Cytokine 71 (2015) 181–187

Contents lists available at ScienceDirect

Cytokine

journal homepage: www.journals .e lsev ier .com/cytokine

Involvement of the TNF-a/TGF-b/IDO axis in IVIg-induced immunetolerance

http://dx.doi.org/10.1016/j.cyto.2014.10.0161043-4666/� 2014 Elsevier Ltd. All rights reserved.

⇑ Corresponding author at: Department of Research and Development, Héma-Québec, 1070 Avenue des Sciences-de-la-Vie, Québec (Qc) G1V 5C3, Canada. Tel.: +1418 780 4362; fax: +1 418 780 2091.

E-mail address: renee.bazin@hema-quebec.qc.ca (R. Bazin).

Lionel Loubaki a, Dominique Chabot a,b, Renée Bazin a,b,⇑a Department of Research and Development, Héma-Québec, Québec (Qc), Canadab Department of Biochemistry, Microbiology and Bioinformatics, Laval University, Québec (Qc), Canada

a r t i c l e i n f o a b s t r a c t

Article history:Received 9 January 2014Received in revised form 17 October 2014Accepted 28 October 2014

Keywords:Intravenous immunoglobulinTNF-alphaTGF-betaIDOImmunomodulation

The immune tolerance induced by IVIg treatment is generally attributed to its capacity to modulate thefunctions of antigen presenting cells and to induce the expansion of regulatory T cells by mechanismsthat are not well-defined. Herein, we investigated the contribution of the TNF-a/TGF-b/IDO axis toIVIg-induced immune tolerance. We show that high dose IVIg is able to markedly increase the expression(>3 fold) of the well-known tolerogenic cytokine TGF-b in monocytes. In addition, the expression of TNF-a, a pleiotropic cytokine that controls TGF-b-induced tolerogenic effects, as well as of its cognate recep-tors (TNF-R1 and TNF-R2) is also significantly increased following IVIg treatment. Along with TNF-a, theexpression of the enzyme and signaling protein IDO, known to mediate TGF-b dependant tolerogeniceffect, is similarly increased following IVIg treatment. We thus propose that the complex interplaybetween plasticity of immune cells and environmental modifications in which the TNF-a/TGF-b/IDO axismay represent a new mechanism contributing to the development of tolerance in IVIg-treated patients.

� 2014 Elsevier Ltd. All rights reserved.

1. Introduction

The monocyte/macrophage system is a major contributor tohost immunity and immune surveillance against infection. Thesecells play a central role in the initiation and resolution of inflam-mation, principally through phagocytosis, reactive oxygen species(ROS) production, activation of the acquired immune system andrelease of inflammatory mediators such as IL-1b, tumor necrosisfactor-a (TNF-a) and transforming growth factor-b (TGF-b) [1,2].

TGF-b is a cytokine with well-documented anti-inflammatoryproperties such as the inhibition of antigen presentation abilityof macrophages [3–5], the induction of peripheral tolerancethrough modulation of antigen-presenting cell (APC) functions[3,6,7] and the development, maintenance and induction of regula-tory T cells (Treg) [3,8]. The immune tolerance mediated by TGF-b-exposed APCs has been shown to depend on TNF-a and its cognatereceptor expression [9,10]. TNF-a is a pleiotropic cytokine predom-inantly produced by activated monocytes/macrophages whichmediates a variety of cellular responses, including inflammationand cell survival [11–13]. TNF-a produces its biological effectsvia two distinct receptors, the ubiquitously expressed TNF receptor

1 (TNF-R1) and the hematopoietically restricted TNF-R2. Severalstudies suggest that TNF-R1 is the major mediator of TNF-a-induced apoptosis because TNF-R2 lacks the cytoplasmic deathdomain [14–16]. On the other hand, TNF-R2 has been shown tomediate the anti-inflammatory effects of TNF-a through a mecha-nism involving secretion of TGF-b by APCs and through promotionof both expansion and function of Treg cells [10,17].

Along with TNF-a, TGF-b-induced tolerance has been shown toinvolve another protein named indoleamine 2,3-dioxygenase (IDO)[18,19]. IDO is an inducible intracellular enzyme expressed in sev-eral tissues but reaching its highest levels in dendritic cells andmacrophages following stimulation by mediators such as IFN-c,TGF-b and LPS. IDO catalyzes the degradation of the essentialamino acid tryptophan into several biologically active molecules,collectively known as kynurenines and also acts through consump-tion of reactive oxygen species [20,21]. Furthermore, Pallotta et al.showed that independently of its enzymatic function, IDO acts as asignal transducer involved in intracellular signaling events andconfers a stably tolerogenic phenotype to plasmacytoid DCs (pDCs)in response to the immunoregulatory cytokine TGF-b. This in turnresults in a further increase of TGF-b release and contributes to thegeneration of Treg cells [18].

