Gene, 126 (1993) 179-185 0 1993 Elsevier Science Publishers B.V. All rights reserved. 0378-l 119/93/$06.00 179

GENE 07047

Induction of the murine class-II antigen-associated invariant chain by TNF-a is controlled by an NF-KB-like element

(Transcriptional regulation; DNA-protein interactions; recombinant DNA; cytokines; tumor necrosis factor; human growth hormone)

Daniel P. Kolk and Georgia Floyd-Smith

Department of Zoology, Arizona State University, Tempe, AZ, 85287, USA

Received by D. Denhardt: 5 June 1992; Revised/Accepted: 9 December/10 December 1992; Received at publishers: 18 January 1993

SUMMARY

The murine class-II antigen-associated invariant chain (Ii) is a glycoprotein whose synthesis is co-regulated with the major histocompatibility class-II antigens. The Zi mRNA is inducible by tumor necrosis factor-a (TNF-cl). An NF-KB protein-binding site (NBS), located in the Zi promoter at bp - 121 to - 111, confers TNF-a inducibility on chimeric reporter constructs expressing the human growth hormone-encoding gene. A distal NF-KB-like protein-binding site (NBLS) located at bp -167 to -157 is not required for TNF-a inducibility, and deletion of this distal NBLS results in increased constitutive, as well as TNF-a-induced, expression of the reporter gene. The NBS is well protected during DNase I footprinting assays and specifically binds proteins in electrophoretic mobility shift assays. A distinct protein- DNA complex is observed when nuclear extracts from TNF-a-treated L-cells are used; this complex is not seen in extracts from untreated cells.

INTRODUCTION

The class-II antigen-associated invariant chain (Ii) is an intracellular glycoprotein that is required for antigen processing and presentation by major histocompatibility

Correspondence to: Dr. G. Floyd-Smith, Department of Zoology, Arizona State University, Tempe, AZ 85287-1501, USA. Tel. (602)965-6918; Fax (602)965-2519.

Abbreviations: bp, base pair(s); CAT, chloramphenicol acetyltransfer- ase; EMSA, electrophoretic mobility shift assay; FBS, fetal bovine serum; Hepes, 4-[2-hydroxyethyl]-l-piperazine-N’[2-ethanesulfonic acid]; hGH, human growth hormone; hGH, gene encoding hGH, Ii, murine class-11 antigen-associated invariant chain; li, gene encoding Ii; ZSRE, interferon-stimulated response element; kb, kilobase or 1000 bp; MEM, modified Eagle’s medium; MHC, major histocompati- bility complex; N, A or C or G or T, NBLS, NF-KB-like-binding site; NBS, NF-kB-binding site; NF-KB, immunoglobulin light-chain enhancer-binding protein; oligo, oligodeoxyribonucleotide; PCR, poly- merase chain reaction; R, C or T, Sp-1, general transcription factor for DNA polymerase II; TNF-u, tumor necrosis factor-a; tsp, transcription start point(s); Y, A or G.

complex (MHC) class-II antigens (reviewed in Benoist and Mathis, 1990). Two forms of Ii, of 31 and 41 kDa, are translated from mRNAs generated by alternative splicing of a single gene (Koch et al., 1987) located on mouse chromosome 18 (Yamamoto et al., 1985). Ii, like the class-II antigens, is inducible by TNF-cr (Pessara and Koch, 1990), a cytokine which has both anti-tumor and immunomodulatory effects (reviewed in Arai et al., 1990 and Fiers et al., 1989). TNFs induce a wide array of pro- teins including interferon-y, and the MHC class-1 and class-II antigens (Arai et al., 1990; Fiers et al., 1989). Inducibility of an MHC class-I gene by TNF-u is medi- ated through an element containing two sequences, S- GGGGAAGCCCA and T-GGGGATTCCCC (Israel et al., 1989), that bind the Rel-NF-KB family of transcrip- tion factors (reviewed in Lenardo and Baltimore, 1989). Israel et al. (1989) have shown that TNF-a can induce gene expression by activating NF-KB, which is present in an inactive form in most cell types. The role of additional factors that bind to NF-KB-binding sites (NBS) such as

180

c-Rel (Sica et al., 1992) and PRDII-BFI (Fan and Maniatis, 1990) in the regulation of TNF-a-inducible genes has yet to be established.

