HIF-2α is essential for carotid body development and function · 2018. 1. 19. · 6 133 Results...

1

1

HIF-2α is essential for carotid body development and function 2

3

4

5

David Macías1, Andrew S. Cowburn1,2, Hortensia Torres-Torrelo3, Patricia 6

Ortega-Sáenz3, José López-Barneo3, and Randall S. Johnson1,4,5. 7 81Department of Physiology, Development and Neuroscience. 2Department of 9

Medicine, University of Cambridge, Cambridge, UK; 3Instituto de Biomedicina 10

de Sevilla (IBiS), Seville, Spain. 4Department of Cell and Molecular Biology, 11

Karolinska Institute, Stockholm, Sweden. 12

13

14

15

16

17

18

19

20

21

22

Keywords: hypoxia, carotid body, oxygen sensing, HIF-2α, HVR, physiological 23

responses 24

25

26

275For correspondence: Professor Randall S. Johnson, Department of 28

Physiology, Development and Neuroscience, University of Cambridge, 29

Downing Street, Cambridge. CB2 3EG. United Kingdom. E-mail: 30

[email protected] 31

32

33

.CC-BY 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made

The copyright holder for this preprint (whichthis version posted January 19, 2018. ; https://doi.org/10.1101/250928doi: bioRxiv preprint

https://doi.org/10.1101/250928

http://creativecommons.org/licenses/by/4.0/

2

Summary 34

Mammalian adaptation to oxygen flux occurs at many levels, from shifts in 35

cellular metabolism to physiological adaptations facilitated by the sympathetic 36

nervous system and carotid body (CB). Interactions between differing forms of 37

adaptive response to hypoxia, including transcriptional responses 38

orchestrated by the Hypoxia Inducible transcription Factors (HIFs), are 39

complex and clearly synergistic. We show here that there is an absolute 40

developmental requirement for HIF-2a, one of the HIF isoforms, for growth 41

and survival of oxygen sensitive glomus cells of the carotid body. The loss of 42

these cells renders mice incapable of ventilatory responses to hypoxia, and 43

this has striking effects on processes as diverse as arterial pressure 44

regulation, exercise performance, and glucose homeostasis. We show that 45

the expansion of the glomus cells is correlated with mTORC1 activation, and 46

is functionally inhibited by rapamycin treatment. These findings demonstrate 47

the central role played by HIF-2a in carotid body development, growth and 48

function. 49

50

51

52

53

54

55

56

57

58



https://doi.org/10.1101/250928


3

Introduction 59

Detecting and responding to shifts in oxygen availability is essential for animal 60

survival. Responding to changes in oxygenation occurs in cells, tissues, and 61

at the level of the whole organism. Although many of responses to oxygen flux 62

are regulated at the transcriptional level by the hypoxia inducible transcription 63

factor (HIF), at tissue and organismal levels there are even more dimensions 64

to the adaptive process. In vertebrates, the actors in adaptation are found in 65

different peripheral chemoreceptors, including the neuroepithelial cells of the 66

gills in teleosts, and in the carotid body (CB) of mammals. The CB regulates 67

many responses to changes in oxygenation, including alterations in ventilation 68

and heart rates. 69

70

The carotid body is located at the carotid artery bifurcation, and contains 71

glomeruli that contain O2-sensitive, neuron-like tyrosine hydroxylase (TH)-72

positive glomus cells (type I cells). These glomus cells are responsible for a 73

rapid compensatory hypoxic ventilatory response (HVR) when a drop in 74

arterial O2 tension (PO2) occurs (Lopez-Barneo, Ortega-Saenz, et al., 2016; 75

Teppema & Dahan, 2010). In addition to this acute reflex, the CB plays an 76

important role in acclimatization to sustained hypoxia, and is commonly 77

enlarged in people living at high altitude (Arias-Stella & Valcarcel, 1976; Wang 78

& Bisgard, 2002) and in patients with chronic respiratory diseases (Heath & 79

Edwards, 1971; Heath, Smith, & Jago, 1982). This enlargement is induced 80

through a proliferative response of CB stem cells (type II cells)(Pardal, 81

Ortega-Saenz, Duran, & Lopez-Barneo, 2007; Platero-Luengo et al., 2014). 82



https://doi.org/10.1101/250928


4

During embryogenesis, the initiating event in CB organogenesis occurs when 83

multipotent neural crest cells migrate toward the dorsal aorta, to give rise to 84

the sympathoadrenal system (Le Douarin, 1986). Segregation of sympathetic 85

progenitors from the superior cervical ganglion (SCG) then creates the CB 86

parenchyma (Kameda, 2005; Kameda, Ito, Nishimaki, & Gotoh, 2008). This 87

structure is comprised of O2-sensitive glomus cells (type-I cells) (Pearse et al., 88

1973), glia-like sustentacular cells (type-II cells) (Pardal et al., 2007) and 89

endothelial cells (Annese, Navarro-Guerrero, Rodriguez-Prieto, & Pardal, 90

2017). 91

92

The cellular response to low oxygen is in part modulated by two isoforms of 93

the HIF-α transcription factor, each with differing roles in cellular and 94

organismal response to oxygen flux: HIF-1α and HIF-2α. At the organismal 95

level, mouse models hemizygous for HIFs-α (Hif-1α+/- and Hif-2α+/-) or where 96

HIF inactivation was induced in adults showed contrasting effects on CB 97

function, without in either case affecting CB morphogenesis (Hodson et al., 98

2016; Kline, Peng, Manalo, Semenza, & Prabhakar, 2002; Y. J. Peng et al., 99

2011). 100

101

Transcriptome analysis has confirmed that Hif-2α is the second most 102

abundant transcript in neonatal CB glomus cells (Tian, Hammer, Matsumoto, 103

Russell, & McKnight, 1998; Zhou, Chien, Kaleem, & Matsunami, 2016), and 104

that it is expressed at far higher levels than are found in cells of similar 105

developmental origins, including superior cervical ganglion (SCG) sympathetic 106

neurons (Gao et al., 2017). It has also been recently shown that Hif-2α, but 107



https://doi.org/10.1101/250928


5

not Hif-1α, overexpression in sympathoadrenal cells leads to enlargement of 108

the CB (Macias, Fernandez-Aguera, Bonilla-Henao, & Lopez-Barneo, 2014). 109

Here, we report that HIF-2α is required for the development of CB O2-110

sensitive glomus cells, and that mutant animals lacking CB function have 111

impaired adaptive physiological responses. 112

113

114

115

116

117

118

119

120

121

122

123

124

125

126

127

128

129

130

131

132



https://doi.org/10.1101/250928


6

Results 133

Sympathoadrenal Hif-2α loss blocks carotid body glomus cell 134

development 135

To elucidate the role of HIFα isoforms in CB development and function, we 136

generated mouse strains carrying Hif-1α or Hif-2α embryonic deletions (TH-137

HIF-1αKO and TH-HIF-2αKO) restricted to catecholaminergic tissues by 138

crossing them with a mouse strain expressing cre recombinase under the 139

control of the endogenous tyrosine hydroxylase (TH) promoter (Macias et al., 140

2014). 141

142

Histological analysis of the carotid artery bifurcation dissected from adult TH-143