Intravenous immunoglobulin (IVIg) is a highly purified poly-specific immunoglobulin G preparation obtained from pooledplasma of several thousand healthy donors and is widely used to

182 L. Loubaki et al. / Cytokine 71 (2015) 181–187

treat a number of inflammatory and autoimmune diseases [22,23].The mechanisms of immunomodulatory effects of IVIg are incom-pletely understood; they involved suppression of the inflammatoryevents by neutralization of bacterial toxins, autoantibodies or cyto-kines and by interfering with activating Fcc receptor such as Fcc RIand RIII expression but also by modulating the inhibitory receptorFcc RIIB [24,25]. IVIg has also been shown to attenuate inflamma-tion through induction of Treg cells by uncharacterized mecha-nisms, although Tregitopes (small amino acid sequences derivedfrom the IgG molecule) have been proposed to participate in theinduction of these cells [26–30].

To better understand the IVIg-induced peripheral tolerance andthe associated increase in Treg cell expansion, we analyzed theexpression of IDO, TGF-b, TNF-a and its cognate receptors inhuman monocytes in the presence or absence of IVIg. We showedthat IVIg significantly up-regulates TGF-b expression which corre-lates with an increased expression of TNF-a, TNF-R1 and R2. Fur-thermore, we found that addition of IVIg to human monocytessignificantly up-regulates the expression of IDO. Our findingsreveal a new pathway by which IVIg therapy may lead to theinduction of immune tolerance.

2. Materials and methods

2.1. Preparation of human mononuclear cells

This study has been approved by the Héma-Québec’s ResearchEthics Committee and all participants in this study have signedan informed consent. Leukoreduction system (LRS) chambers fromTrima Accel™ collection systems (Gambro BCT, Lakewood, CO)were recovered after routine apheresis. Leukocytes were extractedfrom LRS chambers as previously described [31] and used to isolateperipheral blood mononuclear cells (PBMCs) using Ficoll-Paquedensity gradient following the manufacturer’s instructions (GEHealthcare, Baie d’Urfé, Canada).

2.2. Monocyte isolation and culture

PBMC were washed thrice with PBS containing 0.2% glucose(PBS-glucose) and suspended in PBS containing 2 mM EDTA.Monocytes were purified using the EasySep™ Human MonocyteEnrichment Kit (Stem Cell Technologies, Vancouver, Canada). Toassess purity, cells were labeled with an anti-human CD14-FITCconjugate (BD Bioscience, San Diego, CA) and analyzed by flowcytometry. CD14+ monocyte purity was P95%. The purified mono-cytes were seeded in the wells of a 6-well microplate (Corning,Fisher Scientific Company, Ottawa, Canada), in RPMI 1640 mediumsupplemented with 10% FBS, 2 mM L-glutamine, 1X penicillin–streptomycin, 1 mM sodium pyruvate and allowed to adhere for3 h (h). Wells were washed with PBS and the cells were then cul-tured in the same medium supplemented with 15 mg/mL of IVIgor human serum albumin (HSA) (both from Grifols Canada Ltd.,Mississauga, Canada) for up to 96 h.

2.3. Real Time PCR analysis

Total RNA was extracted from monocytes using the mirVana™miRNA Isolation Kit (Invitrogen, Life Technologies Inc., Burlington,Canada) according to the manufacturer’s instructions. Total RNAconcentration was measured using a NanoDrop Spectrophotome-ter ND-1000 (Thermo scientific, Wilmington, DE). 250 ng of totalRNA was denatured at 65 �C for 10 min and incubated at 37 �Cfor 60 min, with the following mix: 0.5 mM dNTP, 0.25 lg/ml hex-amer (both from GE Healthcare), 200U RT-MMLV and 1X firststrand buffer (Invitrogen) to generate the cDNA. Expression of

TGF-b1 (Fw: CCCAGCATCTGCAAAGCTC; Rv: GTCAATGTA-CAGCTGCCGCA) and GAPDH (Fw: TGGTGAAGACGCCAGTGGA; Rv:GCACCGTCAAGGCTGAGAAC) (all from Integrated DNA Technolo-gies, Inc., Coralville, IA) was quantified using the SybrGreenreagent (Qiagen, Mississauga, Canada) on a Stratagene 3005p sys-tem (Agilent Technologies Inc., Mississauga, Canada).

2.4. Flow cytometry

Monocytes were detached from the microwells using TrypLE™Express recombinant enzyme (Life Technologies Inc.). To avoidunwanted binding of antibodies to human FccR and to allow per-meabilization, cells were incubated for 10 min at 4 �C in PBS con-taining 2% FcR-block reagent (Miltenyi Biotec, Cambridge, MA)and 0.05% saponin prior to labeling to quantitate total (intracellu-lar and surface membrane) expression of the target proteins. Then,unconjugated rabbit polyclonal antibodies directed against TNF-R1(C25C1, #3736), TNF-R2 (#3727) or IDO (#12006) (Cell SignalingTechnology, Danvers, MA), HLA-ABC or HLA-DR (R&D Systems,Minneapolis, MN) were added and incubated for 1 h followed bywashing in PBS containing 0.05% saponin. Alexa Fluor 488-conju-gated goat anti-rabbit IgG (Life technologies) were then added.After another wash step with PBS, the expression of IDO, TNF-R1,TNF-R2, HLA-ABC or HLA-DR was measured on a Partec CyflowML flow cytometer (Partec North America, Inc., Swedesboro, NJ).The data was analyzed using FCS express 4 software (De NovoSoft-ware, Los Angeles, CA).

