ORIGINAL RESEARCH ARTICLE

In Vivo Targeting of Activated Leukocytes by a b2-IntegrinBinding Peptide

Tanja-Maria Ranta • Juho Suojanen • Oula Penate-Medina • Olga Will •

Robert J. Tower • Claus Gluer • Kalevi Kairemo • Carl G. Gahmberg •

Erkki Koivunen • Timo Sorsa • Per E. J. Saris • Justus Reunanen

Published online: 28 August 2013

� Springer International Publishing Switzerland 2013

Abstract

Background In immunopathological conditions, clinical

diagnosis is commonly made on the basis of patient

symptoms, measurement of blood leukocyte levels or

proinflammatory biomarkers, non-specific radiological

findings and, regarding infection, microbiological analysis.

Nevertheless, frequently the exact spatial location of

inflammation or even infection cannot be reliably identi-

fied, despite the use of up-to-date clinical, laboratory and

imaging techniques. For this reason, new tools are war-

ranted for use in advanced diagnosis and therapy targeting

in patients.

Objective The peptide CPCFLLGCC (LLG), known to

bind activated b2-integrins in vitro, was fused with green

fluorescent protein (GFP) to test the ability of LLG fusions

to target and bind activated leukocytes in vivo.

Methods A murine skin scratch inflammation model was

chosen for the convenient non-surgical detection of GFP.

Results The murine skin lesion inflammation model

demonstrated in vivo targeting of LLG-GFP to sites of

inflammation. Targeting by LLG-GFP fusion construct

depends on the ability of the LLG-moiety to bind activated

leukocytes. Control construct unable to bind b2-integrins

appeared biologically inert.

Conclusion The data support the possibility of using this

fluorescently labeled peptide as a tool for both the detection

of and targeting to inflammatory sites characterized by

robust leukocyte activation.

1 Introduction

Leukocytes are largely quiescent and inactive, apart from a

small fraction which carries out constant patrolling to

detect any immunological problems that may arise [1].

They can be activated by direct contact with foreign

T.-M. Ranta � C. G. Gahmberg � E. Koivunen

Division of Biochemistry and Biotechnology, Department

of Biosciences, University of Helsinki, Helsinki, Finland

J. Suojanen � T. Sorsa

Department of Cell Biology of Oral Diseases, Institute of

Dentistry, Biomedicum Helsinki, University of Helsinki,

Helsinki, Finland

J. Suojanen � T. Sorsa

Department of Oral and Maxillofacial Diseases, Helsinki

University Central Hospital, University of Helsinki,

Helsinki, Finland

J. Suojanen

Department of Diagnostics and Oral Medicine, Institute of

Dentistry, Oulu University Hospital, University of Oulu,

Oulu, Finland

O. Penate-Medina � O. Will � R. J. Tower � C. Gluer

Sektion Biomedizinische Bildgebung, Klinik fur Radiologie,

Universitatsklinikum Schleswig-Holstein,

MOIN CC, Kiel, Germany

K. Kairemo

Docrates Cancer Center, Helsinki, Finland

P. E. J. Saris � J. Reunanen

Department of Food and Environmental Sciences,

University of Helsinki, Helsinki, Finland

J. Reunanen (&)

Department of Veterinary Biosciences, Veterinary Microbiology

and Epidemiology, University of Helsinki, Agnes Sjobergin katu

2, 00014 Helsinki, Finland

e-mail: justus.reunanen@helsinki.fi

Mol Diagn Ther (2014) 18:39–44

DOI 10.1007/s40291-013-0052-5

antigens, by complement activation-mediated response, or

by chemical or direct signalling from other leukocytes or

antigen-presenting cells [2]. Activation of leukocytes is an

amplifying, multistage process which causes significant

changes in the expression levels of several cell surface

proteins [3], and activation of the leukocyte-specific

b2-integrins CD11/CD18 [4].