HIF-2αKO mice revealed virtually no CB TH+ glomus cells (Figure 1A, bottom 144

panels) compared to HIF-2αWT littermate controls (Figure 1A, top panels). 145

Conversely, TH-HIF-1αKO mice showed a typical glomus cell organization, 146

characterized by scattered clusters of TH+ cells throughout the CB 147

parenchyma (Figure 1B, bottom panels) similar to those found in HIF-1αWT 148

littermate controls (Figure 1B, top panels). These observations were further 149

corroborated by quantification of the total CB parenchyma volume (Figure 1D-150

1F). 151

152

Other catecholaminergic organs whose embryological origins are similar to 153

those of the CB, e.g., the superior cervical ganglion (SCG), do not show 154

significant differences in structure or volume between TH-HIF-2αKO mutants 155

and control mice (Figure 1A-C). This suggests a specific role of HIF-2α in the 156

development of the CB glomus cells, and argues against a global role for the 157



https://doi.org/10.1101/250928


7

gene in development of catecholaminergic tissues. Further evidence for this 158

comes from phenotypic characterization of adrenal medulla (AM) TH+ 159

chromaffin cells. No major histological alterations were observed in adrenal 160

glands removed from TH-HIF-2αKO and TH-HIF-1αKO mutant mice compared 161

to HIF-2αWT and HIF-1αWT littermate controls (Figure 1G and H). Consistent 162

with this, the amount of catecholamine (adrenaline and noradrenaline) present 163

in the urine of TH-HIF-2αKO and TH-HIF-1αKO deficient mice was similar to 164

that found in their respective littermate controls (Figure 1I). 165

166

To determine deletion frequencies in these tissues, we crossed a loxP-flanked 167

Td-Tomato reporter strain (Madisen et al., 2010) with TH-IRES-Cre mouse 168

mice. Td-Tomato+ signal was only detected within the CB, SCG and AM of 169

mice expressing cre recombinase under the control of the Th promoter 170

(Figure 1-figure supplement 1A). Additionally, SCG and AM from HIF-2αWT, 171

HIF-1αWT, TH-HIF-2αKO and TH-HIF-1αKO were quantified for Hif-2α and Hif-172

1α deletion efficiency using genomic DNA. As expected, there is a significant 173

level of deletion of Hif-2α and Hif-1α genes detected in TH-HIF-2αKO and TH-174

HIF-1αKO mutant mice compared to HIF-2αWT and HIF-1αWT littermates 175

controls (Figure 1-figure supplement 1B and C). 176

177

To determine whether absence of CB glomus cells in adult TH-HIF-2αKO mice 178

is a result of impaired glomus cell differentiation or cell survival, we examined 179

carotid artery bifurcations dissected from TH-HIF-2αKO mice at embryonic 180

stage E18.5 (i.e., 1-2 days before birth), and postnatally (P0) (Figure 2A). 181

Differentiated TH+ glomus cells were found in the carotid bifurcation of TH-182



https://doi.org/10.1101/250928


8

HIF-2αKO mutant mice at both stages (Figure 2A). However, there is a 183

significant reduction in the total CB parenchyma volume and in the number of 184

differentiated TH+ glomus cells in TH-HIF-2αKO mice at E18.5, and this 185

reduction is even more evident in newborn mice (Figure 2B and C). Since CB 186

volume and cells number of mutant mice decreased in parallel, no significant 187

changes were seen in TH+ cell density at these two time points, however 188

(Figure 2D). 189

190

Consistent with the results described above (Figure 1C), the SCG volume was 191

not different in mutant newborns relative to wild type controls (Figure 2E). We 192

next assessed cell death in the developing CB, and found a progressive 193

increase in the number of TUNEL+ cells within the CB parenchyma of TH-HIF-194

2αKO mice compared to HIF-2αWT littermates (Figure 2F and G). These data 195

demonstrate that HIF-2α, but not HIF-1α, is essential for the differentiation of 196

CB glomus cells. 197

198

Impaired ventilatory response and whole-body metabolic activity in TH-199

HIF-2αKO mice exposed to hypoxia 200

Although TH-HIF-2αKO deficient mice did not show an apparent phenotype in 201

the AM or SCG, it was important to determine whether their secretory or 202

electrical properties were altered (Figure 3-figure supplement 1). The 203

secretory activity of chromaffin cells under basal conditions and in response to 204

hypoxia, hypercapnia and high (20mM) extracellular K+ was not changed in 205

TH-HIF-2αKO mice (8-12 weeks old) relative to control littermates (Figure 3-206

figure supplement 1A-D). Current-voltage (I-V) relationships for Ca2+ and K+ 207



https://doi.org/10.1101/250928


9

currents of dispersed chromaffin cells (Figure 3- figure supplement 1E) and 208

SCG neurons (Figure 3-figure supplement 1F) were also similar in HIF-2αWT 209

and TH-HIF-2αKO animals. These data further support the notion that HIF-2α 210

loss in the sympathoadrenal lineages predominantly affects CB glomus cells. 211

212

To study the impact of the TH-HIF-2αKO mutation on respiratory function, we 213

examined ventilation in normoxia (21% O2) and in response to environmental 214

normobaric hypoxia (10% O2) via whole-body plethysmography. Figure 3A 215

illustrates the changes of respiratory rate during a prolonged hypoxic time-216

course in HIF-2αWT and TH-HIF-2αKO littermates. HIF-2αWT mice breathing 217

10% O2 had a biphasic response, characterized by an initial rapid increase in 218

respiratory rate followed by a slow decline. In contrast, TH-HIF-2αKO mice, 219

which have normal ventilation rates in normoxia (Figure 3A-C), respond 220

abnormally throughout the hypoxic period. Averaged respiratory rate and 221

minute volume during the initial 5 minutes of hypoxia show a substantial 222

reduction in ventilation rate in TH-HIF-2αKO mutant mice relative to HIF-2αWT 223