2.5. ELISA

Culture supernatants of monocytes incubated for 24 h with orwithout IVIg were collected and immediately stored at�80 �C untiluse. For quantification of both TGF-b and TNF-a concentration,ELISA was performed using respectively Human LAP (TGF-b1)ELISA Ready-SET Go kit (eBioscience, San Diego, CA) and HumanTNF-a Mini ELISA Development Kit (PeproTech Inc., NJ) accordingto the manufacturer’s instructions.

2.6. IDO activity

IDO enzymatic activity was determined by measuring the levelsof tryptophan and kynurenine in the monocyte culture superna-tants by high-pressure liquid chromatography (INAF analytical ser-vices, Laval University, Québec, Canada) as previously described[32]. Briefly, tryptophan was detected by its natural fluorescenceat 286-nm excitation and 366-nm emission wavelengths. 3-Nitro-L-tyrosine, used as an internal standard, and kynureninewere determined by ultraviolet absorption at 360 nm. An albu-min-based external standard mix was prepared and included50 lM tryptophan, 10 lM kynurenine (both from Sigma–AldrichCanada Co., Oakville, Canada), and a frozen serum pool. Proteinprecipitation from culture supernatants was achieved by additionof 25 lL of 2 M trichloroacetic acid (Sigma–Aldrich). The reactionvials were immediately vortexed and centrifuged at 12,000 g for6 min at room temperature. Supernatants were collected and ana-lyzed by HPLC. The concentration of the components was calcu-lated according to peak heights and was compared with 3-nitro-L-tyrosine as a reference standard.

2.7. Statistical analyses

All statistical analyses were performed with the Graph-PadInStat software (GraphPad Software Inc., Lajolla, CA). Comparisonof three or more means was done using one-way analysis of vari-ance (ANOVA) with the appropriate post-test (Tukey–Kramer Mul-

L. Loubaki et al. / Cytokine 71 (2015) 181–187 183

tiple Comparisons Test). Values of P < 0.05 were considered to indi-cate statistical significance.

3. Results

3.1. Treatment of monocytes with IVIg results in a significant increasein TGF-b expression

To better understand the mechanisms by which IVIg promotestolerance induction, the expression of TGF-b by monocytes incu-bated for 3, 6 and 12 h in the absence (Ctrl) or presence of15 mg/mL of HSA (protein control) or IVIg was determined byreal-time PCR. The 15 mg/mL dose was selected since this doserepresents the expected increase in plasma IgG concentration fol-lowing administration of therapeutic doses of IVIg in patients withinflammatory disorders [33]. The results showed that addition ofIVIg to resting monocytes results in a significant increase in TGF-b expression (>3 fold) at 12 h (Fig. 1A) but not at 3 or 6 h (datanot shown). Furthermore, ELISA quantitation of TGF-b in culturesupernatants of monocytes incubated for 24 h with 15 mg/mL ofIVIg or HSA confirmed this increased expression at protein level(Fig. 1B). This effect was not due to the high concentration of pro-tein added since HSA, used at the same concentration as IVIg, didnot affect TGF-b expression.

3.2. IVIg affects TNF-a and its cognate receptor expression

The tolerogenic properties of TGF-b-exposed APCs have beenshown to dependent on TNF-a [9]. Therefore, to assess whetheraddition of IVIg modulates TNF-a expression by monocytes, weevaluated the expression of both this cytokine and its receptorsby IVIg-treated cells. Real-time PCR analysis revealed a significantincrease in the expression of TNF-a mRNA (>2 fold) at 6 h follow-ing the addition of IVIg on resting monocytes (data not shown).Furthermore, supernatants were collected 24 h after addition ofIVIg for TNF-a quantitation by ELISA and monocytes were recov-ered after 24, 48, 72 and 96 h and labeled for flow cytometry anal-ysis of TNF-R1 and TNF-R2 expression. The results (Fig. 2A) show amore than 3-fold increased expression of TNF-a secretion in IVIg-treated monocytes, but not in HSA-treated monocytes, thereforeconfirming the specificity of IVIg effect. In addition, flow cytometryanalysis of TNF-a receptors revealed a significant increase in theproportion of monocytes expressing TNF-R1 (Fig. 2B) and TNF-R2(Fig. 2C) when cultured in the presence of IVIg (but not HSA),

A B

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

TGF-

β(fo

ld in

crea

se)

*

n.s.

Ctrl HSA IVIg

Fig. 1. IVIg increases TGF-b expression in monocytes. Human monocytes were culturerespectively for (A) TGF-b mRNA expression analysis by real-time PCR and (B) ELISA quann.s., not significant (ANOVA).

although the difference at 24 h did not reach statisticalsignificance.

