of August 19, 2018.This information is current as Production

αInducers of High-Level Dendritic Cell TNF-Mouse Neutrophils Transforming Them into

to the Surface ofαMobilization of TNF-Microbial Antigen Triggers Rapid

Soumaya Bennouna and Eric Y. Denkers

http://www.jimmunol.org/content/174/8/4845doi: 10.4049/jimmunol.174.8.4845

2005; 174:4845-4851; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/174/8/4845.full#ref-list-1

, 21 of which you can access for free at: cites 49 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2005 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on August 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on August 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Microbial Antigen Triggers Rapid Mobilization of TNF-� tothe Surface of Mouse Neutrophils Transforming Them intoInducers of High-Level Dendritic Cell TNF-� Production1

Soumaya Bennouna and Eric Y. Denkers2

Neutrophils play a critical role in early immunity to many microbial pathogens, and this may in part be due to their ability torelease immunoregulatory cytokines and chemokines during infection. Here, we demonstrate by flow cytometric analysis thatmouse polymorphonuclear leukocytes (PMN) up-regulate surface expression of TNF-� within 10 min of stimulation with LPS, andthat this is followed by gradual loss over a period of 18 h. Early increases in surface TNF-� expression correlated with loss ofintracellular pools of preformed TNF-�. Nevertheless, extended incubation with LPS resulted in increased levels of TNF-� mRNAsynthesis and replenishment of intracellular cytokine. After triggering with LPS, PMN acquired the ability to induce dendritic cell(DC) TNF-� and IL-12 production. Transwell assays demonstrated that high-level DC TNF-� production induced by LPS-triggered neutrophils was dependent upon cell-to-cell contact and neutrophil TNF-�, but neither was required for neutrophilinstruction of DC IL-12 synthesis. The data suggest that microbial Ag-triggered mouse PMN acquire the capacity to deliver potentDC-activating signals through elaboration of cytokines and direct interactions at the cell surface. The Journal of Immunology,2005, 174: 4845–4851.

C ellular components of innate immunity are critical insensing infection and initiating responses leading tolong-term protection through acquired immunity (1).

Dendritic cells (DC),3 through their ability to capture Ag, migrateto secondary lymphoid organs, present antigenic peptide with co-stimulation, and release proinflammatory cytokines, are importantin driving Th1 differentiation (2–4). Nevertheless, the cellular andmolecular events involved in DC activation during microbial in-fection are not fully understood.

Neutrophils are often the first cell type recruited to site of in-flammation, and they are considered to be terminally differentiatedeffectors involved in phagocytosis and intracellular killing ofpathogens (5, 6). More recent evidence demonstrates the ability ofPMN to produce several important proinflammatory cytokines andchemokines (7, 8). In a Toxoplasma gondii infection model, wepreviously demonstrated that parasite-triggered mouse neutrophilssecrete DC and macrophage chemotactic factors including CCL2,CCL3, CCL4, CCL5, and CCL20 (9, 10). PMN coincubated withlive tachyzoites also release factors that induce DC up-regulationof costimulatory molecules and secretion of IL-12 as well asTNF-� (10–12) Mice lacking CXCR2, a chemokine receptor in-volved in neutrophil recruitment, display increased susceptibilityto Toxoplasma (13). Furthermore, mice depleted of Gr-1� cells are

unable to survive acute toxoplasmosis (12, 14, 15). This lack ofresistance is associated with defective type 1 cytokine responses,in particular decreased TNF-� and IL-12 expression by splenic DC(10, 16). These results suggest that PMN play a role in orchestrat-ing early immunity through production of DC-activating factors.

To further clarify the role of neutrophils as immunomodula-tory cells in responses driven by microbial Ag, we investigatedthe ability of mouse PMN to trigger DC activation after stim-ulation with LPS. Use of LPS rather than a highly complexmicrobial lysate such as soluble tachyzoite Ag, which we em-ployed in previous studies, provides the advantage that a singlemolecule with a single receptor (TLR4) is involved, facilitatingdissection of PMN-DC interactions. LPS induces neutrophil ac-tivation both in vivo and in vitro, as measured by release ofcytokines, degranulation, increased adhesion potential, and ox-idative burst activity (17–21).

In this study, we present data showing that mouse neutrophilscontain preformed TNF-� that is rapidly mobilized to the cell sur-face upon LPS stimulation. Transmembrane TNF-� expression isaccompanied by up-regulation of surface CD40L and CD11b/CD18. LPS-triggered mouse neutrophils are potent inducers of DCTNF-� when cells are placed in direct contact with each other.This response itself is dependent upon PMN TNF-� expression.Endotoxin-activated mouse neutrophils also induce DC IL-12 pro-duction, but here neither PMN TNF-� nor direct contact was re-quired. The data suggest microbial Ag endow PMN with potentDC-activating capability, a property dependent upon increased ex-pression of neutrophil membrane TNF-�.

Materials and MethodsMice

C57BL/6, TNF receptor (TNFR) 1/2 double knockout (TNFR1/2�/�),TNF-� knockout and wild-type (WT) counterparts (B6129SF2/J) were ob-tained from The Jackson Laboratory. C3H/HeN and C3H/HeJ were pur-chased from Taconic Farms. Female mice between 6 and 8 wk of age wereused throughout. Genotype of knockout animals was confirmed by RT-PCR according to protocols obtained from The Jackson Laboratory. Ani-mals were housed in filter-covered isolator cages in the animal facility of

Department of Microbiology and Immunology, College of Veterinary Medicine, Cor-nell University, Ithaca, New York

Received for publication October 12, 2004. Accepted for publication January10, 2005.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by National Institutes of Health Grant AI47888.2 Address correspondence and reprint requests to Dr. E. Denkers, Department ofMicrobiology and Immunology, College of Veterinary Medicine, Cornell University,Ithaca, NY 14853-6401. E-mail address: eyd1@cornell.edu3 Abbreviations used in this paper: DC, dendritic cell; PMN, polymorphonuclear leu-kocyte; BMDC, bone marrow-derived DC; NMS, normal mouse serum; WT, wildtype.