The aim of the present study was to examine induction of li by TNF-a in murine L-cells. The role of two cis- acting elements, NBS and a distal NF-KB-like-binding site (NBLS), in mediating TNF-a induction was investi- gated using Ii deletion constructs ligated to the human growth hormone (hGH) reporter gene. DNase I foot- printing analysis and electrophoretic mobility shift assays (EMSA) demonstrated the presence of proteins specifi- cally binding to the NBS and NBLS. Only one of these two elements, the NBS, was required for TNF-cl induced expression of Ii.

RESULTS AND DISCUSSION

(a) Induction of Zi by TNF-a TNF-a strongly induces synthesis of mouse Ii in rat-2

fibrobiasts transfected with a mouse Ii gene construct containing the entire protein-coding sequence and 802 bp of S-ff anking sequences (Pessara and Koch, 1990). In some murine cell lines, such as the pre-B-cell line, 702/3,

Ii is not induced by TNF-a (Pessara and Koch, 1990). In murine L-cells, 9 h treatment with 50 ng TNF-a/ml induces synthesis of native Ii mRNA 3-4-fold, as deter- mined by Northern blot analysis (data not shown). L-cells, therefore, are among those cell types exhibiting responsiveness to TNF-a for induction of Zi.

(b) Role of the S-flanking sequences in mediating induction of Zi by TNF-&

In order to identify elements regulating Ii expression in L-cells, deletion constructs containing portions of the Ii 5’-flanking sequence were cloned into the reporter plas- mid, pOGH, which encodes hGH, as described in Table I. The genomic clone, CoslO.7, generously provided by Michael Steinmetz (Hoffman-La Roche, Basel, Switzerland), was used to subclone Ii (Koch et al., 1987) into pGEM-3zf(-t-) (Promega, Madison, WI, USA). One of the isolated subclones, plasmid pDKIi-2, has a 1.6-kb EcoRI-Sac1 insert containing the promoter region of Zi, the first exon and a portion of the first intron. The insert from this clone was used as a template for amplification of Ii sequences using PCR (Saiki et al., 1988). Oligos used in plasmid construction and the recombinant plasmids are given in Table I.

TABLE I

Oligos and plasmid constructs

Oligo” Sequence locationb

(nt)

Plasmid

S-TGGCCAGCCAATGGG -208 to -194 S-TAG~AA~T~C~CC~~ATCCTGC~CA -169 to -143 S-GTGAGTGGGGAA~CCAGA~ -127 to -106 S-AGATTTGTGGCTTTCAGTTCCACATCTACC -110 to -81 S’-TTTCAGTTCCACATCTACC -99 to -81 5’-GGGCGAATCAGATTCCTTCC -57 to -38 5’-agctTAGGGAACTCCCCCTTCATCCTGCCCAGGGAGGCAGCTTTGAd -169 to -128