3.3. IVIg affects IDO expression

TNF-a and TGF-b have been previously associated with anincreased expression of IDO in APCs. We thus determined theexpression of IDO in untreated and IVIg- or HSA-treated monocytesafter 24, 48, 72 and 96 h of culture by flow cytometry (Fig. 3A). Ourresults revealed an increased expression of IDO following additionof IVIg, which was significant at all time points. To determinewhether the increased expression of IDO was associated with anincreased catabolism of Tryptophan (Trp), the relative amount ofTrp in the culture supernatants recovered after 24 h was deter-mined by HPLC. The results showed no difference in the relativeTrp concentration (Trp/3-NT ratio) for the different conditionstested (Fig. 3B), indicating that although IDO expression wasupregulated in IVIg-treated monocytes at 24 h and beyond, itsenzymatic activity was not increased accordingly. However, wecannot rule out the possibility that IDO activity is increased at timepoints later than 24 h, although previous studies have suggestedthat 24 h is an adequate time point to assess IDO activity in stim-ulated monocytes [34]. Previous studies have also shown that IDOdown-regulated the expression of HLA class I and II molecules. Wethus measured the expression of these molecules on resting andIVIg- or HSA-treated monocytes after 24 h of culture, by flowcytometry. Both HLA class I and II molecule were constitutivelyexpressed (98% of positive cells) on resting and IVIg- or HSA-trea-ted monocytes (data not shown). However, the analysis alsorevealed the absence of modulation in cell surface HLA moleculeexpression, as shown by the similar MFI observed in the differentconditions (Fig. 3C and D).

4. Discussion

In the present report, we showed that the expression of TNF-aand its cognate receptors, of TGF-b and IDO are significantlyincreased in monocytes following IVIg treatment. These moleculeshave all been identified as important mediators for the develop-ment of Treg cells. Therefore, the effect of IVIg on the TNF-a/TGF-b/IDO axis reported here provides new insights into the mech-anisms by which IVIg treatment may induce the development ofimmune tolerance.

Immune tolerance is defined as a stable state in which theimmune system does not react destructively against self-mole-

0

2000

4000

6000

8000

10000

12000

14000

TGF-

β(p

g/m

L)

Ctrl HSA IVIg

n.s.

*

d in media alone (Ctrl) or exposed to 15 mg/mL of HSA or IVIg for 12 and 24 htitation of TGF-b expression. Data are presented as the mean ± SEM (n = 4). ⁄P < 0.05,

0

10

20

30

40

50

60

24H 48H 72H 96H

TNF-

R1

posi

tive

cells

(%)

n.s.

*** * ***

B

0

10

20

30

40

50

60

24H 48H 72H 96H

TNF-

R2

posi

tive

cells

(%)

n.s.

*****

*

C TNF-R2TNF-R1

0

200

400

600

800

1000

1200

Monocytes

Monocytes + HSA

Monocytes + IVIg

TNF-

α(p

g/m

L)

*A

n.s.

Fig. 2. IVIg increases the secretion of TNF-a and the expression of its cognate receptors. Monocytes were cultured without or with either IVIg or HSA (15 mg/mL) for 24, 48, 72and 96 h. (A) ELISA quantitation of TNF-a after 24 h of culture. (B and C) Time course analysis of TNF-R1 (B) and TNF-R2 (C) expression on monocytes. Cells were recoveredand labeled with TNF-R1 or TNF-R2 specific antibodies followed by addition of a secondary AF488-conjugate and analyzed by flow cytometry. Representative histograms(72 h) are shown (light grey, isotype control; hatched, untreated monocytes; dark grey, IVIg-treated monocytes). Data are presented as the mean ± SEM (n = 5 per group).⁄P < 0.05; ⁄⁄P < 0.01; ⁄⁄⁄P < 0.001; n.s, not significant (ANOVA followed by the Tukey–Kramer multiple comparison post-test).

184 L. Loubaki et al. / Cytokine 71 (2015) 181–187

cules, cells or tissues [35]. Induction of tolerance involves twomain categories of mechanisms: central tolerance mechanismsthat result in deletion of the majority of self-reactive T lympho-cytes and peripheral tolerance mechanisms which include T-cellanergy, deletion and suppression mediated by Treg cells [35]. Fail-ure of any of these tolerance mechanisms can result in the devel-opment of autoimmune disease. IVIg is an establishedtherapeutic agent that has shown efficacy in a wide range ofimmune-mediated inflammatory diseases and has been shown toelicit tolerance rather than immunity [36–39]. IVIg-induced toler-ance is achieved through diverse pathways that are incompletelyunderstood but may include binding to multiple major histocom-patibility (HLA) class II molecules and suppression of effector T cellresponses to diverse antigens [26,29]. More recently, the inductionof natural Treg cell expansion, conversion of naïve and/or T effectorcells into adaptive Treg cells (iTreg), upregulation of Treg-associ-ated cytokines and chemokines have been proposed as importantmechanisms of tolerance induction [29,40]. Indeed, Treg cells playa critical role in the maintenance of immunological unresponsive-ness to self-antigens and in the prevention of immune aggressionand autoimmune diseases [41,42].