The Journal of Immunology

Copyright © 2005 by The American Association of Immunologists, Inc. 0022-1767/05/$02.00

by guest on August 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

the College of Veterinary Medicine at Cornell University, which is accred-ited by the American Association for Accreditation of Laboratory Care.

Reagents and Ab

Ultrapure LPS (Escherichia coli strain 0111:B4) was purchased from ListBiological Laboratories. FITC-conjugated goat anti-hamster IgG Ab wasobtained from eBioscience. Allophycocyanin-conjugated Ab specific forLy6G, PE-conjugated Ab specific for TNF-� (MP6-XT22), CD40L (MR1),CD11b (M1/170), CD14 (rmC5-3), TNFR type II (p75) (TR75-89), puri-fied rat anti-mouse TNF-� (MP6-XT22), and hamster anti-mouse TNF-�(TN3-19.12) were obtained from BD Pharmingen. Purified antiserum spe-cific for CD68 (T-16) and PE-conjugated TNF-� anti-goat Ab were ob-tained from Santa Cruz Biotechnology. Normal hamster Ig and normalmouse serum (NMS) were purchased from Jackson ImmunoResearch Lab-oratories. Cycloheximide was obtained from Calbiochem, and recombinantmouse GM-CSF was purchased from PeproTech.

Bone marrow PMN

Neutrophils were isolated from mouse bone marrow following a previouslypublished protocol (22). Briefly, single cell suspensions of bone marrowcells were collected from femur and tibia and resuspended in DMEM sup-plemented with 5% FCS (Hyclone Laboratories), 100 U/ml penicillin, and100 mg/ml streptomycin (PenStrep; Invitrogen Life Technologies). Cellswere then centrifuged at 500 � g for 7 min at 4°C and resuspended inCa2�-free HBSS supplemented with 0.38% sodium citrate. The cell sus-pension was layered on top of a step gradient consisting of 52, 65, and 75%Percoll diluted in Ca2�-free HBSS, and centrifuged at 1500 � g for 30 minat 4°C. Neutrophils were recovered at the interface between the 65 and75% Percoll layers. The proportion of neutrophils, determined by Diff-Quik staining of cytospin preparations, was routinely �90%.

Peritoneal neutrophils

Mice were i.p. injected with 1 ml of 10% thioglycolate (Difco). Peritonealexudate cells were obtained by lavage 18 h later with ice-cold PBS. Cellswere washed in PBS, passed through a 70-�m nylon cell strainer, anderythrocytes in the suspension were lysed using Red cell lysis buffer (Sigma-Aldrich). Cells were then washed, resuspended at 2 � 107 cells/ml in buffercomposed of Dulbecco’s PBS (Invitrogen Life Technology) containing0.5% BSA (Sigma-Aldrich), 1 mM EDTA (Fisher Scientific), and incu-bated for 15 min at 4°C with anti-MHC class II magnetic microbeads. Afterwashing, the mixture was transferred to columns installed within a mag-netic apparatus to remove MHC class II-expressing cells, according to themanufacturer’s instructions (Miltenyi Biotec).

Bone marrow-derived DC (BMDC)

Generation of BMDC was accomplished following a previously publishedprotocol (23). Briefly, single cell bone marrow preparations were obtainedas described above, cells were washed in RPMI 1640 (Fisher Scientific)and resuspended at 2 � 105 cells/ml in DC medium composed of RPMI1640 supplemented with 100 U/ml penicillin and 100 �g/ml streptomycin,10% FCS, 5 � 10�5 M 2-ME, and 20 ng/ml GM-CSF. Cells were platedon 100 � 15 mm standard sterile polystyrene petri dishes (Fisher Scien-tific) and cultured for 9 days at 37°C in 5% CO2. Fresh DC medium,containing 20 ng/ml GM-CSF, was added on days 3, 6, and 8 after cultureinitiation. On day 9, cells were resuspended in cDMEM composed ofDMEM (Invitrogen Life Technologies) supplemented with 10% FCS, 100U/ml penicillin, and 100 �g/ml streptomycin, 5 � 10�5 M 2-ME, 10 mMHEPES (Invitrogen Life Technologies), 100 �M nonessential amino acids(Invitrogen Life Technologies), 1 mM sodium pyruvate (Invitrogen LifeTechnologies), alone or in the presence of different stimuli at 37°C in 5%CO2. Supernatants from the cultures were recovered 18 h later and eitherused immediately or stored at �80°C.

PMN culture

Peritoneal PMN (2 � 106/ml) were cultured in cDMEM alone or in thepresence of 1 �g/ml LPS at 37°C in 5% CO2 in a 96-well tissue cultureplate (Corning Costar). Supernatants from the cultures were recovered 18 hlater and either used immediately or stored at �80°C. In the cocultureexperiments, neutrophils were cultured in medium or LPS (1 �g/ml) for 3 hfollowed by three washes; then they were either plated together with im-mature BMDC in 12-well tissue culture plates (Corning Costar) or placedin the upper well of a Transwell system (Corning Costar), while BMDCwere added to the lower well. In some experiments PMN were fixed for 15min on ice in 1% formaldehyde solution. In experiments involving block-ing of new protein synthesis, neutrophils were incubated in medium con-

taining 30 �g/ml cycloheximide for 15 min followed by a stimulation with1 �g/ml LPS.

RT-PCR

RNA was isolated, reverse transcribed and subjected to PCR amplificationas described (12). The primer sequences used were: �-actin, TGACGGGGGTCACCCACACTGTGCCCATCTA (sense), CTAGAAGCATTGCGGTGGACGATGGAGGG (antisense); TNF-�, CAGCCTCTTCTCATTCCTGCTTGTG (sense), CTGGAAGACTCCTCCCAGGTATAT(antisense). The cDNA was amplified 31 cycles.