pOGH-208 pOGH-169 pOGH-127 pOGH-110 pOGH-100 pOGH-57 pOGH-ANF-KB

“Methodr Automated oligo synthesis was done on a Coder 300 DNA Synthesizer (DuPont Co., Wilmington, DE, USA). Oligos, except for the last one corresponding to nt -168 to -128, were used as the 5’ primers for amplification of segments of li using PCR (Saiki et al., 1988) on a Cetus thermal cycler (Cetus Corporation, Emeryville, CA, USA). The 1.6-kb EcoRI-PstI fragment from pDKIi-2 was isolated and used as a template for all PCR reactions. In these reactions, the sequence, S-CCCACAGGCGCTGCTGCT (Ii from f52 to +69), was used as the 3’ anti-sense primer, Reaction mixtures (100 pl) contained 20 ng of template in 50mM KCl/lO mM TriseHCl pH 9.Ojl.S mM MgCl,/O.l% Triton X100/2.5 mM dATP, dGTP, dCTP, dTTP/l% formamide/l ug each of synthetic oligo primers/l unit of Taq polymerase. Thermal cycle parameters were 1 min at 94”C, 2 mm at 48”C, 3 min at 72°C for 30 cycles. 10 ,ul of reaction products were analyzed on a 1.8% agarose gel to verify proper amplification. MgCI, was added to each reaction to bring the final concentration to 10 mM and 2 units of E. coli DNA polymerase I (Klenow fragment) added to each reaction to remove non-template added nt from the 5’ ends of the PCR products. Reaction mixtures were incubated at room temperature for 30 min and extracted with chloroform to remove the paraffin oil overlay. The aqueous phase was isolated and DNA precipitated in 0.8 M LiCl and 2 ~01s. ethanol. The PCR reaction products were resuspended in polynucleotide kinase buffer [lOmM Triseacetate pH 7S/lOmM Mgqacetate/SOmM K-acetate] containing 1 mM ATP and incubated at 37°C for 30 min with 1 unit of T4 polynucleotide kinase to phosphorylate the 5’ ends. ‘The location of oligos in ii is given using the numbering of Zhu and Jones (1989). ‘Methods: Inserts were synthesized using PCR and cloned into the H&II site of pOGH, a vector expressing kGZ& which was obtained from Nichols Institute (San Juan Capistrano, CA, USA). For construction of pOGH-ANF-lcB, an digo containing nt -169 to -128 and a HindIII half-site was synthesized along with its complement. These complementary oligos were annealed and ligated into the Hind111 site of pOGH-110. The construct, pOGH-ANF-h-B, therefore contains li sequences at nt - 169 to - 128, a 17-bp spacer sequence, S-agcttgggcctgcaggtc, and Ii sequences at nt - 110 to f69. All plasmids were sequenced using either the dideoxy method (Sanger et al., 1980) according to the manufacturers protocol (US Biochemicals, Cleveland, OH, USA) or the chemical cleavage method (Maxam and Gilbert, 1980). dLowercase letters designate a Hind111 half-site.

181

Deletion constructs were designed to contain or exclude sequences resembling the NF-KB-binding consen- sus sequence (NBS). Table II shows sequences in the Ii resembling the NBS along with the NBS in the mouse Ig K enhancer and the consensus NBS (Lenardo and Baltimore, 1989). The Zi sequence from nt - 167 to - 157 contains a region (NBLS) differing from the NBS by 1 bp. The nt - 121 to - 111 sequence is the same as the NBS and differs from the immunoglobulin K enhancer by 1 bp. The sequence from nt -105 to -95 differs from the NBS by 3 bp. This region overlaps a DNA segment resembling another putative regulatory element, the interferon- stimulated response element (ISRE) that has been shown to confer interferon-y inducibility on human Zi (Barr and Saunders, 1991). Fig. 1A shows the Ii region between nt - 168 and - 31 with the NBS, NBLS, ISRE-like elements, and Spl-like-binding sites (Dynan and Tjian, 1983) boxed. Fig. 1B illustrates the deletion constructs which either retain or lack the indicated putative regulatory elements.

To identify c&acting elements involved in regulation of Ii expression, deletion constructs were transfected into L-cells and either left untreated, or treated with TNF-cr for 12 h. Plasmid pCAT control was used as a control for transfection efficiency. Fig. 2 shows the results of tran- sient transfection assays using pOGH-208, pOGH-169, pOGH- 127, pOGH-ANF-KB, pOGH- 110 and pOGH- 57. The levels of hGH produced by control L-cells transfected with pOGH-208 and pOGH-169 were com- parable, whereas control L-cells transfected with pOGH- 110 showed a 50% decrease in hGH production, as did transfection with pOGH-100 (not shown). Deletion of the ISRE-like element and the distal Spl-binding site in pOGH-57 resulted in a tenfold further decrease in hGH secretion, suggesting that either one or both of these ele- ments are critical for basal level expression. Treatment of L-cells, transfected with pOGH-208 and pOGH-169, with TNF-a resulted in a 1.5- to twofold increase in hGH

TABLE II Ii sequences resembling NBS

Gene”

(nt)

Sequenceb

Invariant chain (-168 to - 155) aGGGAACTCCCCct Invariant chain (-122 to -109) tGGGGAATTTCCag Invariant chain (- 106 to - 93) t TGTGGCTTTCAgt Mouse Ig K enhancer GGGGACTTTCC

Consensus GGGGR:TYYCC T

“The last two sequences are taken from Lenardo and Baltimore (1989). bThe NBS and similar sequences are in uppercase letters, whereas flanking sequences are in lowercase letters. R = A or G, Y = C or T.