controls (Figure 3B and C). 224

225

Additional respiratory parameters altered by the lack of CB in response to 226

hypoxia are shown in Figure 3-supplement 2. Consistent with these data, 227

hemoglobin saturation levels dropped to 50-55% in TH-HIF-2αKO mice, as 228

compared to 73% saturation in control animals after exposure to 10% O2 for 5 229

minutes (Figure 3D). HIF-1αWT and TH-HIF-1αKO mice have similar respiratory 230

responses to 21% O2 and 10% O2, which indicates that HIF-1α is not required 231



https://doi.org/10.1101/250928


10

for the CB-mediated ventilatory response to hypoxia (Figure 3E-G; Figure 3-232

supplemental 2F-J). 233

We next determined metabolic activity in HIF-2αWT and TH-HIF-2αKO 234

littermates in a 21% O2 or 10% O2 environment. Circadian metabolic profiles 235

(VO2 and VCO2) were similar in WT and TH-HIF-2αKO mutant mice (Figure 3H 236

and I). After exposure to hypoxia, however, TH-HIF-2αKO mice showed lower 237

VO2 and VCO2 peaks and had a significantly hampered metabolic adaptation 238

to low oxygen (Figure 3J and K). 239

240

Deficient acclimatization to chronic hypoxia in mice with CBs loss 241

The CB grows and expands during sustained hypoxia, due to the proliferative 242

response of glia-like (GFAP+) neural crest-derived stem cells within the CB 243

parenchyma (Arias-Stella & Valcarcel, 1976; Pardal et al., 2007). Despite the 244

absence of adult TH+ oxygen sensing cells in TH-HIF-2αKO mice, we identified 245

a normal number of CB GFAP+ stem cells in the carotid artery bifurcation of 246

these animals (Figure 4-figure supplement 1A). We then determined the rate 247

at which CB progenitors from TH-HIF-2αKO mice were able to give rise to 248

newly formed CB TH+ glomus cells after chronic hypoxia exposition in vivo. 249

Typical CB enlargement and emergence of double BrdU+ TH+ glomus cells 250

was seen in HIF-2αWT mice after 14 days breathing 10% O2 (Figure 4-figure 251

supplement 1B-D), as previously described (Pardal et al., 2007). However, no 252

newly formed double BrdU+ TH+ glomus cells were observed in TH-HIF-2αKO 253

mice after 14 days in hypoxia (Figure 4-figure supplement 1B-D). These 254

observations are consistent with the documented role of CB glomus cells as 255



https://doi.org/10.1101/250928


11

activators of the CB progenitors proliferation in response to hypoxia (Platero-256

Luengo et al., 2014). 257

258

HIF-2αWT, HIF-1αWT and TH-HIF-1αKO mice adapted well and survived up to 259

21 days in a 10% O2 atmosphere normally. However, long-term survival of the 260

TH-HIF-2αKO deficient mice kept in a 10% O2 environment was severely 261

compromised, and only 40% reached the experimental endpoint (Figure 4A). 262

Mouse necropsies revealed internal general haemorrhages, which are most 263

likely the cause of the death. TH-HIF-2αKO mice also showed increased 264

haematocrit and haemoglobin levels relative to HIF-2αWT littermates when 265

maintained for 21 days in a 10% O2 atmosphere (Figure 4B and C). 266

Consistent with this, after 21 days in hypoxia, heart and spleen removed from 267

TH-HIF-2αKO mice were enlarged relative to HIF-2αWT littermates, likely due to 268

increased blood viscosity and extramedullary hematopoiesis, respectively 269

(Figure 4D and E). TH-HIF-1αKO mice did not show significant differences 270

compared to HIF-1αWT littermates maintained either in a 21% O2 or 10% O2 271

environment (Figure 4-figure supplement 2A-D). 272

273

Chronic exposure to hypoxia induces pulmonary arterial hypertension (PAH) 274

in mice (Cowburn et al., 2016; Stenmark, Meyrick, Galie, Mooi, & McMurtry, 275

2009). The right ventricle was found to be significantly enlarged in TH-HIF-276

2αKO mice relative to control mice after 21 days of 10% O2 exposure, 277

indicating an aggravation of pulmonary hypertension (Figure 4F). This result 278

was further confirmed by direct measurement of right ventricular systolic 279

pressure (RVSP) on anaesthetised mice (Figure 4G). Lung histology of mice 280



https://doi.org/10.1101/250928


12

chronically exposed to 10% O2 (Figure 4H) shows that the percentage of fully 281

muscularized lung peripheral vessels is significantly increased in TH-HIF-2αKO 282

mice relative to controls. The tunica media of lung peripheral vessels was also 283

significantly thicker in TH-HIF-2αKO mice compared to HIF-2αKO littermates 284

after 21 days of hypoxic exposure (Figure 4I). Taken together, these data 285

demonstrate that pulmonary adaptation to chronic hypoxia is highly reliant on 286

a normally functioning CB. 287

288

Cardiovascular homeostasis is altered in mice lacking CBs 289

An important element of the CB chemoreflex is an increase in sympathetic 290

outflow (Lopez-Barneo, Ortega-Saenz, et al., 2016). To determine whether 291

this had been affected in TH-HIF-2αKO mutants, cardiovascular parameters 292

were recorded on unrestrained mice by radiotelemetry. Circadian blood 293

pressure monitoring showed a constitutive hypotensive condition that was 294

more pronounced during the diurnal period (Figure 5A and B) and did not 295

correlate with changes in heart rate, subcutaneous temperature or activity 296

(Figure 5C; Figure 5-figure supplement 1A and B). We next subjected 297

radiotelemetry-implanted HIF-2αWT and TH-HIF-2αKO littermates to a 10% O2 298

environment preceded and followed by a 24 hour period of normoxia (Figure 299

5D-F; Figure 5-figure supplement 1C-E). Normal control HIF-2αWT mice have 300

a triphasic response to this level of hypoxia, characterised by a short (10 301

minutes) initial tachycardia and hypertension, followed by a marked drop both 302

in heart rate and blood pressure; a partial to complete recovery is then seen 303

after 24-36 hours (Figure 5D and E; Figure 5-figure supplement 1C and 304

D)(Cowburn, Macias, Summers, Chilvers, & Johnson, 2017). However, while 305



https://doi.org/10.1101/250928


13

TH-HIF-2αKO mice experienced similar, but less deep, hypotension 3 hours 306

post hypoxic challenge, they failed to recover, and showed a persistent 307

hypotensive state throughout the hypoxic period (Figure 5D; Figure 5-figure 308

supplement 1C and D). Interestingly, the bradycardic effect of hypoxia on 309

heart rate was abolished in TH-HIF-2αKO animals (Figure 5E). Subcutaneous 310

temperature, an indirect indicator of vascular resistance in the skin, showed 311

an analogous trend to that seen in the blood pressure of TH-HIF-2αKO 312

mutants (Figure 5F). Activity of TH-HIF-2αKO mice during hypoxia was slightly 313

reduced relative to littermate controls (Figure 5-figure supplement 1E). 314

315

The carotid body has been proposed as a therapeutic target for neurogenic 316

hypertension (McBryde et al., 2013; Pijacka et al., 2016). To determine the 317

relationship between CB and hypertension in these mutants, we performed 318

blood pressure recordings in an angiotensin II (Ang II)-induced experimental 319

hypertension model (Figure 5G). As shown, TH-HIF-2αKO animals showed 320

lower blood pressure relative to HIF-2αWT littermate controls after 7 days of 321