The IVIg-mediated modulation in TGF-b and TNF-a expressionreported in the present study may thus represent the link betweenIVIg and tolerance induction by Treg cells. Interestingly, increasedplasma concentrations of TGF-b have been reported after IVIg infu-sion for the treatment of childhood autoimmune diseases or

multiple sclerosis [43,44]. In addition, Hecker et al. reported thatthe tolerogenic properties of TGF-b-exposed APCs were dependenton TNF-a, as systemic administration of neutralizing anti-TNF-aantibodies abrogated the tolerance [9]. It should be noted that inthe abovementioned study, APCs were exposed to TGF-b2 whereasin the present study, we looked at TGF-b1 expression by mono-cytes. However, the three TGF-b isoforms (TGF-b1, TGF-b2, andTGF-b3) identified in mammals have been reported to have similarbiological function and to be expressed in different tissues [45,46],suggesting that the observations made by Hecker et al. using TGF-b2 also apply for TGF-b1. Thus, consistent with this, we found thataddition of IVIg to resting monocytes resulted in an increasedexpression of TNF-a associated with stimulation of TNF-R1 andTNF-R2 expression. We also observed an increased synthesis ofTGF-b, which is likely to further stimulate the expression of TNF-a. In addition, the increased interaction between TNF-a with itscognate receptors will sustain the release of TGF-b by the APC, cre-ating a stimulatory loop resulting in a TGF-b/TNF-a dominant envi-ronment prone to favor Treg cell development. Although we didnot directly evaluate the ability of IVIg-treated monocytes toinduce Treg cells or to modulate target cells production of cyto-kines, our data suggest that IVIg could drive a modification of thecytokine environment consistent with tolerance induction. Sur-rounding cells could thus respond to this cytokine change follow-ing increased receptor/ligand interactions, leading to thesecretion of additional cytokines and modifications of cell surface

A

0

10

20

30

40

50

60

70

IDO

-pos

itive

cel

ls (%

)

*

******

***

24H 48H 72H 96H

B

0

50

100

150

200

250

300

350

400

450

HLA

-I ex

pres

sion

(MFI

)

C

0

50

100

150

200

250

300

350

400

450

HLA

-II e

xpre

ssio

n (M

FI)

D

Monocytes

Monocytes + IVIg

Monocytes + HSA

0.00

0.05

0.10

0.15

0.20

0.25

0.30

0.35

Trp/

3-ni

tro-ty

rosi

ne

Fig. 3. Effect of IVIg on IDO expression and activity and on HLA expression. (A) Time course analysis of the expression of IDO on monocytes following incubation for 24, 48, 72and 96 h in the absence or presence of HSA or IVIg (15 mg/ml). The monocytes were recovered, permeabilized and labeled with IDO-specific antibodies followed by additionof a secondary AF488-conjugate and analyzed by flow cytometry. Results show the mean percentage ± SEM of monocytes positive for IDO expression. (B) HPLC quantitation ofTryptophan (Trp) in 24-h cell culture supernatants. 3-nitro-L-tyrosine (3-NT) was used as a reference. (C, D) Expression of HLA class I (C) and HLA class II (D) on untreated andHSA- or IVIg-treated human monocytes after 24hours. Monocytes were recovered and labeled with HLA class I or II-specific antibodies prior to analysis by flow cytometry.Data are presented as the mean ± SEM of individual MFI. Results are representative of 6 independent experiments. ⁄P < 0.05; ⁄⁄⁄P < 0.001 (ANOVA followed by the Tukey–Kramer multiple comparison test).

Fig. 4. Proposed mechanism for TGF-b/TNF-a/IDO axis participation in IVIg-induced tolerance. (1) IVIg binding to APC leads to an increased expression ofTGF-b and TNF-a. (2) TGF-b may further stimulate the expression of TNF-a and itscognate receptors TNF-R1 and TNF-R2 which will sustain release of TGF-b by theAPC. (3) Along with the aforementioned effect, TNF-a may bind to TNF-R2 that isexpressed on Treg cells and increase their immunosuppressive activity. (4) Inaddition to TNF-a, TGF-b may also stimulate IDO expression and use this latter as asignalling protein that further sustains TGF-b production. Overall, these events mayresult in a TGF-b and TNF-a dominant environment which is prone to inducetolerance through several mechanisms including the inhibition of antigen presen-tation and the development, maintenance and induction of Treg cells.

L. Loubaki et al. / Cytokine 71 (2015) 181–187 185

receptor expression that could lead to the development of Tregcells (Fig. 4).

The mechanism by which IVIg increases the secretion of TNF-aand TGF-b is currently unknown but may involve its interactionwith cell surface receptors expressed by monocytes, such as FccRor DCIR. Indeed, it has been shown that cross-linking of FccR onmonocytes by human IgG induces the secretion of TNF-a [47].On the other hand, it has been recently reported that IVIg bindsto DCIR on the surface of murine dendritic cells to induce phos-phorylation of SHP-2 and SHIP-1 leading to the development of tol-erogenic dendritic cells [48]. Since human monocytes also expressDCIR [49] we suggest that both FccR and DCIR could play a role inthe induction of cytokine release by IVIg-treated monocytes.

