense bacteria through expression of the conserved pattern recognition receptors 68
(PRRs), such as the Toll-like receptors (TLRs) (21, 27). Some studies have shown that 69
TLR2 and TLR4 were constitutively expressed both in IEC lines and primary IEC 70
isolated from intestinal tissue (3, 21). These receptors activated the nuclear factor kappa 71
B (NF-κB) and mitogen-activated protein kinase (MAPK), the immune-related 72
transcriptional factors that induced the synthesis of cytokines and chemokines (26). It has 73
been reported that B. lactis, the dominant microbial population group in the human GI 74
tract, induced the inflammatory cytokine IL-6 production through NF-κB and p38 MAPK 75
signaling pathways in IEC (32). L. casei could activate these signaling pathways in 76
production of innate cytokines such as TNF-α and IL-12 in spleen cells (18). Miettinen M 77
et al. also showed that L. rhamnosus GG (LGG) can initiate the NF-κB, STAT1 and 78
STAT3 DNA-binding activity in human macrophages (29). Therefore, it is likely that the 79
activation of these transcriptional factors of host cells by L. acidophilus plays important 80
roles in the generation of immune-related cytokines and chemokines that function to 81
benefit the host. 82
In this study, we examined the ability of L. acidophilus NCFM to stimulate cytokine 83
and chemokine production in native IEC and IEC lines, and elucidated the mechanisms 84
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
5
involved. We found that L. acidophilus NCFM could rapidly but transiently induce 85
cytokine and chemokine production, and cytokines showed lower expression levels than 86
chemokines. Furthermore, our research suggested that the activation of TLR2-mediated 87
NF-κB and p38 MAPK signaling pathways played a key role in the production of 88
cytokines and chemokines in IEC. 89
MATERIALS AND METHODS 90
Bacterial strain and culture conditions. L. acidophilus NCFM was obtained from 91
American Type Culture Collection (ATCC; Rockville, Md, USA). For stimulation 92
experiments, the bacteria were anaerobically grown at 37°C in de Man, Rogosa and Sharp 93
broth (MRS broth; Difco, Detroit, MI, USA) overnight prior to use. The bacteria cells 94
were harvested by centrifugation (4,000 g, 10 min) at stationary phase, washed twice with 95
sterile phosphate buffered saline (PBS), and then diluted with Dulbecco’s modified 96
Eagle’s minimal essential medium (DMEM; GIBCO-BRL, Grand Island, NY, USA) and 97
sterile 10% skimmed milk for in vitro and in vivo experiments respectively. The number 98
of bacteria cells was determined by plate counting agar method. 99
Cell culture. The human colorectal adenocarcinoma cell line Caco-2 cells were 100
purchased from ATCC and maintained in an incubator at 37°C, 5% CO2, in DMEM 101
supplemented with 10% heat-inactivated fetal bovine serum (FBS; NQBB, Australia), 1% 102
nonessential amino acids, 10 unit/mL penicillin and 10 μg/mL streptomycin. The Caco-2 103
cells (3×106 cells/well), which were used for stimulation experiments, were allowed to 104
attach and grow in plastic six-well culture plates (Costar, Corning, USA). Cell culture 105
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
6
medium was changed every second day for approximately 17 days until the cells reached 106
full differentiation and polarization (28). Subsequently, the Caco-2 cells were used in 107
experimental investigations as specified below. 108
Stimulation experiment. Before stimulation, the polarized epithelial cell monolayers 109
were washed twice with prewarmed PBS, and then the cells were incubated with the 110
bacteria suspensions at a multiplicity of infection (MOI, ratio of bacteria number to 111
epithelial cell number) of 10, which did not affect the composition of the culture medium 112
and IEC viability (21), for various times at 37°C and 5% CO2. Culture medium was used 113
as a negative control. Where indicated, the experiments were terminated by thoroughly 114
washing the cells with cold PBS. 115
Animal studies. BALB/c mice, 10 to 12 weeks old weighing from 20 g to 24 g, were 116
used for studying the in vivo kinetics of how L. acidophilus NCFM induced the cytokine 117
and chemokine expression. The mice were housed in plastic cages kept in a constant 118
room temperature of 22 ± 2°C, relative humidity of 55 ± 5%, and exposed to a 12 h 119
light/dark cycle. They had free access to a conventional balanced diet and distilled water. 120
The experimental group was administered intragastrically with L. acidophilus NCFM 121
diluted in 10% skimmed milk at a clinically relevant concentration of 109 colony forming 122
units (CFU)/mL for a week (10), and the daily suspension intake of bacteria was 1.0 ± 0.1 123