Integrins play a role not only in immunological reac-

tions, but also function in cell growth, movement, and

survival [4]. The activation of leukocytes results in

upregulation and reorganizations of many cell surface

proteins, some of which interact with leukocyte integrins to

produce functional complexes. The b2-integrin family

consist of four dimeric molecules, each made up of a

common b2-chain (CD18) paired with one of the four

a-chains, aL, aM, aX and aD (CD11a, CD11b, CD11c, and

CD11d). Furthermore, the CD11b/CD18 integrin (macro-

phage-1 antigen, Mac-1), in particular, and, to a lesser

extent, CD11c/CD18, are known to be rather promiscuous

in ligand binding. For these reasons, development of new

immunomodulators aimed at interfering with CD18 inte-

grins has become a major focus of study, and several

CD11b inhibitors and immunomodulators have already

been proven highly active in vivo [5–7].

The expression levels of b2-integrins vary in accordance

with the differentiation line and maturity level of the par-

ticular leukocyte type. Due to their multiple functions in

inside-out and outside-in signalling, as well as cell–cell and

cell–matrix interactions, varying levels of expression,

clustering, and molecular activity in response to increased

cellular activity are seen. In general, CD11a/CD18 is

expressed on lymphocytes, CD11b/CD18 on neutrophils,

CD11c/CD18 on monocyte-macrophage cells, and CD11d/

CD18 on macrophages [8]. Since CD11b/CD18 is associ-

ated with neutrophils, it plays a special role in innate

immunity and cell-mediated immune response during the

acute phase.

Integrin binding phage display peptides have been used

as tools in molecular imaging in clinical and pre-clinical

settings. Arginine–glycine–aspartic acid (RGD) tripeptide

is an attachment site in various adhesive extracellular

matrix and cell surface proteins recognized by several

integrin subtypes. F-18-labeled RGD peptides [9, 10], and

multimodal I-124 and fluorescence-labeled nanoparticles

with RGD peptides [11] are currently in clinical trials.

The b2-integrins can be utilized for detecting and tar-

geting activated leukocytes in situations where leukocyte

activity is unwanted, or of diagnostic value, e.g. detecting

or tracking autoimmune and inflammatory responses. We

have previously identified, using phage display selection, a

nine amino acid peptide CPCFLLGCC (LLG), which binds

to activated b2-integrins [12]. In this study, we describe the

generation of a construct fusing green fluorescent protein

(GFP) with this leukocyte b2-integrin-targeting LLG pep-

tide, and the testing of the functionality of the resulting

fusion protein in cell adhesion experiments and in an ani-

mal model of skin lesion inflammation.

2 Methods

2.1 Construction of Expression Vectors

A coding sequence for the LLG peptide or a mutated

negative control (CPCFALACC, Ala-LLG), both contain-

ing a C-terminal 6xHis-tag followed by a translation ter-

mination codon, was introduced into a SacI/EcoRI digested

expression vector pGFPuv (Clontech) encoding for the

highly fluorescent ‘cycle 3’ variant of GFP using the oli-

gonucleotides 50-CTGCCCTTGCTTCCTGCT GGGTTGC

TGCAGGCCTCATCATCATCACCATCATTAAG-30 and

50AATTCTTAATGATGGTGATGATGATGA GGCCTG

CAGCAACCCAGCAGGAAGCAAGGGCAGAGCT-30 or

50-CTGCCCTTGCTTCGCTCTGGCTTGCTGCAGGCCT

CATCATCATCACCATCATTAAG-30 and 50-AATTCT

TAATGATGGTGATGATGATGAGGCCTGCAGCAAG

CCAGAGCGAAG CAAGGGCAGAGCT-30, respectively.

The resulting plasmids, named pLEB644 (encoding the

LLG-GFP chimera) and pLEB645 (encoding the Ala-LLG-

GFP chimera), were transformed into the Escherichia coli

strain TG1 using electroporation and renamed ECO669 and

ECO670, respectively.