Ang II infusion (Figure 5H; Figure 5-figure supplement 1F and G). Heart rate, 322

subcutaneous temperature and physical activity were unchanged throughout 323

the experiment (Figure 5K-M; Figure 5-figure supplement 1). Collectively, 324

these data highlight the CB as a systemic cardiovascular regulator which, 325

contributes to baseline blood pressure modulation, is critical for 326

cardiovascular adaptations to hypoxia and delays the development of Ang II-327

induced experimental hypertension. 328

329



https://doi.org/10.1101/250928


14

Adaptive responses to exercise and high glucose are affected in mice 330

with CB dysfunction 331

We next questioned whether this mutant, which lacks virtually all CB function, 332

can inform questions about adaptation to other physiological stressors. In the 333

first instance, we assessed metabolic activity during a maximal exertion 334

exercise test. Oxygen consumption and carbon dioxide production (VO2 and 335

VCO2, respectively) were comparable in HIF-2αWT and TH-HIF-2αKO mice at 336

the beginning of the test. However, TH-HIF-2αKO mutants reached VO2max 337

much earlier than wild type controls, with significantly decreased heat 338

generation (Figure 6A, B and D). There was no shift in energetic substrate 339

usage, as evidenced by the lack of difference in respiratory exchange ratio 340

(RER) (Figure 6C). The time to exhaustion trended lower in mutants, and 341

there was a significant reduction in both aerobic capacity and power output 342

relative to littermate controls (Figure 6E-G). Interestingly, although no 343

significant changes were found in glucose blood content across the 344

experimental groups and conditions (Figure 6H), lactate levels in TH-HIF-2αKO 345

mice were significantly lower than those observed in HIF-2αWT mice after 346

running (Figure 6I). 347

348

We next examined the response of TH-HIF-2αKO mice to hyperglycemic and 349

hypoglycemic challenge. Baseline glucose levels of HIF-2αWT and TH-HIF-350

2αKO animals were not statistically different under fed and fasting conditions 351

(Figure 6J and K), and metabolic activity during fasting was unaffected (Figure 352

6-figure supplement 1A-D). However, TH-HIF-2αKO mutant mice showed 353

significant changes in glucose tolerance, with no change in insulin tolerance 354



https://doi.org/10.1101/250928


15

when compared to HIF-2αWT littermates (Figure 6L and M). TH-HIF-2αKO mice 355

also showed an initially hampered lactate clearance relative to control mice 356

(Figure 6N). Together, these data demonstrate that the mutants demonstrate 357

intriguing roles for the CB in metabolic adaptations triggered by both exercise 358

and hyperglycemia. 359

360

CB development and proliferation in response to hypoxia require 361

mTORC1 activation 362

Hypoxia is an mTORC1 activator that can induce cell proliferation and growth 363

in a number of organs, e.g., the lung parenchyma (Brusselmans et al., 2003; 364

Cowburn et al., 2016; Elorza et al., 2012; Hubbi & Semenza, 2015; Torres-365

Capelli et al., 2016). Physiological proliferation and differentiation of the CB 366

induced by hypoxia closely resembles CB developmental expansion (Annese 367

et al., 2017; Pardal et al., 2007; Platero-Luengo et al., 2014); therefore a 368

potential explanation for the developmental defects in CB expansion observed 369

in above could be defects in mTORC1 activation. 370

371

To test this hypothesis, we first determined mTORC1 activation levels in the 372

CB of mice maintained at 21% O2 or 10% O2 for 14 days. This was done via 373

immunofluorescent detection of the phosphorylated form of the ribosomal 374

protein S6 (p-S6) (Elorza et al., 2012; Ma & Blenis, 2009). In normoxia, there 375

was a faint p-S6 expression within the TH+ glomus cells of the CB in wild type 376

mice; this contrasts with the strong signal detected in SCG sympathetic 377

neurons (Figure 7A, left panels; Figure 7-figure supplement 1A, left panel). 378

However, after 14 days in a 10% O2 environment, we saw a significantly 379



https://doi.org/10.1101/250928


16

increased p-S6 signal within the CB TH+ cells while the SCG sympathetic 380

neurons remained at levels similar to those seen in normoxia (Figure 7A and 381

B; Figure 7-figure supplement 1A and B). TH expression, which is induced by 382

hypoxia (Schnell et al., 2003), was also significantly elevated in CB TH+ cells, 383

and trended higher in SCG sympathetic neurons (Figure 7B; Figure 7-figure 384

supplement 1B). 385

386

We next assessed the role of HIF-2α in this hypoxia-induced mTORC1 387

activation. We began with evaluating expression of p-S6 in late stage 388

embryos. In E18.5 embryos there was a striking accumulation of p-S6; this is 389

significantly reduced in HIF-2α deficient CB TH+ cells in embryos from this 390

stage of development (Figure 7C and D). p-S6 levels in SCG TH+ sympathetic 391

neurons of HIF-2αWT and TH-HIF-2αKO E18.5 embryos were unaffected, 392

however (Figure 7-figure supplement 1C and D). 393

394

TH expression trended lower in both CB and SCG TH+ cells from TH-HIF-395

2αKO E18.5 embryos relative to HIF-2αWT littermate controls (Figure 7D; 396

Figure 7-figure supplement 1D). These data indicate that HIF-2α regulates 397

mTORC1 activity in the CB glomus cells during development. To determine 398

whether this pathway could be pharmacologically manipulated, we then 399

studied the effect of mTORC1 inhibition by rapamycin on CB proliferation and 400

growth following exposure to environmental hypoxia. mTORC1 activity, as 401

determined by p-S6 staining on SCG and CB TH+ cells after 14 days of 402

hypoxic treatment, was inhibited after in vivo rapamycin administration (Figure 403

7-figure supplement 1E). Interestingly, histological analysis of rapamycin 404



https://doi.org/10.1101/250928


17

injected wild type mice maintained for 14 days at 10% O2 showed decreased 405

CB parenchyma volume, TH+ cells number, and showed a dramatic reduction 406

in the number of proliferating double BrdU+ TH+ cells when compared to 407

vehicle-injected mice (Figure 7E-H). 408

409

In addition, we assessed the ventilatory acclimatization to hypoxia (VAH), as a 410

progressive increase in ventilation rates is associated with CB growth during 411

sustained exposure to hypoxia (Hodson et al., 2016). Consistent with the 412

histological analysis above, rapamycin treated mice had a decreased VAH 413

compared to vehicle-injected control mice following 7 days at 10% O2 (Figure 414

7K). Haematocrit levels were comparable between vehicle control and 415

rapamycing treated wild type mice after 7 days in hypoxia (Figure 7-figure 416

supplement 1F). 417

418

Collectively, these data indicate that mTORC1 activation is required for CB 419

expansion in a HIF-2α-dependent manner, and this activation regulates CB 420

growth and subsequent VAH under prolonged low pO2 conditions. 421

422



https://doi.org/10.1101/250928


18

Discussion 423

Metabolic homeostasis depends on a complex system of O2-sensing cells and 424

organs. The carotid body is central to this, via its regulation of metabolic and 425

ventilatory responses to oxygen (Lopez-Barneo, Macias, Platero-Luengo, 426

Ortega-Saenz, & Pardal, 2016). At the cellular level, the HIF transcription 427

factor is equally central for responses to oxygen flux. However, how HIF 428

contributes to the development and function of CB O2-sensitivity is still not 429

completely understood. Initial studies performed on global Hif-1α-/- or Hif-2α-/- 430

mutant mice revealed that HIFs are critical for development (Compernolle et 431

al., 2002; Iyer et al., 1998; J. Peng, Zhang, Drysdale, & Fong, 2000; Ryan, Lo, 432