mL/mouse. The mice that were administered intragastrically with sterile 10% skimmed 124
milk alone were used as negative controls. The mice of each group were sacrificed 1, 3, 5 125
and 7 days after the initial intragastric administration. The cecum and colon were 126
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
7
removed, washed in cold PBS, and then placed in liquid nitrogen (LIN) immediately after 127
the mice being sacrificed. 128
Inhibitor treatment. Prior to stimulation with L. acidophilus NCFM, the polarized 129
Caco-2 cells were incubated with the NF-kB inhibitor (PDTC, 40 μM; sigma, USA) and 130
p38 MAPK inhibitor (SB203580, 20 μM; sigma, USA) for 30 min. Afterwards, the cells 131
were washed twice with prewarmed PBS and then exposed to L. acidophilus NCFM for 2 132
h at a MOI of 10. The experiments were terminated by thoroughly washing the cells with 133
cold PBS and then total RNA was prepared for real-time RT-PCR. 134
RNA isolation and real-time RT-PCR. RNA from cell lines or cecum and colon was 135
extracted using Trizol (Invitrogen, Carlsbad) by repetitive pipetting (17). The purity and 136
integrity of RNA were evaluated by spectrophotometry and electrophoresis on 1% 137
agarose gels. cDNA was synthesized using the cDNA RT reagent kit (Takara, Dalian, 138
China) according to the manufacturer’s protocol. Real-time RT-PCR reactions were 139
performed using the ABI PRISM 7500 System using SYBR green buffer according to the 140
manufacturer’s instructions (Applied Biosystems, USA), subjected to 30 s denaturation at 141
95°C, followed by 40 cycles of 5 s at 95°C and 34 s at 60°C. The sequences of specific 142
primers used in the PCR are shown in Table 1. The data were analyzed by using the ABI 143
PRISM 7500 System Sequence Detection software. All the gene quantifications were 144
performed with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal 145
standard and the relative quantification of gene expression was analyzed by using the 146
standard formula 2-[(Et-Rt)-(Ec-Rc)]. Ct is the cycle number where the amplified target reaches 147
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
8
the defined threshold, Et is the Ct of the experimental gene in treated samples, Rt is the 148
Ct of GAPDH in treated samples, Ec is the Ct of the experimental gene in control 149
samples, and Rc is the Ct of GAPDH in control samples (30). Application plot and 150
dissociation curves were used for the examination of the amplified products. 151
Western blot analysis. Caco-2 cells, which were treated with L. acidophilus NCFM 152
and DMEM respectively, were lysed in lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 1 153
mM EDTA, 1 mM EGTA, 10% NP-40 and Sodium deoxycholate, 10 mg/mL 154
Aprotenin and Leupeptin, 100 mg/ml PMSF, 400 μM Na3VO4 and 5 Mm NaF), incubated 155
at 4°C for 30 min, and centrifuged at 13,000 g for 10 min at 4°C. The supernatants were 156
transferred to fresh tubes and stored at -70°C until required. Protein concentration in the 157
supernatants was determined by Bradford’s method. Approximately 20 μg protein per 158
lane were loaded on sodium dodecyl suphate-12% polyacrylamide gel electrophoresis 159
(SDS-PAGE), and then transferred onto a polyvinylidene fluoride membrances (Millipore, 160
Bedford, USA) in 25 mM Tris-base, 190 mM glycine, and 20% methanol using a wet 161
blotter. Subsequently, the membranes were blocked with 5% bovine serum albumin (BSA) 162
in TBS supplemented with 0.1% Tween-20 for 1 h, and washed with TBS supplemented 163
with 0.1% Tween-20 for 5 min three times. Afterwards, the membrances were incubated 164
at 4°C overnight with rabbit anti-Ser(p)-NF-kB p65, anti-Th(p)-p38 MAPK (Cell 165
Signaling Technology, Inc., Beverly, MA), anti-TLR2 and anti-GAPDH (Santa Cruz 166
Biotechnology, Santa Cruz, CA) respectively. After incubation with horseradish 167
peroxidase (HRP)-conjugated anti-rabbit antibody, the membranes were incubated with 168
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
9
ECL chemiluminescene reagent (TransGen Biotech, Beijing, China) and the film was 169
then exposed to the membranes. 170
Statistical analysis. Data was expressed as the means ± standard deviation (SD) of 171
triplicates. The statistical significance of the difference between the two means was 172
evaluated by using Student’s t test. Values of p < 0.05 were considered significant. 173
RESULTS 174
Kinetics of cytokine and chemokine expression in Caco-2 cells stimulated with L. 175
acidophilus NCFM. In order to assess the effect of L. acidophilus NCFM on cytokine 176
and chemokine production in IEC, the Caco-2 cells were incubated with bacteria at a 177
MOI of 10 for 0, 2, 4, 8 and 12 h, and cytokines and chemokines, including IL-1α, IL-1β, 178