B “BLS i =

-190

pmH.2M -2as I poQn_lso -lb I poQn.1n -127 / poGl+dWhe -169 M -____il

poQH.l,O -110 1 p0an.m -1M) .

PJQW 4771 Y

Fig. 1. Nucleotide sequence of the Ii promoter and deletion constructs used to investigate TNF-a induction. (A) The nt sequence of the Ii

promoter from nt - 168 to - 3 1. The NBS, NBLS, ISRE-like elements, and Spl-like-binding sites are boxed. (B) The Ii gene from nt -190 to + 69 is diagramed with filled boxes indicating the TTTAA box, as well as the NBS, NBLS, ISRE-like elements and Spl-like-binding sites. The major tsp +1 is indicated by a bent arrow. The open box designates an CAG repeat (Koch et al., 1987). Below are shown deletion constructs used in transient transfection assays. The reporter gene, hGH, is indicated.

production. TNF-a responsiveness was not seen in cells transfected with deletion constructs pOGH-110, pOGH- 100 or pOGH-57, which lack NBLS and NBS. In order to delineate more precisely the roles of NBS and NBLS, L-cells were also transfected with the plasmids, pOGH- 127 and pOGH-ANF-KB, in which the NBLS and NBS were deleted, respectively. In the construct pOGH-ANF- KB, the sequences from nt - 127 to - 111 are replaced by sequences from the multiple cloning site (polylinker) of pOGH, in order to maintain a constant distance between putative regulatory elements and the tsp. These sequences are present in all constructs used. The levels of hGH secreted by untreated cells transfected with pOGH- 127 were 1.5- to twofold higher than cells transfected with constructs containing both the NBS and NBLS. Treatment of cells transfected with pOGH-127, with TNF-a, resulted in a 1.5- to twofold increase in hGH levels above that seen for untreated controls. These data suggest that the NBS is sufficient for TNF-a inducibility, and deletion of the upstream NBLS increases hGH pro- duction. Expression of hGH from the construct pOGH- ANF-KB was not significantly different from that of pOGH-110 and was not responsive to TNF-a, suggesting that the NBLS does not enhance expression of the Zi promoter in either control or TNF-a-treated cells. The single-bp change, G to A, appears to result in a non- functional element or an element that suppresses gene expression. Therefore, in the Zi promoter, unlike that of

182

pOGH-208 pOGH-169 pOGH-127 pOGH-ANF& pOGH-110 pOGH-57

Fig. 2. Functional analysis of the li promoter region. Levels of hGH secreted by L-cells transiently transfected with the indicated recombi- nant plasmids were determined. The percent of hGH (ng)/ CAT protein (pg) secreted was determined and plotted as % of control. The means of four replicate determinations are given with error bars indicating the standard deviation. Open bars, control cells, filled bars, TNF-a-treated cells. Methods: L-cells from Dr. B. Jacobs (Arizona State University, Tempe, AZ, USA) were grown in Dulbecco-modified MEM supple- mented with 5% fetal bovine serum (FBS) at 37°C with 6% CO*. L-cells were transfected with 5 pg of reporter plasmid and 0.5 ug of the reference plasmid using the method described by Golub et al. (1989). hGH levels were assayed 48 h post-transfection in control cells or cells treated with TNF-a (25 ng/ml) for 12 h. The Allegro hGH transient gene expression assay (Nichols Institute, San Juan Capistrano, CA, USA) was used to quantitate secreted hGH by measuring specific binding of an iz51- labeled monoclonal antibody. Assays were performed as recommended by the manufacturer and counted in a liquid scintillation counter (Tri- Carb 16OOTR, Packard Instrument Co., Meriden, CT, USA). The hGH secreted (ng/lOO ~1) was calculated using a standard containing a known amount of hGH. The reference plasmid, pCAT Control, which produces CAT was from Promega (Madison, WI, USA). Levels of CAT (pg/20 pg protein) were determined using an immunoassay kit from 5 Prime- 3 Prime, Inc. (Boulder, CO, USA), according to the manufacturer’s protocol.

the MHC class-1 genes (Israel et al., 1989), only one NBS appears to be involved in mediating TNF-cl induction.