Flow cytometry

To analyze surface markers on PMN, Fc receptors were blocked in FACSbuffer (PBS, 1% BSA, and 0.1% sodium azide) containing 5 �g/ml anti-mouse CD16/CD32 (BD Pharmingen) and 10% NMS for 15 min at 0°C,then cells were stained with optimal concentrations of allophycocyanin-conjugated anti-Gr-1(Ly-6G) in combination with PE-conjugated antiseraspecific for TNF-�, CD40L, CD11b, CD14, TNFR type II (p75), and un-labeled goat anti-CD68 followed by PE-conjugated anti-goat Ab for 30 minat 0°C. For intracellular cytokine detection, peritoneal cells were blockedas described above, stained with allophycocyanin-conjugated anti-Gr-1 Aband unlabeled anti-TNF-� Ab, then cells were fixed in 3% paraformalde-hyde (Sigma-Aldrich), 0.1 mM CaCl2, and 0.1 mM MgCl2 for 30 min at0°C. Cells were subsequently washed in permeabilization buffer (PBS with0.075% saponin) and incubated for 15 min at 0°C in permeabilizationbuffer containing 10% NMS. After two washes in permeabilization buffer,unlabeled hamster anti-TNF-� was added, and cells were incubated for 30min at 0°C. After washing in permeabilization buffer, FITC-conjugatedanti-hamster was added followed by a 30-min incubation at 0°C andsubsequently washed for flow cytometric analysis. Data was acquired onFACSCalibur system (10,000 events per sample) and analyzed withCellQuest software (BD Biosciences Immunocytometry Systems).

Cytokine ELISA

IL-12p40 was measured as previously described (12), and TNF-� was mea-sured using a commercially obtained kit (BD Pharmingen).

Statistical Analysis

The statistical significance of the data was analyzed using SD and unpairedtwo-tailed Student’s t test.

ResultsLPS triggers rapid changes in peritoneal PMN surfacemembrane-associated molecules

We began by examining the influence of endotoxin on expressionof neutrophil cell surface markers. Flow cytometric analysis re-vealed early LPS-induced up-regulation of surface TNF-�,CD40L, and CD11b, followed by a time-dependent down-regula-tion relative to cells cultured in medium alone (Fig. 1A). The sur-face expression of these molecules in medium alone at 30 min wasequivalent to staining of freshly isolated, nonstimulated peritonealneutrophils (data not shown). We also examined expression ofCD14, TNFR type II, and CD68, which are markers of exocytosisof secretory vesicles, specific and azurophilic granules, respec-tively (24–27). Both CD14 and CD68 were rapidly mobilized tothe cell surface, consistent with exocytosis of secretory vesiclesand azurophilic granules. Interestingly, the influence of LPS onTNFR type II expression was distinct, in that LPS triggered earlydown-regulation. This was followed by a gradual increase inTNFR type II surface expression that required 18 h to reach max-imal levels (Fig. 1B). These effects are likely mediated by TLR4,because increased expression of TNF-� and other molecules didnot occur in peritoneal PMN from the LPS nonresponder strainC3H/HeJ (Fig. 1C and data not shown).

Control of neutrophil transmembrane TNF-�

We next focused on surface expression of TNF-� by peritonealPMN. TNF-� is synthesized as a transmembrane 26-kDa proteinthat is transported to the cell surface where it is cleaved by a

4846 TNF-�-DRIVEN NEUTROPHIL-DENDRITIC CELL INTERACTION

by guest on August 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

metalloproteinase (TACE) to release the soluble 17-kDa protein(28–34). Therefore, increased TNF-� levels on the cell surface(Fig. 1A) could be the result of higher levels of transmembranecytokine or, alternatively, the result of soluble TNF-� binding toneutrophil TNF receptors. To distinguish these possibilities, westimulated WT or TNFR1/2�/� peritoneal neutrophils with LPSand analyzed surface expression of TNF-�. Both WT (Fig. 2A) andTNFR1/2�/� (Fig. 2B) peritoneal PMN up-regulated surfaceTNF-� expression after 1 h of stimulation with LPS. This resultargues that transmembrane 26-kDa TNF-� is up-regulated on thePMN cell surface, rather than a situation in which soluble TNF-�binds to neutrophil TNF receptors. In addition, preincubation of

cells with unlabeled anti-TNF-� Ab prevented binding of the PE-conjugated Ab, confirming the specificity of Ab binding (Fig. 2C).

We previously found that mouse PMN contain an intracellularpool of IL-12 (35). Because we observed surface expression ofTNF-� very early after LPS stimulation in our experiments, weinvestigated the possibility that mouse PMN also contain pre-formed TNF-�. To address this question, we first pretreated peri-toneal PMN with cycloheximide to block new protein synthesisbefore stimulation of cells with LPS. Cycloheximide had no effecton early LPS-induced up-regulation of surface TNF-�. However,after 1 h of LPS stimulation, cycloheximide-treated cells displayeda marginal but reproducible decrease in TNF-� surface expression,suggesting that de novo protein synthesis may contribute to surfaceexpression at later time points (Fig. 3A). To further examine thepresence of preformed TNF-�, we blocked surface TNF-�, per-meabilized cells, and stained for intracellular cytokine. In this case,bone marrow and peritoneal exudate PMN were strongly positivefor intracellular TNF-� (Fig. 3B).

We next examined modulation of surface vs intracellular ex-pression of TNF-� in LPS-stimulated peritoneal PMN. At 10 minafter LPS stimulation, when compared with unstimulated cells, weobserved a decrease in intracellular TNF-� and a parallel increasein surface expression of this cytokine (Fig. 3C). However, after 1 hof exposure to LPS, both surface and intracellular TNF-� expres-sion were increased (Fig. 3C). These results suggest that de novoprotein synthesis replenishes the pool of intracellular TNF-� that isinitially mobilized to the neutrophil surface. Evidence that LPSinduces increased TNF-� gene transcription is shown by RT-PCRin Fig. 3D. Increased levels of TNF-� mRNA were apparentwithin 15 min, and maximal levels were attained by 60 min ofstimulation. The combined results argue that both preformed poolsand newly synthesized TNF-� contribute to high level expressionof this cytokine on the cell surface.