While TNF-R1 has been initially associated with pro-inflamma-tory effects and induction of apoptosis by TNF-a, it has also beenshown that sustained TNF-R1 signaling induced by a chronic expo-sure to TNF-a is sufficient to suppress T cell functions in vivo, sug-gesting a tolerogenic function for this receptor [50,51]. In additionto TNF-R1, TNF-R2 has been shown to mediate the tolerogeniceffects of TGF-b through a mechanism that involves stimulationof TGF-b expression and thereby promotes both expansion andfunction of Treg cells [10,17]. Direct binding of TNF-a to TNF-R2expressed on Treg cells also contributes to increase their immuno-suppressive activity [17]. Indeed, Masli et al. reported that TGF-b-treated APCs secrete TNF-a which, upon binding to TNF-R2, helpsustain the ability of these cells to induce peripheral toleranceand suppression of delayed type hypersensitivity [9,10], highlight-ing the importance of the interplay between these two cytokinesfor tolerance induction.

186 L. Loubaki et al. / Cytokine 71 (2015) 181–187

We showed that IVIg treatment results in an increased expres-sion of IDO in monocytes. Based on previous studies showing theinduction of IDO in response to TGF-b [19], we propose that theincreased expression observed in the present work is an autocrinephenomenon driven by the IVIg-induced TGF-b production. Ourwork did not reveal an increase in the enzymatic activity of IDO,suggesting that the signaling ability of IDO would be responsiblefor the establishment of immune tolerance. This is consistent withprevious work showing that in a TGF-b–dominated environment,Fyn-mediated phosphorylation of IDO activates a variety of down-stream signaling effectors such as SHPs and noncanonical NF-jBthat further sustain TGF-b production and lead to environmentalchanges that supports the differentiation of Treg cells, thus shiftinginflammation toward tolerance [18,52,53]. Li et al. previouslyreported that IDO expression was associated with a reducedexpression of HLA class I on keratinocytes and suggested that thiscould represent a mechanism by which IDO mediates local immu-nosuppression [54]. In the present work, we did not observe down-modulation in HLA I or II expression, suggesting that IVIg-inducedtolerance is not dependent on a reduction in HLA expression.Rather, IVIg treatment stimulates the production of TNF-a andTGF-b, creating a cytokine environment prone to tolerance induc-tion through several mechanisms including the upregulation ofIDO expression, a key player in initiation and maintenance ofperipheral tolerance.

Altogether, our data suggest the existence of a complex inter-play between plasticity of cellular players of the immune responseand the cytokine environment in which TNF-a/TGF-b/IDO axisplays a key role in the development of tolerance resulting from IVIgtherapy. However, further studies are required to evaluate moreprecisely the role of this axis in the mechanisms by which IVIginduces and controls peripheral tolerance.

Acknowledgments

We thank all the volunteers for their participation in this studyand Marie-Ève Allard for the recruitment of participants and bloodcollection.

LL is the recipient of a post-doctoral fellowship by the NaturalSciences and Engineering Research council of Canada.

References

[1] Janeway Jr CA, Medzhitov R. Innate immune recognition. Annu Rev Immunol2002;20:197–216.

[2] Parihar A, Eubank TD, Doseff AI. Monocytes and macrophages regulateimmunity through dynamic networks of survival and cell death. J InnateImmunol 2010;2:204–15.

[3] Li MO, Wan YY, Sanjabi S, Robertson AK, Flavell RA. Transforming growthfactor-beta regulation of immune responses. Annu Rev Immunol2006;24:99–146.

[4] Takeuchi M, Alard P, Streilein JW. TGF-beta promotes immune deviation byaltering accessory signals of antigen-presenting cells. J Immunol1998;160:1589–97.

[5] Du C, Sriram S. Mechanism of inhibition of LPS-induced IL-12p40 productionby IL-10 and TGF-beta in ANA-1 cells. J Leukoc Biol 1998;64:92–7.

[6] Hara Y, Caspi RR, Wiggert B, Dorf M, Streilein JW. Analysis of an in vitro-generated signal that induces systemic immune deviation similar to thatelicited by antigen injected into the anterior chamber of the eye. J Immunol1992;149:1531–8.

[7] Wilbanks GA, Mammolenti M, Streilein JW. Studies on the induction ofanterior chamber-associated immune deviation (ACAID). III. Induction ofACAID depends upon intraocular transforming growth factor-beta. Eur JImmunol 1992;22:165–73.

[8] Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, et al. Conversion ofperipheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med 2003;198:1875–86.

[9] Hecker KH, Niizeki H, Streilein JW. Distinct roles for transforming growthfactor-beta2 and tumour necrosis factor-alpha in immune deviation elicited byhapten-derivatized antigen-presenting cells. Immunology 1999;96:372–80.