2.2 Expression and Purification of LLG-GFP

and Ala-LLG-GFP Chimeras

The plasmids pLEB644 and pLEB645 were transformed

into the E. coli strain BL21Star(DE3)pLysS (Invitrogen)

and grown in 1,000 mL pre-warmed Luria-Bertani medium

supplemented with ampicillin (100 lg/mL) at 37 �C with

shaking (220 rpm) to early logarithmic growth phase

(optical density600nm = 0.5). The expression of chimeric

proteins was induced by addition of isopropyl b-D-1-thio-

galactopyranoside (IPTG) to a final concentration of

0.3 mM for 3 h. Cells were harvested by centrifugation at

7,000g for 10 min. Bacterial pellets were re-suspended in

40 mL binding buffer (20 mM sodium phosphate, 500 mM

sodium chloride, pH 7.8) containing 1 mg/mL of lyso-

zyme, incubated for 10 min at 37 �C with shaking followed

by 15 min sonication in a water bath sonicator. Bacterial

debris was removed by centrifugation at 25,000g for

20 min, and the supernatants were filtered through a

0.45 lm filter (Sartorius). The LLG-GFP and Ala-LLG-

GFP chimeras were recovered from the filtrates with

Novagen� HisBind� Quick 900 Cartridges (EMD Milli-

pore, Billerica, MA, USA) according to the manufacturer’s

40 T.-M. Ranta et al.

instructions. The elution buffer (1 M imidazole, 0.5 M

NaCl, 20 mM Tris-HCl, pH 7.9) was replaced with phos-

phate buffered saline (PBS) by Amicon� Ultra-4 Centrif-

ugal Filter Units (EMD Millipore, Billerica, MA, USA),

and stored at 4 �C.

2.3 Electrophoretic and Western Blot Analysis

The purity of eluates was analyzed with sodium dodecyl

sulfate polyacrylamide gel electrophoresis (SDSPAGE) on

15 % gels. Immunoreactivity of a 1:500 diluted rabbit

polyclonal anti-LLG serum against LLG-GFP and Ala-

LLG-GFP was verified by WesternBreeze� Chromogenic

Western Blot Immunodetection Kit (Invitrogen) on Im-

mobilon-P PVDF-membrane (EMD Millipore, Bedford,

MA, USA).

2.4 Binding to a CD11b/CD18-Expressing Cultured

cell Line

LLG-GFP, Ala-LLG-GFP, and glutathione S-transferase

(GST) [12] alone were coated at a concentration of 40 lg/

mL in PBS on microtiter wells overnight at 4 �C. Blocking

was done with 3 % bovine serum albumin (BSA) in PBS

for 2 h at room temperature. After blocking, wells were

washed three times with PBS.

THP-1 cells were activated for 30 min using 50 nM 4b-

phorbol 12,13-butyrate (PDBu; Sigma) in RPMI-1640 cell

medium containing 0.1 % BSA and 1 mM MgCl2 at 37 �C,

5 % CO2. For experiments testing competing peptides, the

activation medium was replaced with fresh BSA/MgCl2supplemented medium and the cells were further incubated

with or without synthetic LLG peptide (CPCFLLGCC,

guided disulfide bridging C1–C8, C3–C9; AnaSpec, San

Jose, CA, USA) for 20 min before microtiter wells, coated

with the GFP-chimeras or GST alone, were overlaid with

100,000 cells in suspension. As a control, THP-1 binding to

non-coated, BSA-blocked wells was also tested.

After 30 min incubation at 37 �C, 5 % CO2, wells were

washed twice with PBS. Detection of bound cells was

performed with cellular phosphatase assay [13]. Briefly,

100 lL of substrate buffer (3 mg/mL p-nitrophenyl phos-

phate salt in acetate buffer, pH 5.0 with 1 % Triton X 100)

was incubated with cells at 37 �C for 30 min. After addi-

tion of 50 lL of 1 M NaOH, the yellow color was red at

405 nm in a microtiter plate reader.

2.5 Targeting to Sites of Inflammation

C57Bl/6N mice, 10–12 weeks old, with body weights

18–26 g (Charles River Laboratories, Sulzfeld, Germany),

were kept in polycarbonate cages in temperature-controlled

rooms with 12 h light/dark cycle, and access to water and

standard rodent food ad libitum before and during the

study. Animals were anesthetized with ketamine (110 mg/

kg body weight)/xylazine (16 mg/kg body weight) during

handling and imaging. All experiments were carried out in

accordance with the guidelines for Animal Care of the

University of Kiel, Vote No. V 312-72241.121-33 (8-1/12).