LPS stimulated mouse peritoneal neutrophils promote dendriticcell cytokine production

To determine whether LPS-triggered peritoneal PMN can directlystimulate TNF-� and IL-12 production by BMDC, we began bymeasuring cytokine levels in PMN-DC cocultures. When BMDCwere cultured with LPS or cocultured with LPS-activated perito-neal PMN, high levels of both TNF-� and IL-12p40 were releasedinto the coculture supernatants (Fig. 4A). In contrast, when non-stimulated mouse peritoneal PMN were used in the cocultures, noTNF-� and minimal amounts of IL-12p40 were detected (Fig. 4A).To test whether the triggering effect of peritoneal PMN was due tobona fide factors produced by the latter cells or simply to LPScarryover, we conducted identical experiments employing BMDCderived from LPS nonresponder animals. In this case, althoughdirect DC stimulation with LPS failed to elicit a cytokine response,

FIGURE 1. LPS triggers rapid changes in the pattern of molecules ex-pressed on the neutrophil surface. Thioglycolate-elicited peritoneal exudatecells from C57BL/6 (A and B), and C3H/HeN/C3H/HeJ (C) mice werestimulated with LPS (thick lines) or incubated in medium (thin lines) forvarying times, then stained with Ab to Gr-1 and the indicated markers. Thedata show expression profiles gated on Gr-1high cells. C, Surface TNF-�expression 60 min after treatment with LPS or medium. The numbers in Aand C indicate the percentage of positive cells after stimulation with LPS(top) vs incubation in medium (bottom). This experiment was repeatedthree times with essentially identical results.

FIGURE 2. LPS induces neutrophil surface TNF-� expression indepen-dently of TNF receptors. Thioglycolate-induced peritoneal exudate cellsfrom WT (A and C) and TNFR1/2�/� (B) mice were cultured in medium(thin lines) or stimulated with LPS (thick lines) for 1 h and stained forsurface TNF-�. C, Cells were stained with an unlabeled blocking anti-TNF-� Ab followed by staining for TNF-� as in A and B. The profilesshown are gated on the Gr-1high population.

4847The Journal of Immunology

by guest on August 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

coculture with LPS-stimulated peritoneal neutrophils triggered ro-bust TNF-� and IL-12p40 responses (Fig. 4B). This result dem-onstrates that the cytokine responses were triggered by neutrophilfactors rather than residual LPS in the cocultures.

Direct cell-to-cell contact and peritoneal PMN TNF-� arerequired for optimal DC production of TNF-� but not IL-12p40

We next compared the role of soluble vs membrane-bound PMN-derived factors in promoting cytokine release by BMDC. Accord-ingly, we exposed LPS nonresponder BMDC to cell-free superna-tants from 18-h LPS-stimulated mouse peritoneal PMN. Inparallel, we cocultured 3-h LPS-stimulated peritoneal PMN withthe BMDC as in Fig. 4B. Although DC exposed to soluble factorsfrom LPS-triggered peritoneal PMN released both TNF-� and IL-12p40, the response was enhanced when BMDC were coculturedwith LPS-stimulated peritoneal PMN (Fig. 5). This was particu-larly true for TNF-� production, where there was a �6-fold in-crease in the amount of cytokine released in a direct cell-to-cellcontact situation. We next used a transwell system to further probethe requirement for optimal DC cytokine production. As shown inFig. 6A, TNF-� production was severely curtailed when LPS-trig-gered WT mouse peritoneal PMN, and DC were separated by amembrane. In contrast, WT DC IL-12p40 production in responseto LPS-stimulated WT peritoneal PMN was minimally affected(Fig. 6A).

We previously demonstrated that supernatants from T. gondii-triggered PMN induce DC up-regulation of costimulatory mole-cules CD40 and CD86 and that this response depends upon TNF-�(10). In this study, we investigated the involvement of PMN-de-rived TNF-� in promoting cytokine production in PMN-BMDC

FIGURE 3. Mouse neutrophils contain preformed TNF-� that is rapidlymobilized to the cell surface after LPS stimulation. A, Early LPS-triggeredPMN surface TNF-� expression does not require new protein synthesis.Thioglycolate-elicited cells (PEC) were preincubated with cycloheximidethen stimulated for the indicated times with LPS. Cells were stained withAb to Gr-1 and TNF-�. The profiles shown are gated on Gr-1high cells.Green line, LPS with no cycloheximide; red line, LPS with cycloheximide;black line, medium with cycloheximide. No difference was observed be-tween medium and medium with cycloheximide (data not shown). B, PMNcontain intracellular TNF-�. Bone marrow cells and PEC were subjected tosurface TNF-� blocking using unlabeled rat anti-mouse TNF-� Ab, thenpermeabilized and stained with hamster anti-mouse TNF-� Ab. Datashown are gated on Gr-1high cells. Red line, anti-TNF-� Ab; black line,isotype control. C, Changes in intracellular and membrane bound TNF-�during LPS stimulation. Thioglycolate-elicited cells were incubated in me-dium or stimulated with LPS for the indicated times. Cells were subse-quently stained with Gr-1 Ab and surface TNF-� using a rat anti-mouseTNF-�. After permeabilization and blocking, cells were stained for intra-cellular TNF-� using a hamster anti-mouse Ab. Profiles shown are gated onGr-1high cells. Green and gray lines, intracellular TNF-� expression afterincubation with LPS and medium, respectively. Red and black lines, sur-face TNF-� expression after incubation with LPS and medium, respec-tively. Dotted lines, isotype control staining. Numbers in each histogram showpercentage of positive followed by geometric mean fluorescence intensity forLPS-stimulated cells (top) and cells incubated in medium alone (bottom). D,RT-PCR analysis of purified peritoneal exudate PMN incubated in mediumalone or stimulated for the indicated times with LPS.