& Johnson, 1998; Scortegagna et al., 2003; Tian et al., 1998), but only HIF-433

2α-/- embryos showed defects in catecholamine homeostasis, which indicated 434

a potential role in sympathoadrenal development (Tian et al., 1998). 435

436

Investigations using hemizygous Hif-1α+/- and Hif-2α+/- mice showed no 437

changes in the CB histology or overall morphology (Kline et al., 2002; Y. J. 438

Peng et al., 2011). However, our findings demonstrate that embryological 439

deletion of Hif-2α, but not Hif-1α, specifically in sympathoadrenal tissues 440

(TH+) prevents O2-sensitive glomus cell development, without affecting SCG 441

sympathetic neurons or AM chromaffin cells of the same embryological origin. 442

It was previously reported that HIF-2α, but not HIF-1α overactivation in 443

catecholaminergic tissues led to marked enlargement of the CB (Macias et al., 444

2014). Mouse models of Chuvash polycythemia, which have a global increase 445

in HIF-2α levels, also show CB hypertrophy and enhanced acute hypoxic 446

ventilatory response (Slingo, Turner, Christian, Buckler, & Robbins, 2014). 447



https://doi.org/10.1101/250928


19

Thus either over-expression or deficiency of HIF-2α clearly perturbs CB 448

development and, by extension, function. 449

450

Sustained hypoxia is generally thought to attenuate cell proliferation in a HIF-451

1α-dependent fashion (Carmeliet et al., 1998; Goda et al., 2003; Koshiji et al., 452

2004). However, environmental hypoxia can also trigger growth of a number 453

of specialized tissues, including the CB (Arias-Stella & Valcarcel, 1976; Pardal 454

et al., 2007) and the pulmonary arteries (Madden, Vadula, & Kurup, 1992). In 455

this context, the HIF-2α isoform seems to play the more prominent role, and 456

has been associated with pulmonary vascular remodeling as well as with 457

bronchial epithelial proliferation (Brusselmans et al., 2003; Bryant et al., 2016; 458

Cowburn et al., 2016; Kapitsinou et al., 2016; Tan et al., 2013; Torres-Capelli 459

et al., 2016). 460

461

CB enlargement induced by hypoxia to a large extent recapitulates the cellular 462

events that give rise to mature O2-sensitive glomus cells in development. In a 463

recent study, global HIF-2α, but not HIF-1α, inactivation in adult mice was 464

shown to impair CB growth and associated VAH caused by exposure to 465

chronic hypoxia (Hodson et al., 2016). Therefore, we used this physiological 466

proliferative response as a model to understand the developmental 467

mechanisms underpinning of HIF-2α deletion in O2-sensitive glomus cells. 468

469

Contrasting effects of HIF-α isoforms on the mammalian target of rapamycin 470

complex 1 (mTORC1) activity can be found in the literature that mirror the 471

differential regulation of cellular proliferation induced by hypoxia in different 472



https://doi.org/10.1101/250928


20

tissues (see above) (Brugarolas et al., 2004; Elorza et al., 2012; Liu et al., 473

2006). Our findings reveal that mTORC1, a central regulator of cellular 474

metabolism, proliferation and survival (Laplante & Sabatini, 2012), is 475

necessary for CB O2-sensitive glomus cell proliferation; and further, that 476

impact in the subsequent enhancement of the hypoxic ventilatory response 477

induced by chronic hypoxia. Importantly, we found that mTORC1 activity is 478

reduced in HIF-2α-deficient embryonic glomus cells, but not in SCG 479

sympathetic neurons, which likely explains the absence of a functional adult 480

CB in these mutants. 481

482

As HIF-2α regulates mTORC1 activity to promote proliferation, this 483

connection could prove relevant in pathological situations; e.g., both somatic 484

and germline Hif-2α gain-of-function mutations have been found in patients 485

with paraganglioma, a catecholamine-secreting tumor of neural crest origin 486

(Lorenzo et al., 2013; Zhuang et al., 2012). Indeed, CB tumors are 10 times 487

more frequent in people living at high altitude (Saldana, Salem, & Travezan, 488

1973). As further evidence of this link, it has been shown that the mTOR 489

pathway is commonly activated in both paraganglioma and 490

pheochromocytoma tumors (Du et al., 2016; Favier, Amar, & Gimenez-491

Roqueplo, 2015). 492

493

CB chemoreception plays a crucial role in homeostasis, particularly in 494

regulating cardiovascular and respiratory responses to hypoxia. Our data 495

show that mice lacking CB O2-sensitive cells (TH-HIF-2αKO mice) have 496

impaired respiratory, cardiovascular and metabolic adaptive responses. 497



https://doi.org/10.1101/250928


21

Although previous studies have linked HIF-2α and CB function (Hodson et al., 498

2016; Y. J. Peng et al., 2011), none of them exhibited a complete CB loss of 499

function. This might explain the differing effects observed in hemizygous Hif-500