To image leukocyte binding in vivo, a scratch migration

assay was conducted. Briefly, the skin of C57Bl/6N mice

(n = 3 in each goup) was lightly scratched on the back

right flank and imaged 24 h later. LLG-GFP and Ala-LLG-

GFP constructs were administered by tail vein injection in

a volume of 200 lL (200 lg) per mice. The mice were

imaged with a Berthold NightOwl fluorescence camera, 1

hour after injection. Image analysis was performed using

the Indigo software.

3 Results and Discussion

Chimeric proteins were isolated from bacteria encoding

GFP containing C-terminal fusions with either the wild-

type b2-integrin-binding peptide LLG (LLG-GFP) or its

mutant form (Ala-LLG-GFP) which lacks b2-integrin

specificity. Electrophoretic analysis of purified chimeras

shows one-step purification gave highly pure elution frac-

tions for both chimeras, in which the major bands migrated

at a rate consistent with a mass slightly greater than

30 kDa, as expected for GFP supplemented with seventeen

additional amino acids (Fig. 1). Western blot analysis

confirmed the identity of the 30 kDa band as the LLG-GFP

construct, whereas the Ala-LLG-GFP showed no immu-

noreactivity with the rabbit anti-LLG serum (Fig. 2).

LLG peptide fused to GST has previously been shown to

bind activated leukocytes through CD11b/CD18 and

Fig. 1 LLG and Ala-LLG chimeras are expressed in highly purified

samples after one-step purification. Electrophoretic analysis of crude

lysates and purified chimeras from isopropyl b-D-1-thiogalactopyra-

noside (IPTG)-induced cell cultures. Lane 1 molecular weight

markers; Lane 2 crude lysate of Escherichia coli strain BL21Star

(DE3)pLysS; Lane 3 crude lysate of LLG-GFP producing strain; Lane

4 purified LLG-GFP; Lane 5 crude lysate of Ala-LLG-GFP producing

strain; Lane 6 purified Ala-LLG-GFP

LLG Peptide in Leukocyte Targeting 41

CD11c/CD18 integrins in cell adhesion assays [12]. To

determine whether our GFP fusion proteins were biologi-

cally functional, we first assessed their ability to bind

activated leukocytes in vitro. LLG-GFP and Ala-LLG-GFP

were immobilized on microtiter well plates, overlaid with

activated leukocytes and assayed for leukocyte binding.

Wells coated with the LLG-GFP strongly bound activated

b2-integrin-expressing THP-1 cells, suggesting that the

addition of GFP did not inhibit the ability of LLG to bind

activated leukocytes. The interaction between LLG-GFP

and activated leukocytes was specific for the LLG peptide,

as Ala-LLG-GFP showed significantly reduced binding

strength at levels comparable to that of background binding

levels of BSA or GST alone (Fig. 3). Binding was further

confirmed to be LLG-dependent as leukocyte retention

could be competitively inhibited through the use of the

synthetic LLG peptide. These results suggest that the

addition of an N-terminal GFP does not prevent binding of

the LLG peptide to activated leukocytes and that binding is

due mainly to the presence of the LLG peptide and not

resulting from the presence of GFP.

Next, we sought to determine whether our LLG-GFP

fusion protein would be capable of targeting and binding to

activated leukocytes in vivo. Mice were subjected to mild

scratches to induce skin surface inflammation, and sub-

sequent activation and recruitment of activated leukocytes.

The mice were then injected with purified LLG-GFP or

Ala-LLG-GFP and subjected to fluorescent planar imaging

to quantify the presence of GFP at the site of inflammation

(Fig. 4a). LLG-GFP-injected mice showed clear accumu-

lation of fluorescent GFP signal at the sites of inflammation

as compared to mice injected with the control Ala-LLG-

GFP construct, in which the GFP signal at the wounds were

similar to that of non-inflamed control surfaces (i.e. ears)

(Fig. 4b). Analysis and quantification of fluorescence in

LLG-GFP-injected mice showed fluorescent peak intensi-

ties approximately 2.5-fold greater than those in Ala-LLG-

GFP-injected mice or in non-inflamed control surfaces

(Fig. 4c, d). Significant increase in the average fluorescent

intensity in inflamed areas of LLG-GFP-injected mice were

seen as compared to non-inflamed regions or Ala-LLG-

GFP-injected mice (Fig. 4e). These data demonstrate that

LLG-GFP accumulates at the sites of inflammation and can

be used as a fluorescent marker to label and locate acti-

vated leukocytes in vivo. The method thereby provides a

new tool for the studies of activated leukocyte b2-integrins,

allowing the identification and targeting of sites of

inflammation in vivo.