FIGURE 4. LPS-triggered PMN express factors that trigger DC TNF-�and IL-12 production. BMDC were incubated with medium (open bars),LPS (black bars; 1 �g/ml), unstimulated PMN (gray bars), and LPS-stim-ulated PMN (cross-hatched bars). The ratio of PMN to DC was 2:1. After18 h of incubation (37°C, 5% CO2), DC culture supernatants were col-lected for TNF-� and IL-12p40 ELISA. A, BMDC from C3H/HeN (LPSresponder) and B, BMDC from C3H/HeJ (LPS nonresponder) mice. Levelsof cytokine detected in PMN culture supernatants after 3 h incubation inmedium alone or in the presence of LPS followed by 18 h in medium,respectively, were: 31 � 2 pg/ml; 109 � 7 pg/ml for TNF-� and �1 pg/mland 147 � 1 pg/ml for IL-12p40. n.d., Not detected. Data are representativeof three different experiments.

4848 TNF-�-DRIVEN NEUTROPHIL-DENDRITIC CELL INTERACTION

by guest on August 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

coculture experiments. Although LPS-stimulated WT peritonealPMN were able to trigger TNF-� production by BMDC, LPS-stimulated TNF�/� neutrophils were defective in driving such aresponse (Fig. 6A). However, both LPS-stimulated WT andTNF�/� peritoneal PMN were able to promote DC IL-12p40 pro-duction in cocultures and when separated in a Transwell chambersystem (Fig. 6A). Similarly, using TNFR1/2�/� DC, we found thatLPS-stimulated peritoneal PMN no longer elicited DC TNF-� re-lease while leaving IL-12p40 production unaffected (Fig. 6B).Last, DC lacking CD40 were examined. Here, there was no evi-dence for involvement of this costimulatory molecule in DC cy-tokine production (Fig. 6C). Collectively, the results in Fig. 6 showthat direct cell-to-cell contact is required for optimal TNF-� butnot IL-12p40 production, and that DC TNF-� but not IL-12p40release depends upon neutrophil TNF-� production.

Fixed mouse peritoneal neutrophils retain the ability tostimulate DC TNF-� release

The results presented so far indicate that cell-to-cell contact be-tween DC and PMN directs TNF-� production by DC, but they donot rule out additional involvement of neutrophil soluble factors.To address this issue, peritoneal neutrophils were subjected toparaformaldehyde fixation before DC stimulation. This procedureresults in loss of ability of PMN to secrete factors, but surfacemembrane molecules will be retained. As shown in Fig. 7A, fix-ation had no effect on the ability of LPS-triggered peritoneal neu-trophils to drive DC TNF-� production. In contrast, fixation ab-lated the ability of PMN to drive DC IL-12p40 production,consistent with a role for soluble factors in this situation (Fig. 7B).These results demonstrate that direct contact between DC andPMN is necessary and sufficient to promote TNF-� production byDC, but that soluble factors induce DC IL-12 production.

DiscussionThe results of this study demonstrate that mouse neutrophils trig-gered with microbial Ag become licensed activators of DC. Al-though PMN themselves serve as a source of proinflammatory cy-tokines IL-12p40 and TNF-�, the amount of cytokine released byneutrophil-activated DC is 1–2 orders of magnitude higher (Figs.4–6). Importantly, by using DC with nonfunctional TLR4, it waspossible to rule out involvement of endotoxin carryover in theeffects of LPS-triggered neutrophils on DC. The DC TNF-� re-lease was triggered by neutrophil TNF-�, and this was optimallydriven by direct cell-to-cell contact.

FIGURE 6. Requirements for PMN triggering of DC cytokine produc-tion. Thioglycolate-elicited peritoneal PMN were preincubated 3 h withLPS, then added directly to BMDC (black bar) or separated in a Transwellsystem (open bar). Supernatants were collected 18 h later for TNF-� andIL-12p40 ELISA. A, WT and TNF-��/� PMN were compared for abilityto trigger WT DC. B, WT PMN were used to trigger WT and TNFR1/2�/�

DC. C, WT neutrophils were used to trigger WT and CD40�/� DC. Nocytokine release was detected when nonstimulated PMN were used in eachof these experiments (data not shown). This experiment was repeated twicewith similar results. �, p � 0.01 (direct cell-to-cell contact vs Transwell).��, p � 0.01 (direct cell-to-cell contact between WT DC and WT PMN vsdirect cell-to-cell contact between WT DC and TNF�/� PMN). n.d., Notdetected.

FIGURE 5. Cell-to-cell contact is required for optimal DC TNF-� but not IL-12p40 production. C3H/HeJ (LPS nonresponder) BMDC were incubated18 h with supernatants from unstimulated (open bars) or 18 h with LPS-stimulated (black bars) PMN. In addition, DC were coincubated with PMN thathad been exposed to medium (gray bars) or LPS (cross-hatched bars) for 3 h. A 2:1 ratio of PMN to DC was used in the coincubation experiments. After18 h, supernatants were collected for TNF-� (A) and IL-12p40 (B) ELISA. PMN alone stimulated with LPS released 311 � 16 pg/ml (TNF-�) and 3490 �139 pg/ml (IL-12p40). The experiment was repeated twice with similar results. �, p � 0.01 (DC � 18 h PMN supernatants vs DC-PMN coculture). n.d.,Not detected.

4849The Journal of Immunology

by guest on August 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Neutrophil TNF-� was mobilized to the membrane surfacewithin 15 min of endotoxin stimulation relative to cells incubatedfor the same length of time in medium alone. Surface TNF-� up-regulation occurred in the presence of cycloheximide indicatingthat de novo protein synthesis was not required. Furthermore, non-stimulated mouse neutrophils contained an intracellular pool ofTNF-� that displayed a transient decrease concomitant with in-creased surface TNF-� expression. In addition to TNF-�, PMNhave previously been shown to contain preformed IL-12, IL-6, andMIP-2 (35–37). Both TNF-� and IL-12 are present in non-elicitedmouse neutrophils. It is, therefore, likely that these cytokines areexpressed in PMN during the course of differentiation in the bonemarrow. Thus, in addition to their well-known role as microbicidaleffectors, neutrophils may also serve an important function as ve-hicles that rapidly deliver preformed cytokines to sites of inflam-mation and infection.