2α+/- mice (Hodson et al., 2016; Y. J. Peng et al., 2011) compared to our TH-501

HIF-2αKO mice. 502

Mice with a specific HIF-1α ablation in CB O2-sensitive glomus cells (TH-HIF-503

1αKO mice) did not show altered hypoxic responses in our experimental 504

conditions. Consistent with this, hemizygous Hif-1α+/- mice exhibited a normal 505

acute HVR (Hodson et al., 2016; Kline et al., 2002) albeit some otherwise 506

aberrant CB activities in response to hypoxia (Kline et al., 2002; Ortega-507

Saenz, Pascual, Piruat, & Lopez-Barneo, 2007). 508

509

Alterations in CB development and/or function have recently acquired 510

increasing potential clinical significance and have been associated with 511

diseases such as heart failure, obstructive sleep apnea, chronic obstructive 512

pulmonary disease, sudden death infant syndrome and hypertension 513

(Iturriaga, Del Rio, Idiaquez, & Somers, 2016; Lopez-Barneo, Ortega-Saenz, 514

et al., 2016). 515

516

We describe here the first mouse model with specific loss of carotid body O2-517

sensitive cells: a model that is viable in normoxia but shows impaired 518

physiological adaptations to both acute and chronic hypoxia. In addition, we 519

describe new and likely important roles for the CB in systemic blood pressure 520

regulation, exercise performance and glucose management. Further 521



https://doi.org/10.1101/250928


22

investigation of this mouse model could aid in revealing roles of the carotid 522

body in both physiology and disease. 523

524

525

526

527

528

529

530

531

532

533

534

535

536

537

538

539

540

541

542

543

544

545

546



https://doi.org/10.1101/250928


23

Material and Methods 547

Mice husbandry 548

This research has been regulated under the Animals (Scientific Procedures) 549

Act 1986 Amendment Regulations 2012 following ethical review by the 550

University of Cambridge Animal Welfare and Ethical Review Body (AWERB). 551

Targeted deletion of Hif-1α, Hif-2α and Td-Tomato in sympathoadrenal 552

tissues was achieved by crossing homozygous mice carrying loxP-flanked 553

alleles Hif1atm3Rsjo (Ryan et al., 1998), Epas1tm1Mcs (Gruber et al., 2007) or 554

Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (Madisen et al., 2010) into a mouse strain of 555

cre recombinase expression driven by the endogenous tyrosine hydroxylase 556

promoter (Thtm1(cre)Te)(Lindeberg et al., 2004), which is specific of 557

catecholaminergic cells. LoxP-flanked littermate mice without cre 558

recombinase (HIF-1αflox/flox, HIF-2αflox/flox or Td-Tomatoflox/flox) were used as 559

control group (HIF-1αWT, HIF-2αWT and Td-Tomato, respectively) for all the 560

experiments. C57BL/6J wild type mice were purchased from The Jackson 561

laboratory (Bar Harbor, Maine, US). All the experiments were performed with 562

age and sex matched control and experimental mice. 563

564

Tissue preparation, immunohistochemistry and morphometry 565

Newborn (P0) and adult mice (8-12 weeks old) were killed by an overdose of 566

sodium pentobarbital injected intraperitoneally. E18.5 embryos were collected 567

and submerged into a cold formalin solution (Sigma-Aldrich, Dorset, UK). The 568

carotid bifurcation and adrenal gland, were dissected, fixed for 2 hours with 569

4% paraformaldehyde (Santa Cruz Biotechnology) and cryopreserved (30% 570

sucrose in PBS) for cryosectioning (10 µm thick, Bright Instruments, Luton, 571



https://doi.org/10.1101/250928


24

UK). Tyrosine hydroxylase (TH), glial fibrillary acidic protein (GFAP), 572

bromodeoxyuridine (BrdU) and phospho-S6 ribosomal protein (p-S6) were 573

detected using the following polyclonal antibodies: rabbit anti-TH (1:5000, 574

Novus Biologicals, Abindong, UK; NB300-109) for single immunofluorescence 575

or chicken anti-TH (1:1000, abcam, Cambridge, UK; ab76442) for double 576

immunofluorescence, rabbit anti-GFAP (1:500, Dako, Cambridge, UK; 577

Z0334), rat anti-BrdU (1:100, abcam, ab6326), and rabbit anti-phospho-S6 578

ribosomal protein (1:200, Cell Signaling, 2211), respectively. Fluorescence-579

based detection was visualized using, Alexa-Fluor 488- and 568-conjugated 580

anti-rabbit IgG (1:500, ThermoFisher, Waltham, MA US), Alexa-Fluor 488-581

conjugated anti-chicken IgG (1:500, ThermoFisher) and Alexa-Fluor 488-582

conjudaged anti-rat IgG (1:500, ThermoFisher) secondary antibodies. 583

Chromogen-based detection was performed with Dako REAL Detection 584

Systems, Peroxidase/DAB+, Rabbit/Mouse (Dako, K5001) and counterstained 585

with Carrazzi hematoxylin. For the Td-Tomato detection, carotid bifurcation 586

and adrenal gland were dissected, embedded with OCT, flash-frozen into 587

liquid N2 and sectioned (10 µm thick, Bright Instruments). Direct Td-Tomato 588

fluorescence was imaged after nuclear counterstain with 4',6-diamidino-2-589

phenylindole (DAPI). 590

CB glomus cell counting, area measurements and pixel mean intensity were 591

calculated on micrographs (Leica DM-RB, Wetzlar, Gernany) taken from 592

sections spaced 40 µm apart across the entire CB using Fiji software 593

(Schindelin et al., 2012) as previously reported (Macias et al., 2014). CB and 594

SCG volume was estimated on the same micrographs according to Cavalieri’s 595

principle. Lung tissue was removed in the distended state by infusion into the 596



https://doi.org/10.1101/250928


25

trachea of 0.8% agarose and then fixed in 4% paraformaldehyde for paraffin 597

embedding. Lung sections (6 µm thick) were stained with H&E and EVG stain 598

to assess morphology (Merck, Darmstadt, Germany). Vessel medial thickness 599

was measured on micrographs using Fiji software. To determine the degree of 600

muscularization of small pulmonary arteries, serial lung tissue sections were 601

stained with anti-α smooth muscle actin (1:200, Sigma-Aldrich, A2547). 602

Tissue sections were independently coded and quantified by a blinded 603

investigator. 604

605

Gene deletion 606

Genomic DNA was isolated from dissected SCG and AM using DNeasy Blood 607

& Tissue Kit (Qiagen, Hilden, Germany). Relative gene deletion was assayed 608

by qPCR (One-Step Plus Real-Time PCR System; ThermoFisher Scientific) 609

using TaqMan™ Universal PCR Master Mix (ThermoFisher Scientific) and 610

PrimeTime Std qPCR Assay (IDT, Coralville, IA US). 611

For Hif-1α, 612

Hif1_probe: 5’-/56-FAM/CCTGTTGGTTGCGCAGCAAGCATT/3BHQ_1/-3’ 613

Hif1_F: 5’-GGTGCTGGTGTCCAAAATGTAG-3’ 614

Hif1_R: 5’-ATGGGTCTAGAGAGATAGCTCCACA-3’ 615

For Hif-2α, 616

Hif2_probe: 5’-/56-FAM/CCACCTGGACAAAGCCTCCATCAT/3IABkFQ/-3’ 617

Hif2_F: 5’-TCTATGAGTTGGCTCATGAGTTG-3’ 618

Hif2_R: 5’-GTCCGAAGGAAGCTGATGG-3’ 619

Relative gene deletion levels were calculated using the 2ΔΔCT method. 620

621



https://doi.org/10.1101/250928


26

Tissue preparation for amperometry and patch clamp experiments 622

Adrenal glands and SCG were quickly removed and transferred to ice-cooled 623

PBS. Dissected AM was enzymatically dispersed in two steps. First, tissue 624

was placed in 3 ml of extraction solution (in mM: 154 NaCl, 5.6 KCl, 10 625

Hepes, 11 glucose; pH 7.4) containing 425 U/ml collagenase type IA and 4-5 626

mg of bovine serum albumin (all from Sigma-Aldrich), and incubated for 30 627

min at 37°C. Tissue was mechanically dissociated every 10 minutes by 628

pipetting. Then, cell suspension was centrifuged (165 g and 15-20ºC for 4 629

min), and the pellet suspended in 3 ml of PBS containing 9550 U/ml of trypsin 630