Fig. 2 Purified LLG-GFP protein band is immunoreactive with anti-

LLG serum. Western blot analysis of purified chimeras using rabbit

polyclonal anti-LLG serum. Lane 1 molecular weight markers; Lane 2

LLG-GFP; Lane 3 Ala-LLG-GFP

0

20

40

60

80

100

LLG-GFP Ala-LLG-GFP GFP LLG-GFP GST BSA

Rel

ativ

e bi

ndin

g in

per

cen

ts

+20 µM LLGcoating

inhibition

p=0.00018

Fig. 3 LLG-GFP specifically binds to activated leukocytes in vitro.

Microtiter plate wells were coated with LLG-GFP, Ala-LLG-GFP or

control substrates (Green Fluorescent Protein (GFP), glutathione

S-transferase (GST), bovine serum albumin (BSA)) and assayed for

their ability to bind leukocytes activated with 4b-phorbol 12,13-

butyrate (PDBu). Specificity of binding was confirmed by the addition

of a synthetic LLG peptide. The result shown is from representative

experiment with three parallel wells per construct, and values

represent average relative binding ± standard deviation (n = 3)

42 T.-M. Ranta et al.

4 Conclusion

The LLG-GFP chimera is an interesting candidate for

future research to shed light on the binding partners of

leukocyte integrins, on the mechanisms of leukocyte acti-

vation and the processes involved in inflammatory

response, as well as a potential diagnostic aid in clinical

work. LLG peptides also hold interesting potential in

Fig. 4 LLG-GFP targets to and

accumulates at sites of

inflammation in vivo.

a Fluorescence planar image of

C57Bl/6N mice (n = 3) with

scratches on their right flank.

Mice were injected with LLG-

GFP (left) or Ala-LLG-GFP

(right). b Inflamed (top) and

non-inflamed control surface

(middle) regions of LLG-GFP-

injected mice and the inflamed

region of Ala-LLG-GFP

(bottom) were expanded.

c Surface rendering and

z-profile fluorescent intensity

histogram (d) of inflamed (left)

and non-inflamed control

surface (middle) regions of

LLG-GFP-injected mice and the

inflamed region of Ala-LLG-

GFP mice (right) were

determined and fluorescent

intensities quantified 20 min

post-injection (e). f Binding

kinetics of LLG-GFP and Ala-

GFP were also determined

relative to non-targeted control

site and found to be significantly

different showing enhanced

accumulation of the targeted

LLG-GFP construct compared

to the Ala-GFP control. Results

represent average

values ± standard deviation.

*p \ 0.05, ***p \ 0.001. cps

counts per second

LLG Peptide in Leukocyte Targeting 43

combination with other drug delivery methods. Moreover,

since the ability of the LLG peptide to target to foci of

inflammation in vivo is not hampered even when it is fused

to a large molecule such as GFP (30 kDa), the coupling of

phage display peptides to nanoparticles is especially

appealing, since it enables increasing overall avidities of

nanoparticles due to multiple binding sites [14]. Similar

prospects have been observed using gelatinase and tumor

vasculature-targeting peptides combined to heavier coun-

terparts [15]. Therefore, the potential of LLG to be used as

a homing surrogate marker or targeting moiety in forth-

coming chimeric molecules deserves future attention and

studies, both for imaging and therapeutic purposes.

Acknowledgments This work has been supported by grants from

the Academy of Finland (project number 177321), Biomedicum

Helsinki Foundation, Dental Society Apollonia, Duodecim Founda-

tion, Emil Aaltonen Foundation, Helsinki University Central Hospital

Research Foundation, Helsinki Graduate Program in Biotechnology

and Molecular Biology, Magnus Ehrnrooth Foundation, the Wilhelm

and Else Stockmann Foundation, the Sigrid Juselius Foundation, The

Finnish Medical Association, and Sukuseura Lindgren. Imaging

support was provided by the Molecular Imaging North Competence

Center (MOIN CC) at the Christian-Albrechts-University, Kiel,

Germany.