Whereas intracellular TNF-� pools were depleted 10 min afterLPS stimulation, after 60 min, intracellular TNF-� was replen-ished. LPS triggering also induced increased levels of TNF-�mRNA. The data argue that, although mouse PMN possess anintracellular pool of preformed cytokine, the cells also display theability to up-regulate cytokine gene induction, as shown here forTNF-� and elsewhere for IL-12 (35). Sustained PMN productionof inflammatory cytokines, particularly for the case of GM-CSF, islikely to be important for delaying onset of apoptosis that thesecells are programmed to undergo (38, 39). In this way, immuno-regulatory and microbicidal effects of neutrophils at sites of in-flammation and infection are likely to be prolonged.

We, and others, have suggested that neutrophils, by virtue oftheir pattern of cytokine expression, may have important in vivoimmunoregulatory effects on DC (10, 40–42). In addition to trig-gering DC TNF-� and IL-12 production, activated PMN exertother effects on these cells. For example, mouse neutrophil releaseof chemokines CCL3, CCL4, CCL5, and CCL20 together mediatepotent chemotactic activity on immature DC (10). Furthermore,PMN induce potent DC up-regulation of costimulatory moleculessuch as CD40 and CD86, an effect that is in part dependent uponneutrophil TNF-� release (10). Other recent studies show that neu-trophils assume type 1 and type 2 cytokine profiles, depending onthe activating stimulus (43–45). Together, these findings provideevidence for a key role for neutrophils in controlling immunoregu-latory effects of DC.

An unexpected conclusion emerging from our studies is thatneutrophil-directed production of DC TNF-� and IL-12 is non-identical. Thus, DC IL-12 production does not rely on neutrophilTNF-�. In contrast, DC TNF-� production requires TNF-� ex-pression by peritoneal neutrophils. Furthermore, PMN-induced re-lease of DC IL-12, in contrast to TNF-�, occurs equally efficientlyacross a transwell membrane relative to when cells are in directcontact. CD40 ligation is well known to be involved in DC acti-vation (46), and indeed we show here that LPS induces up-regu-lation of PMN CD40L expression. Nevertheless, using CD40�/�

DC, we were able to exclude a role for CD40:CD40L in effects ofPMN on DC. Likewise, IL-12 has been implicated as a primingsignal for high-level DC IL-12 production (47), but experimentsemploying IL-12�/� PMN demonstrate lack of involvement of thiscytokine (unpublished observations). The potential role of otherneutrophil-derived IL-12-inducing mediators, for example brady-kinin, is currently under investigation (48).

Our studies here and elsewhere (9, 10, 12) employ thioglyco-late-elicited peritoneal and bone marrow neutrophils. In principle,these populations are non-identical since the former has respondedto an inflammatory stimulus. Nevertheless, we have yet to detectdifferences in these populations, particularly with regard to cyto-kine/chemokine production. In addition, it can be argued that elic-ited PMN are the most relevant to study because neutrophils ar-riving at a site of infection do so in response to inflammatorysignals.

The biological significance of DC TNF-� production is pres-ently unclear. The cells are more well-known as an IL-12 sourcethat, together with Ag and costimulation, play a central role in thegeneration of Th1 effector lymphocytes. Nevertheless, DC subsetshave been identified in vivo that mediate innate immune defenseagainst microbial infection by producing both NO and TNF-� (49).The role of TNF-� in this situation may be to promote, along withother inflammatory mediators, macrophage and DC acquisition ofmicrobicidal function.

In vivo evidence for the importance of neutrophils in DC func-tion is provided by observations that depletion of Gr-1(Ly6G)�

cells results in decreased TNF-� and IL-12 production by splenicCD11c� cells and increased susceptibility during infection withmicrobial pathogens such as T. gondii (10). In this regard, acti-vated PMN that rapidly accumulate at a site of infection or in-flammation may play an important role in driving acquisition ofDC microbicidal function. The fact that direct cell contact is re-quired for optimal DC TNF-� production may be a way to focusthe response solely at inflammatory sites of infection and neutro-phil accumulation.

AcknowledgmentsWe thank Barbara Butcher, Laura Del Rio, and Matthias Hesse for con-structive criticism and insightful discussion during the course of this work.

DisclosuresThe authors have no financial conflict of interest.

References1. Janeway, C. A., Jr., and R. Medzhitov. 2002. Innate immune recognition. Annu.

Rev. Immunol. 20:197.2. Palucka, K., and J. Banchereau. 2002. How dendritic cells and microbes interact

to elicit or subvert protective immune responses. Curr. Opin. Immunol. 14:420.3. Guermonprez, P., J. Valladeau, L. Zitvogel, C. Thery, and S. Amigorena. 2002.

Antigen presentation and T cell stimulation by dendritic cells. Annu. Rev. Immu-nol. 20:621.

4. Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu,B. Pulendran, and K. Palucka. 2000. Immunobiology of dendritic cells. Annu.Rev. Immunol. 18:767.

5. Belaaouaj, A., R. McCarthy, M. Baumann, Z. Gao, T. J. Ley, S. N. Abraham, andS. D. Shapiro. 1998. Mice lacking neutrophil elastase reveal impaired host de-fense against gram negative bacterial sepsis. Nat. Med. 4:615.

FIGURE 7. LPS-stimulated fixed mouse neutrophils retain the ability tostimulate DC TNF-� production. Peritoneal PMN were incubated for 3 hin medium or LPS, washed, fixed or left untreated, and added directly toBMDC (black bars) or separated in a Transwell system (open bars). After18 h, supernatants were collected for TNF-� (A) and IL-12p40 (B) ELISA.Untreated PMN alone stimulated with LPS released 143 � 1 pg/ml(TNF-�) and 395 � 2 pg/ml (IL-12). No cytokine release was detectedwhen nonstimulated PMN were used (data not shown). In addition, nocytokine was detected in supernatants of LPS-stimulated fixed neutrophils,and no DC IL-12 was detected using fixed neutrophils as stimulators. Thisexperiment was repeated twice with similar results. �, p � 0.01 (directcell-to-cell contact vs transwell). n.d., Not detected.