[10] Masli S, Turpie B. Anti-inflammatory effects of tumour necrosis factor (TNF)-alpha are mediated via TNF-R2 (p75) in tolerogenic transforming growthfactor-beta-treated antigen-presenting cells. Immunology 2009;127:62–72.

[11] Natoli G, Costanzo A, Guido F, Moretti F, Levrero M. Apoptotic, non-apoptotic,and anti-apoptotic pathways of tumor necrosis factor signalling. BiochemPharmacol 1998;56:915–20.

[12] Magnusson C, Vaux DL. Signalling by CD95 and TNF receptors: not only life anddeath. Immunol Cell Biol 1999;77:41–6.

[13] Lynch DH. The role of FasL and TNF in the homeostatic regulation of immuneresponses. Adv Exp Med Biol 1996;406:135–8.

[14] Waetzig GH, Rosenstiel P, Arlt A, Till A, Brautigam K, Schafer H, et al. Solubletumor necrosis factor (TNF) receptor-1 induces apoptosis via reverse TNFsignaling and autocrine transforming growth factor-beta1. FASEB J2005;19:91–3.

[15] Ware CF, VanArsdale S, VanArsdale TL. Apoptosis mediated by the TNF-relatedcytokine and receptor families. J Cell Biochem 1996;60:47–55.

[16] Luo X, Budihardjo I, Zou H, Slaughter C, Wang X. Bid, a Bcl2 interacting protein,mediates cytochrome c release from mitochondria in response to activation ofcell surface death receptors. Cell 1998;94:481–90.

[17] Chen X, Baumel M, Mannel DN, Howard OM, Oppenheim JJ. Interaction of TNFwith TNF receptor type 2 promotes expansion and function of mouseCD4+CD25+ T regulatory cells. J Immunol 2007;179:154–61.

[18] Pallotta MT, Orabona C, Volpi C, Vacca C, Belladonna ML, Bianchi R, et al.Indoleamine 2,3-dioxygenase is a signaling protein in long-term tolerance bydendritic cells. Nat Immunol 2011;12:870–8.

[19] Fallarino F, Grohmann U, Puccetti P. Indoleamine 2,3-dioxygenase: fromcatalyst to signaling function. Eur J Immunol 2012;42:1932–7.

[20] Mulley WR, Nikolic-Paterson DJ. Indoleamine 2,3-dioxygenase intransplantation. Nephrology (Carlton) 2008;13:204–11.

[21] Mellor AL, Munn DH. IDO expression by dendritic cells: tolerance andtryptophan catabolism. Nat Rev Immunol 2004;4:762–74.

[22] Lemieux R, Bazin R, Neron S. Therapeutic intravenous immunoglobulins. MolImmunol 2005;42:839–48.

[23] Gelfand EW. Intravenous immune globulin in autoimmune and inflammatorydiseases. N Engl J Med 2012;367:2015–25.

[24] Nimmerjahn F, Ravetch JV. FcgammaRs in health and disease. Curr TopMicrobiol Immunol 2011;350:105–25.

[25] Schwab I, Nimmerjahn F. Intravenous immunoglobulin therapy: how does IgGmodulate the immune system? Nat Rev Immunol 2013;13:176–89.

[26] Cousens LP, Najafian N, Mingozzi F, Elyaman W, Mazer B, Moise L, et al. In vitroand in vivo studies of IgG-derived Treg epitopes (Tregitopes): a promising newtool for tolerance induction and treatment of autoimmunity. J Clin Immunol2013;33(Suppl 1). S43-9.

[27] Massoud AH, Guay J, Shalaby KH, Bjur E, Ablona A, Chan D, et al. Intravenousimmunoglobulin attenuates airway inflammation through induction offorkhead box protein 3-positive regulatory T cells. J Allergy Clin Immunol2012;129(1656–65):e3.

[28] Olivito B, Taddio A, Simonini G, Massai C, Ciullini S, Gambineri E, et al.Defective FOXP3 expression in patients with acute Kawasaki disease andrestoration by intravenous immunoglobulin therapy. Clin Exp Rheumatol2010;28:93–7.

[29] Cousens LP, Tassone R, Mazer BD, Ramachandiran V, Scott DW, De Groot AS.Tregitope update: mechanism of action parallels IVIg. Autoimmun Rev2013;12:436–43.

[30] Su Y, Rossi R, De Groot AS, Scott DW. Regulatory T cell epitopes (Tregitopes) inIgG induce tolerance in vivo and lack immunogenicity per se. J Leukoc Biol2013.

[31] Neron S, Dussault N, Racine C. Whole-blood leukoreduction filters are a sourcefor cryopreserved cells for phenotypic and functional investigations onperipheral blood lymphocytes. Transfusion 2006;46:537–44.

[32] Hainz U, Obexer P, Winkler C, Sedlmayr P, Takikawa O, Greinix H, et al.Monocyte-mediated T-cell suppression and augmented monocyte tryptophancatabolism after human hematopoietic stem-cell transplantation. Blood2005;105:4127–34.