(c) DNA-protein interactions in the Zi promoter region In order to identify the regions of direct protein-DNA

contact, DNase I footprinting assays were performed on the Zi promoter region from nt - 32 to - 272, as shown in Fig. 3. In addition to the NBS and NBLS elements, this region of DNA contains the H, X, and Y box ele- ments previously identified as important tissue-specific c&acting regulatory elements in the class-II antigen- encoding genes and in Zi (Benoist and Mathis, 1990). Several regions of the DNA were protected by proteins from L-cell nuclear extracts. The Y box and X box regions were protected, as well as a region which contains a GAANYY repeat, located between the X and Y boxes which is not conserved between the Zi and class-II anti- gen-encoding genes. The H box was weakly protected.

-61- *

-7th

-124- -I

2

-163- 1 N2 i

-ias- -lQO-

-I

Fig. 3. DNase I footprint of the li promoter region from nt -32 to -272. The numbers on the left margin designate nt into the Zi sequence, as determined by the electrophoretic mobility of size markers. Arrows show some DNAse I-hypersensitive regions. The locations of an Spl- like-binding site(S), NBS (Nl), NBLS (N2), the Y, X and H box regions, and a GAANYY repeat (G) region are indicated. Lanes: C, no nuclear extract; 1, 150 pg nuclear extract protein; 2, 200 pg nuclear extract protein; 3,250 ug nuclear extract protein. Methods: L cells were grown in suspension in autoclavable MEM with (all per ml) 50 ug gentamicin sulfate/ 2.25% NaHCO,/ 110 ug Na.pyruvate/292 ug L-glutamine/l mg glucose/l00 uM non-essential aa. Large-scale nuclear extracts were pre- pared from 3~10~ L-cells grown in suspension culture, collected and lysed as described previously (Dynan, 1987). Protein concentrations were determined by the method of Bradford (1976), as recommended by the reagent manufacturer (Bio-Rad Laboratories, Richmond, CA, USA), using bovine y-globulin as a standard. Plasmid pDKIi-5.200, which was originally subcloned from pDKIi-2, contains an insert which is a multimer of three tail-to-head repeats of the region from nt -272 to -18 cloned into the XbaI site of pGEM-3zf(+). An EcoRI-PstI frag- ment from this plasmid was labeled at the 3’ end of the non-coding strand by extension of the EcoRI recessed end with [a-32P]dATP and DNA polymerase I, Klenow fragment. DNase I footprinting was done as described (Dynan, 1987), except that calf thymus DNA was omitted. The samples were analyzed on a 6% sequencing gel (Maxam and Gilbert, 1980).

183

Strong DNase I protection was observed over the NBS and adjacent sequences from nt - 126 to -96. This strongly protected region overlaps with the ZSRE-like sequence from nt -102 to -83. Protection was also observed over an Spl-binding site from nt -79 to - 70. The region containing the NBLS (nt - 167 to - 157) was weakly protected. The region between -185 and -170 contains DNase I-hypersensitive sites, as does the region between -155 and -126. The region between -96 and -84 also has a DNase I-hypersensitive site, as does the region between -70 and - 61. Protected regions of the DNA thus appear to be bordered by DNase I-hypersensitive sites. These data support the concept that nuclear factors are interacting specifically with the putative regulatory elements located in the Zi promoter.