CCL2 and CCL20, associated with the host immunity, were measured. As shown in Fig. 1, 179
L. acidophilus NCFM induced the cytokine and chemokine expression with the same 180
kinetics, and the expression of these genes was significantly up-regulated (p<0.05) at 2 h 181
after bacterial stimulation except for IL-1β, which was significantly up-regulated (p<0.05) 182
at 4 h. All the gene expression peaked at 4 h after stimulation, and then gradually declined. 183
The chemokine mRNA expression represents a higher fold change than the cytokines. 184
Kinetics of cytokine and chemokine expression in mice administered 185
intragastrically with L. acidophilus NCFM. In order to further investigate whether L. 186
acidophilus NCFM can induce the cytokine and chemokine expression in vivo, the 187
BALB/c mice were administered intragastrically with bacteria for 0, 1, 3, 5 and 7 days. 188
Fig. 2 shows that L. acidophilus NCFM could induce the cytokine and chemokine 189
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
10
production and the trends of gene expression levels were comparative in vivo and in vitro. 190
The expression of both cytokines and chemokines was highest on Day 5 after the initial 191
bacteria association in mice. However, the expression of these genes was significantly 192
up-regulated (p<0.05) on Day 5 except for IL-1α, the expression of which was not 193
significant (p>0.05) compared to the control group during the bacteria association. 194
Similar to the in vitro data, the expression level of cytokines was lower than that observed 195
for the chemokines. The above results indicated that L. acidophilus NCFM had the ability 196
to regulate the transient cytokine and chemokine expression both in vitro and in vivo. 197
Induction of TLR2 in Caco-2 cells by L. acidophilus NCFM. The expression of the 198
pattern recognition receptors, TLRs, plays an essential role in the activation of the host 199
immune responses, and TLR2 has been shown to be activated by gram-positive bacteria 200
(4, 18). Therefore, we investigated whether L. acidophilus NCFM could induce the TLR2 201
expression in IEC. The Caco-2 cells were treated with bacteria at a MOI of 10 for 0, 0.5, 202
1, 2 and 4 h. As shown in Fig. 3, the TLR2 was induced after stimulation with L. 203
acidophilus NCFM and the activation was started as early as 0.5 h after treatment. The 204
data suggested that probiotic L. acidophilus NCFM could up-regulate the expression of 205
pattern recognition receptor molecule, TLR2, in Caco-2 cells. 206
Activation of NF-κB and p38 MAPK signaling pathways in Caco-2 cells 207
stimulated with L. acidophilus NCFM. TLRs have been shown to lead to the activation 208
of NF-κB and p38 MAPK signaling pathways, which were important in the production of 209
many immune-related factors including cytokines and chemokines (26). Therefore, in 210
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
11
order to examine whether the NF-κB and p38 MAPK signaling pathways have been 211
activated, the activation state of these two signaling pathways was studied when Caco-2 212
cells were stimulated with L. acidophilus NCFM at a MOI of 10 for 0-4 h. As shown in 213
Fig. 4 A, L. acidophilus NCFM could activate the p38 MAPK signaling pathway in IEC. 214
The levels of p38 MAPK phosphorylation increased until 2 h, and then slowly decreased, 215
despite the persistent bacterial stimulation. To verify the activation of the NF-κB 216
signaling pathway, cell lysates were analyzed for levels of phosphorylated NF-κB p65, as 217
phosphorylation of the NF-κB p65 subunit was associated with the activation of the 218
NF-κB signaling pathway (12). L. acidophilus NCFM could rapidly activate the NF-κB 219
signaling pathway with a similar kinetics to the p38 MAPK signaling pathway (Fig. 4 B). 220
These results demonstrated that the NF-κB and p38 MAPK signaling pathways were 221
transiently activated when L. acidophilus NCFM stimulated Caco-2 cells and that this 222
activation occurred before a significant increase of cytokine and chemokine expression 223
(Fig. 1). 224
To further test whether NF-κB and p38 MAPK signaling pathways are necessary for 225
the cytokine and chemokine production, the Caco-2 cells were stimulated with or without 226
the existence of PDTC, a specific inhibitor for NF-κB, or SB203580, a specific inhibitor 227
for p38 MAPK. The Caco-2 cells were pre-incubated with PDTC (40 μM) or SB203580 228
( 20 μM) for 30 min, and then treated with L. acidophilus NCFM for 2 h. Inhibition of the 229
NF-κB or p38 MAPK signaling pathways resulted in a partial yet significant decline 230
(p<0.05) of cytokine and chemokine expression compared to the uninhibited groups 231
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