and 425 U/ml of collagenase type IA (all from Sigma-Aldrich). Cell suspension 631

was further incubated at 37°C for 5 min and mechanically dissociated by 632

pipetting. Enzymatic reaction was stopped by adding ≈10 ml of cold complete 633

culture medium (DMEM/F-12 (21331-020 GIBCO, ThermoFisher Scientific) 634

supplemented with penicillin (100 U/ml)/streptomycin (10 µg/ml), 2 mM L-635

glutamine and 10% fetal bovine serum. The suspension was centrifuged (165 636

g and 15-20ºC for 4 min), the pellet gently suspended in 200 µl of complete 637

culture medium. Next, cells were plated on small coverslips coated with 1 638

mg/ml poly-L-lysine and kept at 37ºC in a 5% CO2 incubator for settlement. 639

Afterwards, the petri dish was carefully filled with 2 ml of culture medium and 640

returned to the incubator for 2 hours. Under these conditions, cells could be 641

maintained up to 12-14 hours to perform experiments. 642

To obtain SCG dispersed cells, the tissue was placed in a 1.5 ml tube 643

containing enzymatic solution (2.5 mg/ml collagenase type IA in PBS) and 644

incubated for 15 min in a thermoblock at 37°C and 300 rpm. The suspension 645

was mechanically dissociated by pipetting and centrifuged for 3 min at 200 g. 646



https://doi.org/10.1101/250928


27

The pellet was suspended in the second enzymatic dispersion (1mg/ml of 647

trypsin in PBS), incubated at 37°C, 300 rpm for 25 min and dissociated again 648

with a pipette. Enzymatic reaction was stopped adding a similar solution than 649

used for chromaffin cells (changing fetal bovine serum for newborn calf 650

serum). Finally, dispersed SCG cells were plated onto poly-L-lysine coated 651

coverslips and kept at the 37ºC incubator. Experiments with SCG cells were 652

done between 24-48h after finishing the culture. 653

654

To prepare AM slices, the capsule and adrenal gland cortex was removed and 655

the AM was embedded into low melting point agarose at when reached 47 ºC. 656

The agarose block is sectioned (200 µm thick) in an O2-saturated Tyrode's 657

solution using a vibratome (VT1000S, Leica). AM slices were washed twice 658

with the recording solution (in mM: 117 NaCl, 4.5 KCl, 23 NaHCO3, 1 MgCl2, 1 659

CaCl2, 5 glucose and 5 sucrose) and bubbled with carbogen (5% CO2 and 660

95% O2) at 37 ºC for 30 min in a water bath. Fresh slices are used for the 661

experiments during 4-5h after preparation. 662

663

Patch-clamp recordings 664

The macroscopic currents were recorded from dispersed mouse AM and SCG 665

cells using the whole cell configurations of the patch clamp technique. 666

Micropipettes (≈3 MΩ) were pulled from capillary glass tubes (Kimax, Kimble 667

Products, Rockwood, TN US) with a horizontal pipette puller (Sutter 668

instruments model P-1000, Novato, CA US) and fire polished with a 669

microforge MF-830 (Narishige, Amityville, NY US). Voltage-clamp recordings 670

were obtained with an EPC-7 amplifier (HEKA Electronik, Lambrecht/Pfalz, 671



https://doi.org/10.1101/250928


28

Germany). The signal was filtered (3 kHz), subsequently digitized with an 672

analog/digital converter (ITC-16 Instrutech Corporation, HEKA Electronik) and 673

finally sent to the computer. Data acquisition and storage was done using the 674

Pulse/pulsefit software (Heka Electronik) at a sampling interval of 10 µsec. 675

Data analysis is performed with the Igor Pro Carbon (Wavemetrics, Portland, 676

OR US) and Pulse/pulsefit (HEKA Electronik) programs. All experiments were 677

conducted at 30-33°C. Macroscopic Ca2+, Na+, and K+ currents were recorded 678

in dialyzed cells. The solutions used for the recording of Na+ and Ca2+ 679

currents contained (in mM): external: 140 NaCl, 10 BaCl2, 2.5 KCl, 10 680

HEPES, and 10 glucose; pH 7.4 and osmolality 300 mOsm/kg; and internal: 681

110 CsCl, 30 CsF, 10 EGTA, 10 HEPES, and 4 ATP-Mg; pH 7.2 and 682

osmolality 285 mOsm/kg. The external solution used for the recording of 683

whole cell K+ currents was (in mM): 117 NaCl, 4.5 KCl, 23 NaHCO3, 1 MgCl2, 684

2.5 CaCl2, 5 glucose and 5 sucrose. The internal solution to record K+ 685

currents was (in mM): 80 potassium glutamate, 50 KCl, 1 MgCl2, 10 HEPES, 686

4 MgATP, and 5 EGTA, pH 7.2. Depolarizing steps of variable duration 687

(normally 10 or 50 msec) from a holding potential of -70 mV to different 688

voltages ranging from -60 up to +50 mV (with voltage increments of 10 mV) 689

were used to record macroscopic ionic currents in AM and SCG cells. 690

691

Amperometric recording 692

To perform the experiments, single slices were transferred to the chamber 693

placed on the stage of an upright microscope (Axioscope, Zeiss, Oberkochen, 694

Germany) and continuously perfused by gravity (flow 1–2 ml min-1) with a 695

solution containing (in mM): 117 NaCl, 4.5 KCl, 23 NaHCO3, 1 MgCl2, 2.5 696



https://doi.org/10.1101/250928


29

CaCl2, 5 glucose and 5 sucrose. The ‘normoxic’ solution was bubbled with 5% 697

CO2, 20% O2 and 75 % N2 (PO2 ≈ 150 mmHg). The ‘hypoxic’ solution was 698

bubbled with 5% CO2 and 95% N2 (PO2 ≈ 10–20 mmHg). The ‘hypercapnic’ 699

solution was bubbled with 20% CO2, 20% O2 and 60 % N2 (PO2 ≈ 150 700

mmHg). The osmolality of solutions was ≈ 300 mosmol kg−1 and pH = 7.4. In 701

the 20 mM K+ solution, NaCl was replaced by KCl equimolarly (20 mM). All 702

experiments were carried out at a chamber temperature of 36°C. 703

Amperometric currents were recorded with an EPC-8 patch-clamp amplifier 704

(HEKA Electronics), filtered at 100 Hz and digitized at 250 Hz for storage in a 705