[33] Imbach P, Wagner HP, Berchtold W, Gaedicke G, Hirt A, Joller P, et al.Intravenous immunoglobulin versus oral corticosteroids in acute immunethrombocytopenic purpura in childhood. Lancet 1985;2:464–8.

[34] von Bubnoff D, Matz H, Frahnert C, Rao ML, Hanau D, de la Salle H, et al.FcepsilonRI induces the tryptophan degradation pathway involved inregulating T cell responses. J Immunol. 2002;169:1810–6.

[35] Pugliese A. Central and peripheral autoantigen presentation in immunetolerance. Immunology 2004;111:138–46.

[36] Kazatchkine MD, Kaveri SV. Immunomodulation of autoimmune andinflammatory diseases with intravenous immune globulin. N Engl J Med2001;345:747–55.

[37] Nimmerjahn F, Ravetch JV. Anti-inflammatory actions of intravenousimmunoglobulin. Annu Rev Immunol 2008;26:513–33.

[38] Tha-In T, Bayry J, Metselaar HJ, Kaveri SV, Kwekkeboom J. Modulation of thecellular immune system by intravenous immunoglobulin. Trends Immunol2008;29:608–15.

[39] Zambidis ET, Scott DW. Epitope-specific tolerance induction with anengineered immunoglobulin. Proc Natl Acad Sci USA 1996;93:5019–24.

[40] Maddur MS, Othy S, Hegde P, Vani J, Lacroix-Desmazes S, Bayry J, et al.Immunomodulation by intravenous immunoglobulin: role of regulatory Tcells. J Clin Immunol 2010;30(Suppl 1):S4–8.

[41] Tang Q, Bluestone JA. The Foxp3+ regulatory T cell: a jack of all trades, masterof regulation. Nat Immunol 2008;9:239–44.

[42] Miyara M, Sakaguchi S. Natural regulatory T cells: mechanisms of suppression.Trends Mol Med 2007;13:108–16.

L. Loubaki et al. / Cytokine 71 (2015) 181–187 187

[43] Rissmann A, Pieper S, Adams I, Brune T, Wiemann D, Reinhold D. Increasedblood plasma concentrations of TGF-beta1 and TGF-beta2 after treatment withintravenous immunoglobulins in childhood autoimmune diseases. PediatrAllergy Immunol 2009;20:261–5.

[44] Reinhold D, Perlov E, Schrecke K, Kekow J, Brune T, Sailer M. Increased bloodplasma concentrations of TGF-beta isoforms after treatment with intravenousimmunoglobulins (i.v.IG) in patients with multiple sclerosis. J Neuroimmunol2004;152:191–4.

[45] Govinden R, Bhoola KD. Genealogy, expression, and cellular function oftransforming growth factor-beta. Pharmacol Ther 2003;98:257–65.

[46] Zhang XL, Selbi W, de la Motte C, Hascall V, Phillips AO. Bone morphogenicprotein-7 inhibits monocyte-stimulated TGF-beta1 generation in renalproximal tubular epithelial cells. J Am Soc Nephrol 2005;16:79–89.

[47] Debets JM, Van de Winkel JG, Ceuppens JL, Dieteren IE, Buurman WA.Cross-linking of both Fc gamma RI and Fc gamma RII induces secretionof tumor necrosis factor by human monocytes, requiring high affinityFc-Fc gamma R interactions. Functional activation of Fc gamma RII bytreatment with proteases or neuraminidase. J Immunol 1990;144:1304–10.

[48] Massoud AH, Yona M, Xue D, Chouiali F, Alturaihi H, Ablona A, et al. Dendriticcell immunoreceptor: a novel receptor for intravenous immunoglobulinmediates induction of regulatory T cells. J Allergy Clin Immunol 2014;133(853–63):e5.

[49] Geijtenbeek TB, Gringhuis SI. Signalling through C-type lectin receptors:shaping immune responses. Nat Rev Immunol 2009;9:465–79.

[50] Cope AP, Liblau RS, Yang XD, Congia M, Laudanna C, Schreiber RD, et al.Chronic tumor necrosis factor alters T cell responses by attenuating T cellreceptor signaling. J Exp Med 1997;185:1573–84.

[51] Chatzidakis I, Mamalaki C. T cells as sources and targets of TNF: implicationsfor immunity and autoimmunity. Curr Dir Autoimmun 2010;11:105–18.

[52] Chen W. IDO: more than an enzyme. Nat Immunol 2011;12:809–11.[53] Hoshino K, Sugiyama T, Matsumoto M, Tanaka T, Saito M, Hemmi H, et al.

IkappaB kinase-alpha is critical for interferon-alpha production induced byToll-like receptors 7 and 9. Nature 2006;440:949–53.

[54] Li Y, Tredget EE, Ghahary A. Cell surface expression of MHC class I antigen issuppressed in indoleamine 2,3-dioxygenase genetically modifiedkeratinocytes: implications in allogeneic skin substitute engraftment. HumImmunol 2004;65:114–23.