12
treated with bacteria only (Fig. 5). The above results suggested that L. acidophilus NCFM 232
could rapidly induce the IL-1α, IL-1β, CCL2 and CCL20 production through NF-κB and 233
p38 MAPK signaling pathways in Caco-2 cells. 234
DISCUSSION 235
It is well known that cytokines and chemokines, which affect the immune cells 236
scattered in the GI tract and recruit immune cells to the GI tract respectively, play a major 237
role in mediating immune and intestinal inflammatory responses (14, 19, 25, 37). 238
Recently, it has been reported that commensal bacteria, like L. rhamnosus, L. acidophilus 239
and E. coli, could up-regulate the production of many members of cytokine and 240
chemokine family such as IL-1, CCL2 and CCL20 (3, 12, 21), although some studies 241
have shown that the intestine appeared to be tolerant to commensal bacteria (23, 31). 242
In line with these studies, our data also showed that L. acidophilus NCFM induced 243
the production of some cytokines (IL-1α and IL-1β) and chemokines (CCL2 and CCL20), 244
which were of crucial importance in the control of normal homeostasis and host gut 245
immunity. The IEC showed a rapid but transient up-regulation of cytokines and 246
chemokines (Fig. 3), despite the persistence of bacteria stimulation. The cytokines and 247
chemokines are a “double-edged sword”, and they play an important role in enhancing 248
the host immunity, but the uncontrolled overexpression has been implicated in epithelial 249
tissue damage and many intestinal pathologies, including chronic intestinal inflammation, 250
especially in the genetically susceptible (32). The non-overexpression of cytokines and 251
chemokines as a result of L. acidophilus NCFM treatment suggested that the normal IEC 252
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
13
had developed feedback mechanisms to control the mucosal immune responses to the 253
constant challenge by commensal bacteria (32). It has been demonstrated that IEC, which 254
remain hypo-responsive to commensal bacteria, can respond to non-pathogenic bacteria 255
in the presence of human peripheral blood mononuclear cells (PBMC), suggesting that 256
bacteria signaling at the intestinal tract requires a network of cellular interactions (11). 257
However, we found that L. acidophilus NCFM exerted a similar inflammatory activation 258
pattern in vivo as to that in vitro with respect to cytokine (IL-1α and IL-1β) and 259
chemokine (CCL2 and CCL20) expression. However, the fold change of the 260
immune-related genes expression in vivo was relatively lower than that in vitro, which 261
may be explained by the fact that bacteria populations existing in the epithelial surfaces 262
are complex and the interactions between different bacteria in vivo might occur (21). 263
Moreover, we found that L. acidophilus NCFM induced cytokine and chemokine 264
up-regulation appeared to be strain-specific. L. acidophilus JCM 1132T did not stimulate 265
the cytokine expression in IEC (13), and L. acidophilus X37 also did not induce the 266
cytokine production except IL8 but with low expression level (40). However, the factors 267
that L. acidophilus species mediating different interactions with IEC remain unclear and 268
further studies are necessary to analyze the different cytokine and chemokine secretion of 269
IEC stimulated with various L. acidophilus strains. 270
IEC sense commensal bacteria through expression of the pattern recognition 271
molecules, such as TLRs are thought to recognize the signature molecules of 272
microorganisms during the early period of innate immune responses (21, 27). It has been 273
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
14
reported that IEC could induce TLR2 and TLR4 when responding to commensal bacteria, 274
but TLR2 was mainly involved in response to Gram-positive bacteria (4, 18, 21, 27). 275
Commensal bacteria, like L. casei, L. rhamnosus, L. plantarum and B. lactis, all activated 276
the TLR2 in many cells including IEC and macrophage (4, 18, 32). In this study, we 277
found that the expression of TLR2 was up-regulated in a rapid manner in IEC after 278
treatment with L. acidophilus NCFM compared to the unstimulated controls (Fig. 3), 279
which is in line with the study that showed L. acidophilus NCFM could activate the 280
TLR2 in HEK293 cells (20), while others pointed that the mice fetal epithelial cells were 281
non-responsive to the expression of TLR2 after L. acidophilus NCFM stimulation (40). It 282
is likely that different cells respond differently even to the same bacteria (6). 283
The consequences of signaling through TLRs have been reported to trigger both 284
NF-κB and p38 MAPK activation. These play important roles in the production of 285