The authors have no conflicts of interest to declare that are directly

relevant to the content of this study.

References

1. Mortier A, Van Damme J, Proost P. Overview of the mechanisms

regulating chemokine activity and availability. Immunol Lett.

2012;145(1–2):2–9.

2. Bueno SM, Riquelme S, Riedel CA, Kalergis AM. Mechanisms

used by virulent Salmonella to impair dendritic cell function and

evade adaptive immunity. Immunology. 2012;137(1):28–36.

3. Andersson LC, Gahmberg CG, Kimura AK, Wigzell H. Activated

human T lymphocytes display new surface glycoproteins. Proc

Natl Acad Sci. 1978;75(7):3455–8.

4. Gahmberg CG, Fagerholm SC, Nurmi SM, Chavakis T, March-

esan S, Gronholm M. Regulation of integrin activity and sig-

nalling. Biochim Biophys Acta. 2009;1790(6):431–444.

5. Bansal VS, Vaidya S, Somers EP, Kanuga M, Shevell D, Weikel

R, et al. Small molecule antagonists of complement receptor type

3 block adhesion and adhesion-dependent oxidative burst in

human polymorphonuclear leukocytes. J Pharmacol Exp Ther.

2003;304(3):1016–24.

6. Bjorklund M, Aitio O, Stefanidakis M, Suojanen J, Salo T, Sorsa

T, et al. Stabilization of the activated alphaMbeta2 integrin by a

small molecule inhibits leukocyte migration and recruitment.

Biochemistry. 2006;45(9):2862–71.

7. Suojanen J, Salo T, Sorsa T, Koivunen E. AlphaMbeta2 integrin

modulator exerts antitumor activity in vivo. Anticancer Res.

2007;27(6B):3775–81.

8. Gahmberg CG, Tolvanen M, Kotovuori P. Leukocyte adhesion—

structure and function of human leukocyte beta2-integrins and

their cellular ligands. Eur J Biochem. 1997;245(2):215–32.

9. Mittra ES, Goris ML, Iagaru AH, Kardan A, Burton L, Berganos

R, et al. Pilot pharmacokinetic and dosimetric studies of (18)F-

FPPRGD2: a PET radiopharmaceutical agent for imaging

alpha(v)beta(3) integrin levels. Radiology. 2011;260(1):182–91.

10. Chen X, Park R, Khankaldyyan V, Gonzales-Gomez I, Tohme M,

Moats RA, et al. Longitudinal microPET imaging of brain tumor

growth with F-18-labeled RGD peptide. Mol Imaging Biol.

2006;8(1):9–15.

11. Benezra M, Penate-Medina O, Zanzonico PB, Schaer D, Ow H,

Burns A, et al. Multimodal silica nanoparticles are effective

cancer-targeted probes in a model of human melanoma. J Clin

Invest. 2011;121(7):2768–80.

12. Koivunen E, Ranta TM, Annila A, Taube S, Uppala A, Jokinen

M, et al. Inhibition of beta(2) integrin-mediated leukocyte cell

adhesion by leucine–leucine–glycine motif-containing peptides.

J Cell Biol. 2001;153(5):905–16.

13. Gahmberg CG, Valmu L, Hilden TJ, Ihanus E, Tian L, Nyman H,

et al. Leukocyte cell adhesion interactions. In: Fleming TP, edi-

tor. Cell–cell interactions: a practical approach. New York:

Oxford University Press; 2002. p. 93–118.

14. Penate Medina O, Haikola M, Tahtinen M, Simpura I, Kaukinen

S, Valtanen H, et al. Liposomal tumor targeting in drug delivery

utilizing MMP-2- and MMP-9-binding ligands. J Drug Deliv.

2011;2011:160515.

15. Suojanen J, Vilen ST, Nyberg P, Heikkila P, Penate-Medina O,

Saris PE, et al. Selective gelatinase inhibitor peptide is effective

in targeting tongue carcinoma cell tumors in vivo. Anticancer

Res. 2011;31(11):3659–64.

44 T.-M. Ranta et al.