4850 TNF-�-DRIVEN NEUTROPHIL-DENDRITIC CELL INTERACTION

by guest on August 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

6. Jackson, S. H., J. I. Gallin, and S. M. Holland. 1995. The p47phox mouse knockoutmodel of chronic granulomatous disease. J. Exp. Med. 182:751.

7. Denkers, E. Y., L. D. Del Rio, and S. Bennouna. 2003. Neutrophil production ofIL-12 and other cytokines during microbial infection. Chem. Immunol. Allergy83:95.

8. Cassatella, M. A. 1999. Neutrophil-derived proteins: selling cytokines by thepound. Adv. Immunol. 73:369.

9. Del Rio, L., B. A. Butcher, S. Bennouna, S. Hieny, A. Sher, and E. Y. Denkers.2004. Toxoplasma gondii triggers MyD88-dependent and CCL2 (MCP-1) re-sponses using distinct parasite molecules and host receptors. J. Immunol. 172:6954.

10. Bennouna, S., S. K. Bliss, T. J. Curiel, and E. Y. Denkers. 2003. Cross-talk in theinnate immune system: neutrophils instruct early recruitment and activation ofdendritic cells during microbial infection. J. Immunol. 171:6052.

11. Bliss, S. K., A. J. Marshall, Y. Zhang, and E. Y. Denkers. 1999. Human poly-morphonuclear leukocytes produce IL-12, TNF-�, and the chemokines macroph-age-inflammatory protein-1� and -1� in response to Toxoplasma gondii antigens.J. Immunol. 162:7369.

12. Bliss, S. K., Y. Zhang, and E. Y. Denkers. 1999. Murine neutrophil stimulationby Toxoplasma gondii antigen drives high level production of IFN-�-independentIL-12. J. Immunol. 163:2081.

13. Del Rio, L., S. Bennouna, J. Salinas, and E. Y. Denkers. 2001. CXCR2 deficiencyconfers impaired neutrophil recruitment and increased susceptibility during Tox-oplasma gondii infection. J. Immunol. 167:6503.

14. Scharton-Kersten, T., G. Yap, J. Magram, and A. Sher. 1997. Inducible nitricoxide is essential for host control of persistent but not acute infection with theintracellular pathogen Toxoplasma gondii. J. Exp. Med. 185:1.

15. Sayles, P. C., and L. J. Johnson. 1997. Exacerbation of toxoplasmosis in neutro-phil depleted mice. Nat. Immun. 15:249.

16. Bliss, S. K., L. C. Gavrilescu, A. Alcaraz, and E. Y. Denkers. 2001. Neutrophildepletion during Toxoplasma gondii infection leads to impaired immunity andlethal systemic pathology. Infect. Immun. 69:4898.

17. Wright, S. D., R. A. Ramos, A. Hermanowski-Vosatka, P. Rockwell, andP. A. Detmers. 1992. Activation of the adhesive capability of CR3 on neutrophilsby endotoxin: dependence on lipopolysaccharide binding protein and CD14.J. Exp. Med. 173:1281.

18. Guthrie, L. A., L. C. McPhail, P. M. Henson, and R. B. J. Johnston. 1984.Priming of neutrophils enhanced release of oxygen metabolites by bacterial li-popolysaccharide: evidence for increased activity of the superoxide-producingenzyme. J. Exp. Med. 160:1656.

19. Surette, M. E., R. Palmantier, J. Gosselin, and P. Borgeat. 1993. Lipopolysac-charides prime whole human blood and isolated neutrophils for the increasedsynthesis of 5-lipoxygenase products by enhancing arachidonic acid availability:involvement of CD14 antigen. J. Exp. Med. 178:1347.

20. Dubravec, D. B., D. R. Spriggs, J. A. Mannick, and M. L. Rodrick. 1990. Cir-culating human peripheral blood granulocytes synthesize and secrete tumor ne-crosis factor �. Proc. Natl. Acad. Sci. USA 87:6758.

21. Cassatella, M. A., L. Meda, S. Gasperini, A. D‘Andrea, X. Ma, and G. Trinchieri.1995. Interleukin-12 production by human polymorphonuclear leukocytes. Eur.J. Immunol. 25:1.

22. Kiefer, F., J. Brumell, N. Al-Alawi, S. Latour, A. Cheng, A. Veillette,S. Grinstein, and T. Pawson. 1998. The Syk protein tyrosine kinase is essentialfor Fc� receptor signaling in macrophages and neutrophils. Mol. Cell Biol. 1998.18:4209.

23. MacDonald, A. S., A. D. Straw, B. Bauman, and E. J. Pearce. 2001. CD8�

dendritic cell activation status plays an integral role in influencing Th2 responsedevelopment. J. Immunol. 167:1982.

24. Borregaard, N., and J. B. Cowland. 1997. Granules of the human neutrophilicpolymorphonuclear leukocyte. Blood 89:3503.

25. Bainton, D. F. 1999. Distinct granule populations in human neutrophils and ly-sosomal organelles identified by electron microscopy. J. Immunol. Methods 232:153.

26. Gullberg, U., N. Bengtsson, E. Bulow, Garwicz, A. Lindmark, and I. Olsson.1999. Processing and targeting of granule proteins in human neutrophils. J. Im-munol. Methods 232:201.

27. Galligan, G., and T. Yoshimura. 2003. Phenotypic and functional changes ofcytokine-activated neutrophils. Chem. Immunol. Allergy 83:24.

28. Beutler, B., and A. Cerami. 1989. The biology of cachectin/TNF-� primary me-diator of the host response. Annu. Rev. Immunol. 7:625.

29. Black, R. A., C. T. Rauch, C. J. Kozlosky, J. J. Peschon, J. L. Slack,M. F. Wolfson, B. J. Castner, K. L. Stocking, P. Reddy, S. Srinivasan, et al. 1997.