Since the NBS was required for responsiveness to TNF-a, the effect of TNF-cx on factor binding to this NBS region of the Ii promoter was examined using an electro- phoretic mobility shift assay (EMSA). Fig. 4 shows the results from an EMSA using the NBS and nuclear extracts from untreated L-cells (lane 2) and L-cells treated TNF-cl (lanes 3-12). Two complexes, Bz and B3, form when nuclear extracts from control cells are used. TNF- c1 treatment of cells results in the appearance of a novel B TNFa complex, having a slower electrophoretic mobility. Unlabeled NBS sequence (self-oligo) competes for factor binding as shown in lanes 4-6. A 15-fold molar excess of unlabeled NBS competes for BTNFDI, whereas a 150-fold and 1500-fold excess of unlabeled self-oligo are required to displace B, and B,, respectively. The ZSRE-like sequence competes poorly for BTNFIl and Bz, but does appear to compete for B3 complex formation. The NBLS competes for binding of BTNF_,, and B3 when present at a 150-fold excess. TNF-cl treatment thus appears to induce a factor that binds specifically to the NBS. Experiments currently in progress are intended to charac- terize the TNF-a-induced factor which has been shown to have the same mobility in EMSA gels as a factor found in a B-cell line (data not shown).

Factor binding to the NBLS has also been observed as shown in Fig. 5. Treatment of cells with TNF-a does not result in the induction of a novel complex binding to this region, but does appear to increase the amount of protein bound in the major complex, B. A 500-fold molar excess of self-oligo competes for binding in this complex whereas the ZSRE-like sequence and the NBS do not compete. Since the NBLS appears to play no role in TNF- u inducibility, protein binding to this distal region may be involved in other regulatory function or may play a role in suppressing transcription.

The NBS is known to bind several factors in addition to NF-KB (Sica et al., 1992; Fan and Maniatis, 1990). Interestingly, one factor, c-Rel, has been shown to bind

NBS ISRE NBS

P i? -II-

ETNFa,

B2.

&Jr

F.

123456 7 6 9 10 11 12

Fig. 4. A TNF-a inducible factor binds specifically to the NBS in the fi promoter. Oligos and their respective complements were synthesized, annealed, and the recessed ends extended by DNA polymerase I (Sequenase; U.S. Biochemicals, Cleveland, OH, USA). The target sequence oligo was 5’-TGAGTGAGTGGGGAATTTCCAGA which corresponds to nt -130 to -108 of the Ii promoter. The target oligo (2 ug) was labeled by annealing two partially complementary oligos, 5’-TGAGTGAGTGGGGA and 5’-TCTGGAAATTCCCCA, and incu- bating them in a reaction mixture containing 2.5 mM unlabeled dATP, dGTP, and dTTP and [u32P]dCTP (3000 Ci/mmol), and Sequenase (U.S. Biochem., Cleveland, OH, USA) in Sequenase buffer. The labeled oligos were column purified (Nuctrap; Statagene, La Jolla, CA, USA). Unlabeled competitor oligos were this same sequence (lanes 4-6), the sequence 5’-AGATTTGTGGCTTTCAGTTCCACATCTACCATG corresponding to nt -110 to -78 of the li promoter (lanes 7-9), or thesequence,S-AGCTTAGGGAACTCCCCCTTCATCCTGCCCA- GGGAGGCAGCTTTGA,correspondingtont -169to -1280fthe li promotor and the Hind111 half-site. Unlabeled competitor DNA was present at 1, 10, or 100 ng as indicated which corresponds to a 15-, 150- and 1500-fold excess, respectively. Methods: L-cells were main- tained as described in the legend to Fig. 1 and mock treated or treated with 25 ng/ml of TNF-a for 2 h. Small-scale nuclear extracts from ten tissue culture dishes (100 x 20 mm) of control L-cells and ten tissue culture dishes of TNF-a-treated cells were prepared by the method of Lee et al. (1988), except that soybean trypsin inhibitor was present at 1 ug/ml. EMSA were performed on 5% polyacrylamide gels (29:l acryl- amide:bisacrylamide ratio) according to the procedure of Zabel et al. (1991). Nuclear extracts (10 ug) were incubated for 30 min with 1 ug of poly(dI)poly(dC) in assay buffer [25 mM HepesNaOH pH 7.9/100 mM KC1/5 mM MgCl,/l mM EDTA pH 7.9/l mM dithiothreitol/l2% glycerol/O.l% Nonidet P40] with 40000 cpm of the target oligo in a total reaction volume of 20 ~1. Nuclear extracts were prepared from untreated L-cells (lane 2); from L-cells treated with TNF-u (lanes 3-12). F designates free target sequence, and B,, BJ, and B,,,, designate target sequence bound to proteins.