cytokines and chemokines involved in regulating immune responses (26). Kim Y. G and 286
his colleagues have shown that p38 MAPK signaling pathway was important for the 287
production of cytokines in L. casei treated-mice spleen cells, whereas NF-κB P65 also 288
contributed, but to a lesser extent (18). B. lactis has also been shown to induce cytokine 289
IL-6 gene expression in IEC through the NF-κB and p38 MAPK signaling pathway (32). 290
In this study, phosphorylation of the NF-κB p65 and p38 MAPK in Caco-2 cells was 291
shown to be rapidly but transiently enhanced in the L. acidophilus NCFM-treated groups 292
(Fig. 4), indicating that both signaling pathways could be activated by L. acidophilus 293
NCFM. Consistent with our findings, previous studies also showed that the direct contact 294
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
15
of L. acidophilus NCFM with IEC was able to activate the NF-κB pathway (10). 295
Inhibition of the NF-κB or p38 MAPK signaling pathway, using the specific inhibitor 296
PDTC or SB203580 respectively, significantly reduced cytokine (IL-1α and IL-1β) and 297
chemokine (CCL2 and CCL20) production in Caco-2 cells after stimulation by L. 298
acidophilus NCFM (Fig. 5). These results suggested that activation of both NF-κB and 299
p38 MAPK could play an important role in augmenting the production of cytokines and 300
chemokines by L. acidophilus NCFM. It has been reported that p38 MAPK had numerous 301
direct and indirect interactions with NF-κB (5, 35), so it is necessary to further examine 302
the role of the interactions of p38 MAPK and NF-κB signaling pathways in the cytokine 303
and chemokine production. 304
Interestingly, both in vivo and in vitro data demonstrated that the cytokines (IL-1α 305
and IL-1β) showed a lower expression level to L. acidophilus NCFM treatment than 306
chemokines (CCL2 and CCL20) (Fig. 1, 2). Some studies also showed that expression of 307
pro-inflammatory cytokines secreted by IEC stimulated with agonist or bacteria was 308
generally much lower than that observed for the chemokines (8, 15). IL-1α and IL-1β are 309
pro-inflammatory mediators which have been shown to induce chemokine responses. 310
IL-1α could up-regulate the CCL20 mRNA expression and protein production in IEC 311
lines including Caco-2 cells and HT-29 cells (2). IL-1β has been shown to significantly 312
induce CCL2 and CCL20 expression in Caco-2 cells or macrophage (11, 38). Fichorova 313
R. N et al. also demonstrated that IL-1 would induce the secretion of chemokines like 314
CCL2 via NF-κB signaling pathway (9, 33). In line with these reports, NF-κB signaling 315
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
16
pathway was reported to be important for IL-1β-stimulated CCL2 production in rat 316
astrocytes, and MAPK signaling pathway also contributed (39). In addition, IL-1β was 317
able to induce the phosphorylation of p38 MAPK in IEC-6 cells (24). Taken together, the 318
synergism between cytokines, chemokines and L. acidophilus NCFM may be explained 319
as follows: L. acidophilus NCFM induced an early phase response with subsequent 320
cytokine (IL-1αand IL-1β) and chemokine (CCL2 and CCL20) production through 321
TLR2-mediated NF-κB and p38 MAPK signaling pathways in Caco-2 cells. Then the 322
secreted cytokines (IL-1α and IL-1β) might further stimulate the cells through NF-κB and 323
p38 MAPK signaling pathways that initiated a late phase response to express the 324
chemokines (CCL2 and CCL20). However, further studies would be required to 325
determine whether IL-1α and IL-1β have important roles as a chemokine-inducing factor 326
in L. acidophilus NCFM stimulated Caco-2 cells. 327
In this study, our data demonstrated that commensal bacteria L. acidophilus NCFM 328
could induce cytokine and chemokine production in IEC, with the cytokines showing a 329
lower expression level to the bacteria treatment than chemokines. This may help to 330
provide important insight into elaborate the host immune responses triggered by probiotic 331
bacteria. Moreover, L. acidophilus NCFM could induce the TLR2 signaling to trigger 332
cytokine and chemokine expression in IEC through NF-κB and p38 MAPK signaling 333
pathways, and the activation in IEC after L. acidophilus NCFM stimulation is rapid but 334
transient. Although we examined the signaling pathways involved, the study does not 335
fully reveal the mechanisms and further research is needed. Together, this study allows 336
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
17
for a better understanding of how the L. acidophilus NCFM contributes to the innmune 337
responses of the host, and it will be important to establish the basis for further studies on 338