A metalloproteinase disintegrin that releases tumor-necrosis factor-� from cells.Nature 385:729.

30. Black, R. A. 2002. Tumor necrosis factor-� converting enzyme. Int. J. Biochem.Cell Biol. 34:1.

31. Bakouche, O., Y. Ichinose, R. Heicappell, I. J. Fidler, and L. B. Lachman. 1988.Plasma membrane-associated tumor necrosis factor: a non-integral membraneprotein possibly bound to its own receptor. J. Immunol. 140:1142.

32. Gearing, A. J. H., P. Beckett, M. Christodoulou, M. Churchill, J. Clements,A. H. Davidson, A. H. Drummond, W. A. Galloway, R. Gillbert, J. L. Gordon,et al. 1994. Processing of tumor necrosis factor-� precursor by metalloprotein-ases. Nature 370:555.

33. Luettig, B., T. Decker, and M. Lohmann-Matthes. 1989. Evidence for the exis-tence of two forms of membrane tumor necrosis factor: an integral protein and amolecule attached to its receptor. J. Immunol. 143:4034.

34. Moss, M. L., S.-L. C. Jin, M. E. Milla, W. Burkhart, H. L. Carter, W. J. Chen,W. C. Clay, J. R. Didsbury, D. Hassler, C. R. Hoffman, et al. 1997. Cloning ofa disintegrin metalloproteinase that processes precursor tumor-necrosis factor-�.Nature 385:733.

35. Bliss, S. K., B. A. Butcher, and E. Y. Denkers. 2000. Rapid recruitment ofneutrophils with pre-stored IL-12 during microbial infection. J. Immunol. 165:4515.

36. Matzer, S. P., T. Baumann, N. W. Lukacs, M. Rollinghoff, and H. U. Beuscher.2001. Constitutive expression of macrophage-inflammatory protein 2 (MIP-2)mRNA in bone marrow gives rise to peripheral neutrophils with pre-formedMIP-2 protein. J. Immunol. 167:4635.

37. Terebuh, P. D., I. G. Otterness, R. M. Strieter, P. M. Lincoln, J. M. Danforth,S. L. Kunkel, and S. W. Chensue. 1992. Biologic and immunohistochemicalanalysis of interleukin-6 expression in vivo. Constitutive and induced expressionin murine polymorphonuclear and mononuclear phagocytes. Am. J. Pathol. 140:649.

38. Lee, A., M. K. B. Whyte, and C. Haslett. 1993. Inhibition of apoptosis andprolongation of neutrophil functional longevity by inflammatory mediators.J. Leukoc. Biol. 54:283.

39. Klein, J. B., M. J. Rane, J. A. Scherzer, P. Y. Coxon, R. Kettritz, J. M. Mathiesen,A. Buridi, and K. R. McLeish. 2000. Granulocyte-macrophage colony stimulatingfactor delays neutrophil constitutive apoptosis through phosphoinositide 3-kinaseand extracellular signal-related kinase pathways. J. Immunol. 164:4286.

40. Denkers, E. Y., B. A. Butcher, L. D. Rio, and S. Bennouna. 2004. Neutrophils,dendritic cells and Toxoplasma. Intl. J. Parasitol. 34:411.

41. Scapini, P., C. Laudanna, C. Pinardi, P. Allavena, A. Mantovani, S. Sozzani, andM. A. Cassatella. 2001. Neutrophils produce biologically active macrophage in-flammatory protein-3� (MIP-3�)/CCL20 and MIP-3�/CCL19. Eur. J. Immunol.31:1981.

42. Akahoshi, T., T. Sasahara, R. Namai, T. Matsui, H. Watabe, H. Kitasato,M. Inooue, and H. Kondo. 2003. Production of macrophage inflammatory protein3� (MIP-3�) (CCL20) and MIP-3� (CCL19) by human peripheral blood neu-trophils in response to microbial pathogens. Infect. Immun. 71:524.

43. Chen, L., T. Watanabe, H. Watanabe, and F. Sendo. 2001. Neutrophil depletionexacerbates experimental Chagas’ disease in BALB/c, but protects C57BL/6mice through modulating the Th1/Th2 dichotomy in different directions. Eur.J. Immunol. 31:265.

44. Romani, L., A. Mencacci, E. Cenci, R. Spaccapelo, G. Del Sero, I. Nicoletti,G. Trinchieri, F. Bistoni, and P. Puccetti. 1997. Neutrophil production of IL-12and IL-10 in candidiasis and efficacy of IL-12 therapy in neutropenic mice. J. Im-munol. 158:5349.

45. Tsuda, Y., H. Takahashi, M. Kobayashi, T. Hanafusa, D. N. Herndon, andF. Suzuki. 2004. Three different neutrophil subsets exhibited in mice with dif-ferent susceptibilities to infection by methicillin-resistant Staphylococcus aureus.Immunity 21:215.

46. Schulz, O., A. D. Edwards, M. Schito, J. Aliberti, S. Manickasingham, A. Sher,and C. Reis e Sousa. 2000. CD40 triggering by dendritic cells in vivo requires amicrobial priming signal. Immunity 13:453.

47. Grohmann, U., M. L. Belladonna, R. Bianchi, C. Orabona, E. Ayroldi,M. C. Fioretti, and P. Puccetti. 1998. IL-12 acts directly on DC to promotenuclear localization of NF-�B and primes DC for IL-12 production. Immunity9:315.

48. Aliberti, J., J. P. Viola, A. Vieria-de-Abreu, P. T. Bozza, A. Sher, andJ. Scharfstein. 2003. Cutting Edge: bradykinin induces IL-12 production by den-dritic cells: a danger signal that drives Th1 polarization. J. Immunol. 170:485.

49. Serbina, N. V., T. P. Salazar-Mathar, C. A. Biron, W. A. Kuziel, and E. A. Pamer.2003. TNF/iNOS-producing dendritic cells mediate innate immune defenseagainst bacterial infection. Immunity 19:59.

4851The Journal of Immunology

by guest on August 19, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from