184

1 23456 7 6 9 10 II

Fig. 5. Factor binding to the NBLS of the li promoter. The target and competitor oligos were prepared as described in the legend to Fig. 4. Thetargetsequence,5’-AGCTTAGGGAACTCCCCCTTCATC- CTGCCCAGGGAGGCAGCTTTGA,correspondingtont -169to -128 of the Ii promoter and the Hind111 half-site was annealed to its complement, and Sequenase was used label sequences complementary to unpaired regions as described in Fig. 4. Unlabeled competitor oligos were this same sequence (lanes 4-6); the sequence S-AGATTTGTGGCTTTCAGTTCCACATCTACCATG correspond- ing to nt -110 to -78 of the Zi promoter (lanes 7-9); or the sequence, T-TGAGTGAGTGGGGAATTTCCAGA corresponding to nt - 130 to -108 of the Ii promoter (lanes 9-11) at 1, 10 or 100 ng which is a 5-, 50- and SOO-fold excess, respectively. EMSA was performed in the absence of nuclear extract (lane l), with nuclear extract from control L-cells (lanes 2, 4-l 1) and from TNF-a-treated L-cells (lane 3) as described in the legend to Fig. 4. F designates free target sequence and B designates the major protein-DNA complex.

an element,S-TGAATTTTCC, which differs from the NBS motif at the underlined nt positions (Sica et al., 1992). The consensus sequence for c-Rel binding would, therefore, include the NBLS, S-GGGAACTCCCC, pre- sent in the Zi (Table II). The function of c-Rel is unknown, however, v-Rel, the related transforming product of reti- culoendotheliosis virus strain T, has been shown to sup- press transcription of genes containing the NBS (Inoue et al., 1991). The existence of several factors related to NF-KB which may recognize distinct, but related cis- acting elements suggests the possibility that these factors could cooperatively interact to control expression of genes, such as Zi which contain multimers of NBS-related sequences.

(d) Conclusions (1) The invariant chain gene contains two elements,

NBS and NBLS, resembling the mouse immunoglobulin K enhancer. The NBS modulates expression of this gene in response to TNF-a. The more distal NBLS does not play a role in TNF-cr inducibility, but may act to suppress constitutive expression.

(2) Proteins specifically bind to the promoter region of Zi. The region containing the NBS specifically binds to a factor in response to TNF-CL Other factors binding to this NBS sequence, and related sequences may also play a role in modulating expression of the murine invariant chain.

ACKNOWLEDGEMENTS

We wish to thank Scott Bingham for synthesizing oligos, Gregory Holguin and Joanna Irvine for technical assistance, and Dr. Elliott Goldstein for technical advice. G. F.-S. is a recipient of a Research Career Development Award (lK04-A100955) from the National Institute of Allergy and Infectious Diseases. This work was supported by a research grant (R29-A124915) from the National Institute of Allergy and Infectious Diseases, Department of Health and Human Services.

REFERENCES

Arai, K.-I., Lee, F., Miyajima, A., Miyatake, S., Arai, N. and Yokota, T.: Cytokines: coordinators of immune and inflammatory responses. Annu. Rev. Biochem. 59 (1990) 783-836.

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (Eds.): Current Protocols in Molecular Biology. Wiley, New York, 1988.

Barr, CL. and Saunders, G.F.: Interferon-y-inducible regulation of the human invariant chain. J. Biol. Chem. 266 (1991) 3475-3481.

Benoist, C. and Mathis, D.: Regulation of major histocompatibility complex class-11 genes: X, Y and other letters of the alphabet. Ann. Rev. Immunol. 8 (1990) 681-715.

Bradford, M.M.: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein- dye binding. Anal. Biochem. 72 (1976) 248-254.

Dynan, W.S.: DNase I footprinting as an assay for mammalian gene regulatory proteins. In: Settow, J.K. (Ed.) Genetic Engineering, Principles and Methods, Vol. 9. Plenum Press, New York, pp. 75-87.

Dynan, W.S. and Tjian, R.: The promoter-specific transcription factor Spl binds to upstream sequences in the SV40 early promoter. Cell (1983) 79-87.