the molecular mechanisms of interactions between commensal bacteria and the host. 339
ACKNOWLEDGEMENTS 340
This study was supported by National Natural Sciende Foundation of China (31171718), 341
National Science and Technology Project (2011AA100902), Program for Changjiang Scholars and 342
Innovative Research Team in University (IRT-0959-203), Key Project of Education Department of 343
Heilongjiang Province (12511z005) and Innovative Research Team Program of Northeast Agriculture 344
University (CXT007-3-2). 345
346
347
348
349
350
351
352
353
354
355
356
357
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
18
REFERENCES 358
1. Altermann E., 2005. Complete genome sequence of the probiotic lactic acid 359
bacterium Lactobacillus acidophilus NCFM. Proceeding of the National Academy of 360
Sciences 102, 3906-3912. 361
2. Arash I., Michael, B.D., Lars, E., Nissi, M., Varki, Martin F.K., 2001. Regulated 362
MIP-3α /CCL20 production by human intestinal epithelium: mechanism for 363
modulating mucosal immunity. American Journal of Physiology Gastrointestinal and 364
Liver Physiology 280, G710-G719. 365
3. Cario E., Podolsky, D.K., 2000. Differential alteration in intestinal epithelial cell 366
expression of Toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. 367
Infection immunity 68, 7010-7017. 368
4. Caro S.D., Tao, H., Grillo, A., Elia C., Gasbarrini, G., Sepulveda, A.R., 369
Gasbarrini, A., 2005. Effects of lactobacillus GG on genes expression pattern in 370
small bowel mucosa. Digestive and Liver Disease 37, 320-329. 371
5. Carter A.B., Knudston, K.L., Monick, M.M., Hunninghake, G.W., 1999. The p38 372
mitogen-activated protein kinase is required for NF-kappaB-dependent gene 373
expression. The role of TATA-binding protein (TBP). Journal of Biological 374
Chemistry 274, 30858-30863. 375
6. Chung W.O., Dale, B.A., 2004. Innate immune response of oral and foreskin 376
keratinocytes: utilization of different signaling pathways by various bacterial species. 377
Infection Immunity 72, 352-358. 378
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
19
7. Eckburg, P.B., Bik, E.M., Bernatein, C.N., Purdom, E., Dethlefsen, L., Sargent, 379
M., Gill, S.R., Nelson, Relman, D.A., 2005. Diversity of the human intestinal 380
microbial flora. Science 308, 1635-1638. 381
8. Eckmann, L., Reed, S.L., Smith, J.R., Kagnoff, M.F., 1995. Entamoeba histolytica 382
trophozoites induce an inflammatory cytokine response by cultured human cells 383
through the paracrine action of cytolytically released interleukin-1 alpha. Journal of 384
Clinical Investigation 96, 1269-1279. 385
9. Fichorova R.N., Tucker, L., Anderson, D.J., 2001. The molecular basis of 386
nonoxynol-9 induced vaginal inflammation and its possible revelance to human 387
immunodeficiency virus type 1 transmission. Journal of Infection Disease 184, 388
418-428. 389
10. Ghgataux C.R., Thuru, X., Gelot, A., Barnich. N., Neut, C., Dubuquoy, L., 390
Dubuquoy, C., Merour, E., Geboes, K., Chamaillard, M., Ouwehand, A., Leyer, 391
G., Carcano, D., Colombel, J.F., Ardid, D., Desreumaux, P., 2006. Lactobacillus 392
acidophilus modulates intestinal pain and induces opioid and cannabinoid receptors. 393
Natural Medicine 10, 35-37. 394
11. Haller D., Bode, C., Hammes, W.P., Pfeifer, A.M.A., Schiffrin, E.J., Blum, S., 395
2000. Non-pathogenic bacteria elicit a differential cytokine response by intestinal 396
epithelial cell/leucocyte co-cultures. Gut 47, 79-87. 397
12. Hayden M.S., Ghosh, S., 2008. Shared principles in NF-kappaB signaling. Cell 132, 398
344-362. 399
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
20
13. Hosoi T., Hirose, R., Saegusa, S., Ametani, A., Kiuchi, K., Kaminogawa, S., 2003. 400
Cytokine responses of human intestinal epithelial-like Caco-2 cells to the 401
nonpathogenic bacterium Bacillus subtilis (natto). International Journal of Food 402
Microbiology 82, 255-264. 403
14. Ismail, A.S., Hooper, L.V., 2005. Epithelial cells and their neighbors. IV. Bacterial 404
contributions to intestinal epithelial barrier integrity. American Journal of Physiology 405
Gastrointest and Liver Physiollogy 289, G779-G784. 406
15. Jung H.C., Eckmann, L., Yang, S.K., Panja, A., Fierer, J., Wroblewska, E.M., 407
Kagnoff, M.F., 1995. Differential cytokine expression in human colon intestinal 408
epithelial cells in response to bacterial invasion. Journal of Clinical Investigation 95, 409
55-65. 410
16. Kagnoff, M.F., Eckmann, L., 1997. Epithelial cells as sensors for microbial 411
infection. Journal of Clinical Investigation 100, 6-10. 412
17. Kim, D.H., Austin, B., 2006. Cytokine expression in leucocytes and gut cells of 413
rainbow trout, Oncorhynchus mykiss Walbaum, induced by probiotics. Reterinary 414