Fan, C.-M. and Maniatis, T.: A DNA-binding protein containing two widely separated zinc finger motifs that recognize the same DNA sequence. Genes Develop. 4 (1990) 29-42.

Fiers, W., Beyaert, R., Brouckaert, P., Everaerdt, B., Grooten, J., Haegeman, G., Libert, C., Suffys, P., Takahashi, N., Tavernier, J., VanBladel, S., Vanhaesebroeck, B., Van Ostade, X. and Van Roy, F.: Tumor necrosis factor and interleukin-6: structure and mecha- nism of action of the molecular, cellular and in vivo level. In: Lother,

185

H., Dernick, R., Ostertag, W. (Eds.), NATO ASI Series, Series H, Cell Biology; Vol. 34. Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation. Springer-Verlag, Berlin, pp.229-240.

Golub, EL, Kim, H. and Volsky, D.J.: Transfection of DNA into adher- ent cells by DEAE-dextran/DMSO method increases drastically if the cells are removed from surface and treated in suspension. Nucleic Acids Res. 17 (1989) 4902.

Inoue, J.-I., Kerr, L.D., Ransone, L.J., Bengal, E., Hunter, T. and Verma, I.M.: C-rel activates but v-rel suppresses transcription from rB sites. Proc. Natl. Acad. Sci. USA 88 (1991) 3715-3719.

Israel, A., LeBail, O., Hatat, D., Piette, J., Kieran, M., Logeat, F., Wallach, D., Fellous, M. and Kourilsky, P.: TNF stimulates expres- sion of mouse MHC class I genes by inducing an NF-KB-like enhancer binding activity which displaces constitutive factors. EMBO J. 8 (1989) 3793-3800.

Keller, A.D. and Maniatis, T.: Identification of an inducible factor that binds to a positive regulatory element of the human B-interferon gene. Proc. Natl. Acad. Sci. USA 85 (1988) 3309-3313.

Koch, N., Lauer, W., Habicht, J. and Dobberstein, B.: Primary structure of the gene for the murine Ia antigen-associated invariant chains (Ii). An alternatively spliced exon encodes a cysteine-rich domain highly homologous to a repetitive sequence of thyroglobulin. EMBO J. 6 (1987) 1677-1683.

Lee, K.W., Bindereif, A. and Green, M.R.: A small-scale procedure for preparation of nuclear extracts that support efficient transcription and pre-mRNA splicing. Gen. Anal. Tech. 5 (1988) 22-3 1.

Lenardo, M.J. and Baltimore, D.: NF-KB: a pleiotropic mediator of inducible and tissue-specific gene control. Cell 58 (1989) 227-229.

Maxam, A. and Gilbert, W.: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560.

Pessara, U. and Koch, N.: Tumor necrosis factor a regulates expression of the major histocompatibility complex class II-associated invari- ant chain by binding of an NF-KB-like factor to a promoter element. Mol. Cell. Biol. 10 (1990) 3777-3767.

Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A.: Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239 (1988) 487-491.

Sanger, F., Coulson, A.R., Barrell, B.G., Smith, A.J.H. and Roe, B.A.: Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J. Mol. Biol. 143 (1980) 161-178.

Sica, A., Tan, T.-H., Rice, N., Kretzschmar, M., Ghosh, P. and Young, H.A.: The c-d protooncogene product c-Rel but not NF-KB binds to the intronic region of the human interferon-y gene at a site related to an interferon-stimulable response element. Proc. Natl. Acad. Sci. USA 89 (1992) 1740-1744.

Yamamoto, K., Floyd-Smith, G., Francke, U., Koch, N., Lauer, W., Dobberstein, B., Schafer, R. and Hammerling, G.J.: The gene encod- ing the Ia-associated invariant chain is located on chromosome 18 in the mouse. Immunogenetics 21 (1985) 83-90.

Zabel, U., Schreck, R. and Baeuerle, P.A.: DNA binding of purified transcription factor NF-KB: affinity, specificity, ZnZf dependence, and differential half-site recognition. J. Biol. Chem. 266 (1991) 252-260.

Zhu, L. and Jones, P.P.: Complete sequence of the murine invariant chain (Ii) gene. Nucleic Acids Res. 17 (1989) 447-448.