Immunology and Immunopathology 114, 297-304. 415
18. Kim Y. G., Ohta, T., Takahashi, T., Kushiro, A., Nomoto, K., Yokokura, T., 416
Okada, N., Danbara, H., 2006. Probiotic lactobacillus casei actvates innate 417
immunity via NF-κB and p38 MAP kinase signaling pathways. Microbes and 418
Infection 8, 994-1005. 419
19. Kohler, T., McCormick, B.A., Walker, W.A., 2003. Bacteria-enterocyte crosstalk: 420
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
21
Cellular mechanisms in health and disease. Journal of Pediatric Gastroenterology and 421
Nutrition 361, 175-185. 422
20. Konstantinov S. R., Smidt, H., Voss, W.M., Sven, C.M., Singh, S.K., Valence, F., 423
Molle, D., Lortal, S., Altermann, E., Klaenhammer, T.R., Kooyk, Y.V., 2008. S 424
layer protein A of Lactobacillus acidophilus NCFM regulates immature dendritic cell 425
and T cell functions. Proceeding of the National Academy of Sciences 105, 426
19473-19478. 427
21. Lan, J.G., Cruickshank, S.M., Singh, J.C., Farrar, M., Lodge, J.P., Felburg, P.J., 428
Carding, S.R., 2005. Different cytokine responses of primary colonic epithelial cells 429
to commensal bacteria. World Journal of Gastroenterol 11, 3375-3384. 430
22. Lilly, D.M., Stillwell, R.H., 1965. Probiotics: growth-promoting factors produced by 431
microorganisms. Science 147, 747-748. 432
23. Lotz, M., Gutle, D., Walther. S., Menard, S., Bogdan, C., Hornef, M.W., 2006. 433
Postnatal acquisition of endotoxin tolerance in intestinal epithelial cells. Journal of 434
Experimental Medicine 203, 973-984. 435
24. Masaaki, A., Pietro, G.A., Li, D.J. and Reinecker, H.C., 1999. NF-κB-inducing 436
kinase is a common mediator of IL-17-, TNF-α-, and IL-1β-induced chemokine 437
promoter activation in intestinal epithelial cells. Journal of Immunology 162, 438
5337-5344. 439
25. Mavris, M., Sansonetti, P., 2004. Epithelial cell responses. Best Practice ﹠ 440
Research in Clinical Gastroenterology 18, 373-386. 441
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
22
26. Medzhitov, R.C., Janeway, J., 2000. The toll receptor family and microbial 442
recognition. Trends in Microbiology 8, 452-456. 443
27. Melmed, G., Thomas, L.s., Lee, N., Tesfay, S.y., Lukasek, K., Michelsen, K.S., 444
Zhou, Y., Hu, B., Arditi, M., Abreu, M.T., 2003. Human intestinal epithelial cells 445
are broadly unresponsive to Toll-like receptor 2-dependent bacterial ligands: 446
implications for host-microbial interactions in the gut. Journal of Immunology 170, 447
1406-1415. 448
28. Meng, T.T., Stephen, E.G., Beatrice, R., Lione, L.B., Marie, A.D., Jean, Y.C., 449
Raphaelle, B.S., Philipp, J.S.E., Therry, P., 2006. Anti-inflammatory effect of 450
Lactobacilllus casei on Shigella-induced human intestinal cells. Journal of 451
Immunology 176, 1228-1237. 452
29. Miettinen, M., Lehtonen, A., Julkunen, I., Matikainen, S., 2000. Lactobacillus 453
and Streptococci activate NF-κB and STAT signaling pathways in human 454
macrophages. Journal of Immunology 164, 3733-3740. 455
30. O'Hara, A.M., O’Regan, P., Fanning, A., O’Mahony, C., MacSharry, J., Lyons, 456
A., Bienenstock, J., O’Mahony, L., Shanahaan, F., 2006. Functional modulation of 457
human intestinal epithelial cell responses by Bifidobacterium infantis and 458
Lactobacillus salivarius. Immunology 118, 202-215. 459
31. Otte, J.M., Cario, E., Podolsky, D.K., 2004. Mechanisms of cross 460
hyporesponsiveness to toll-like receptor bacterial ligands in intestinal epithelial cells. 461
Gastroenterology 126, 1054-1070. 462
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
23
32. Pedro, A.R., Hoffmann, M., Szcesny, S., Balut, M., Haller, D., 2005. Innate 463
mechanisms for Bifidobacterium lactis to activate transient pro- inflammatory host 464
responses in intestinal epithelial cells after the colonization of germ-free rats. 465
Immunology 115, 441-450. 466
33. Perkins, N.D., 1997. Achieving transcriptional specificity with NF-κB. International 467
Journal of Biochemisitry & Cell Biology 29, 1433-1448. 468
34. Pinto, M.G.V., Gomez, M.R., Seifert, S., Watzl, B., Holzapfl, W.H., Franz, 469
C.M.A.P., 2009. Lactobacilli stimulate the innate immune response and modulate the 470
TLR espression of HT29 intestinal epithelial cells in vitro. International Journal of 471
Food Microbiology 133, 86-93. 472
35. Saccani, S., Pantano, S., Natoli, G., 2002. p38-dependent marking of inflammatory 473
genes for increased NF-kappa Brecruitment. Nature Immunology 3, 69-75. 474
36. Sanders, M.E., Klaenhammer, T.R., 2001. Invited review: The scientific basis of 475
Lactobacillus acidophilus NCFM functionality as a probiotic. Journal of Dairy 476
Science 84, 435-440. 477
37. Shao, L., Serrano, D., Mayer, L., 2001. The role of epithelial cells in immune 478
regulation in the gut. Seminars in Immunology 13, 163-175. 479
38. Veckrman, V., Miettinen, M., Matikainen, S., Lande, R., Giacomini, E., Coccia, 480
E.M., Julkunen, I., 2003. Lactobacilli and streptococci induce inflammatory 481
chemokine production in human macrophages that stimulates Th1 cell chemotaxis. 482
Journal of Leukocyte Biology 10, 1189. 483
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
24
39. Wendy, L.T., Linda, J.V.E., 2009. Inflammatory cytokines stimulate the chemokines 484
CCL2/MCP-1 and CCL7/MCP-7 through NFκB and MAPK dependent pathways in 485
rat astroctes. Brain Research 1287, 47-57. 486
40. Zeuthen, L.H., Fink, L.N., Metzdorff, S.B., Kristensen, M.B., Licht, T.R., 487
Nellemann, C., Frøkiær2, H., 2010. Lactobacillus acidophilus induces a slow but 488
more sustained chemokine and cytokine response in naïve foetal enterocytes 489
compared to commensal Escherichia coli. BMC Immunology 11, 2. 490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
25
FIGURE LEGENDS 505
Figure 1. Kinetics of cytokine and chemokine expression in Caco-2 cells stimulated with 506
L. acidophilus NCFM. Caco-2 cells were stimulated with L. acidophilus NCFM at a MOI 507
of 10 for 0, 2, 4, 8 and 12 h. The Caco-2 cells treated with DMEM were used as a control. 508
Total cellular RNA was extracted at different time points and analyzed by real-time 509
RT-PCR. The bars represented the combined mean value (± SD) of three experiments, *p 510
< 0.05, **p < 0.01. CTR-Control. 511
Figure 2. Kinetics of cytokine and chemokine expression in mice administered 512
intragastrically with L. acidophilus NCFM. The BALB/c mice, which were 10-12 weeks 513
old, were administered intragastrically with L. acidophilus NCFM for 0, 1, 3, 5 and 7 514
days. The mice administered intragastrically with sterile skimmed milk were used as 515
controls. Where indicated, the mice (n=3) were killed, and the IEC (the cecum and colon ) 516
were isolated. The total RNA was extracted and analyzed by real-time RT-PCR. The bars 517
represented the combined mean value (± SD) of three experiments, *p < 0.05. 518
CTR-Control. 519
Figure 3. Changes in expression levels of TLR2 in Caco-2 cells after stimulated with L. 520
acidophilus NCFM. Caco-2 cells were stimulated with L. acidophilus NCFM at a MOI of 521
10 for 0, 0.5, 1, 2 and 4 h. Total protein was extracted as described in Materials and 522
methods. The levels of TLR2 and internal standard protein, GAPDH, were measured by 523
Western Blot with antibodies against the TLR2 and GAPDH. Data show one 524
representative experiment of three independent experiments. 525
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
26
Figure 4. Phosphorylation of NF-κB p65 and p38 MAPK in Caco-2 cells stimulated with 526
L. acidophilus NCFM. Caco-2 cells were stimulated with L. acidophilus NCFM at a MOI 527
of 10 for 0, 0.5, 1, 2 and 4 h. Total protein was extracted as described in Materials and 528
methods. (A), The levels of the phosphorylated forms of p38 MAPK and internal 529
standard protein, GAPDH, were measured by Western Blot with antibodies against the 530
Th(p)-p38 MAPK and GAPDH. (B), The levels of the phosphorylated forms of NF-κB 531
p65 and internal standard protein, GAPDH, were measured by Western Blot with 532
antibodies against the Ser(p)-NF-κB p65 and GAPDH. Data show one representative 533
experiment of three independent experiments. 534
Figure 5. Suppression of L. acidophilus NCFM-stimulated cytokine and chemokine 535
production by NF-κB or p38 MAPK inhibitior. Caco-2 cells were pre-incubated with 536
SB203580 (20 μM) or PDTC (40 μM) for 30 min, and then stimulated with L. 537
acidophilus NCFM at a MOI of 10 for 2 h. The total RNA was extracted and analyzed by 538
real-time RT-PCR. The bars represent the combined mean value (± SD) of three 539
experiments, *p < 0.05, **p < 0.01, ***p < 0.001 compared to the uninhibited groups 540
treated with L. acidophilus NCFM only. CTR-Control. 541
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from
Table 1. Primer sequences of cytokines and chemokines for real-time RT-PCR
Gene Primer sequence 5′→3′ Fragment size (bp)
Human
CCL2 (MCP-1) F, CTCAGCCAGATGCAATCAATG
R, AGATCACAGCTTCTTTGGGACAC
129
CCL20 (MCP-3α) F, TTGACTGCTGTCTTGGATAC
R, TCTGTTTGGATTTGCG
150
IL1β F, GTGGCAATGAGGATGACTTGTTC
R, TTGCTGTAGTGGTCGGAG
130
IL1α F, AGAAGACAGTTCCTCCATTG
R, CTTGGATGTTTAGAGGTTTC
136
GAPDH F, AACGGATTTGGTCGTATTG
R, GCTCCTGGAAGATGGTGAT
214
Mouse
CCL2 F, ACGTGTTGGCTCAGCCAGA
R, ACTACAGCTTCCTTTGGGACACC
136
CCL20 F, TACTGCTGGCTCACCTC
R, ATCTGTCTTGTGAAACCC
112
IL1β F, AAGTTGACGGACCCCA
R, GTGATACTGCCTGCCTGA
126
IL1α F, TCTGCCATTGACCATCTC
R, AATCTTCCCGTTGCTTG
183
GAPDH F, GCCTGGAGAAACCTGCC3’
R, ATACCAGGAAATGAGCTTGACA
200
on July 6, 2018 by guesthttp://cvi.asm
.org/D
ownloaded from