computer. Data acquisition and analysis were carried out with an ITC-16 706

interface and PULSE/PULSEFIT software (HEKA Electronics). The secretion 707

rate (fC min−1) was calculated as the amount of charge transferred to the 708

recording electrode during a given period of time. 709

710

Catecholamine measurements 711

Catecholamine levels were determined by ELISA (Abnova, Taipei, Taiwan) 712

following manufacture’s instructions. Spontaneous urination was collected 713

from control and experimental mice (8-12 weeks old) at similar daytime 714

(9:00am). HIF-2αWT and TH-HIF-2αKO or HIF-1αWT, TH-HIF-1αKO samples 715

were collected and assayed in different days. 716

717

Tunel assay 718

Cell death was determined on CB sections using Click-iT™ TUNEL Alexa 719

Fluor™ 488 Imaging Assay (ThermoFisher Scientific), following manufacture’s 720



https://doi.org/10.1101/250928


30

indications. TUNEL+ cells across the whole CB parenchyma were counted 721

and normalized by area. 722

723

Plethysmography 724

Respiratory parameters were measured by unrestrained whole-body 725

plethysmography (Data Sciences International, St. Paul, MN US). Mice were 726

maintained in a hermetic chamber with controlled normoxic airflow (1.1 l/min) 727

of 21% O2 (N2 balanced, 5000ppm CO2, BOC Healthcare, Manchester, UK) 728

until they were calm (30-40 minutes). Mice were then exposed to pre-mixed 729

hypoxic air (1.1 l/min) of 10% O2 (N2 balanced, 5000ppm CO2, BOC 730

Healthcare) for 30 min (time-course experiments) or 10 min (VAH 731

experiments). Real-time data were recorded and analyzed using Ponemah 732

software (Data Sciences International). Each mouse was monitored 733

throughout the experiment and periods of movements and/or grooming were 734

noted and subsequently removed from the analysis. The transition periods 735

between normoxia and hypoxia (2-3 min) were also removed from the 736

analysis. 737

738

Oxygen saturations 739

Oxygen saturations were measured using MouseOx Pulse Oximeter (Starr 740

Life Sciences Corp,Oakmont, PA US) on anaesthetised (isofluorane) mice. 741

Anaesthetic was vaporized with 2 l/min of 100% O2 gas flow (BOC 742

Healthcare) and then shift to 2 l/min of pre-mixed 10% O2 flow (N2 balanced, 743

5000ppm CO2, BOC Healthcare) for 5 min. Subsequently, gas flow was 744

switched back to 100% O2. 745



https://doi.org/10.1101/250928


31

746

Whole-body metabolic assessments 747

Energy expenditure was measured and recorded using the Columbus 748

Instruments Oxymax system (Columbus, OH US) according to the 749

manufacturer’s instructions. Mice were randomly allocated to the chambers 750

and they had free access to food and water throughout the experiment with 751

the exception of fasting experiments. An initial 18-24h acclimation period was 752

disregarded for all the experiments. Once mice were acclimated to the 753

chamber, the composition of the influx gas was switched from 21% O2 to 10% 754

O2 using a PEGAS mixer (Columbus Instruments). For maximum exertion 755

testing, mice were allowed to acclimatize to the enclosed treadmill 756

environment for 15 min before running. The treadmill was initiated at 5 757

meters/min and the mice warmed up for 5 minutes. The speed was increased 758

up to 27 meters/min or exhaustion at 2.5 min intervals on a 15° incline. 759

Exhaustion was defined as the third time the mouse refused to run for more 760

than 3-5 seconds or when was unable to stay on the treadmill. Blood glucose 761

and lactate levels were measured before and after exertion using a StatStrip 762

Xpress (nova biomedical, Street-Waltham, MA US) glucose and lactate 763

meters. 764

765

Chronic hypoxia exposure and in vivo CB proliferation 766

Mice were exposed to a normobaric 10% O2 atmosphere in an enclosed 767

chamber with controlled O2 and CO2 levels for up to 21 days. Humidity and 768

CO2 levels were quenched throughout the experiments by using silica gel 769

(Sigma-Aldrich) and spherasorb soda lime (Intersurgical, Wokingham, UK), 770



https://doi.org/10.1101/250928


32

respectively. Haematocrit was measured in a bench-top haematocrit 771

centrifuge. Haemoglobin levels were analyzed with a Vet abc analyzer 772

(Horiba, Kyoto, Japan) according to the manufacture’s instructions. Heart, 773

spleen tissues were removed and their wet weights measured. Right 774

ventricular systolic pressures were assessed using a pressure-volume loop 775

system (Millar, Houston, TX US) as reported before (Cowburn et al., 2016). 776

Mice were anaesthetized (isoflurane) and right-sided heart catheterization 777

was performed through the right jugular vein. Lungs were processed for 778

histology as describe above. Analogous procedures were followed for mice 779

maintained in normoxia. 780

For hypoxia-induced in vivo CB proliferation studies, mice were injected 781

intraperitoneally once a week with 50 mg/kg of BrdU (Sigma-Aldrich) and 782

constantly supplied in their drinking water (1mg/ml) as previously shown 783

(Pardal et al., 2007). In vivo mTORC inhibition was achieved by 784

intraperitoneal injection of rapamycin (6 mg kg-1 day-1). Tissues were collected 785

for histology after 14 days at 10% O2 as described above. VAH was recorded 786

in vehicle control and rapamycin-injected C57BL/6J mice after 7 days in 787

chronic hypoxia by plethysmography as explained above. 788

789

Blood pressure measurement by radio-telemetry 790

All radio-telemetry hardware and software was purchased from Data Science 791

International. Surgical implantation of radio-telemetry device was performed 792

following University of Cambridge Animal Welfare and Ethical Review Body’s 793

(AWERB) recommendations and according to manufacturer’s instructions. 794

After surgery, mice were allowed to recover for at least 10 days. All baseline 795



https://doi.org/10.1101/250928


33

telemetry data were collected over a 72h period in a designated quiet room to 796

ensure accurate and repeatable results. Blood pressure monitoring during 797

hypoxia challenge was conducted in combination with Columbus Instruments 798

Oxymax system and PEGAS mixer. Mice were placed in metabolic chambers 799

and allowed to acclimate for 24h before the oxygen content of the flow gas 800

was reduced to 10%. Mice were kept for 48h at 10% O2 before being returned 801

to normal atmospheric oxygen for a further 24h. For hypertension studies, 802

mice were subsequently implanted with a micro osmotic pump (Alzet, 803

Cupertino, CA; 1002 model) for Ang II (Sigma-Aldrich) infusion (490 ng min-1 804

kg-1) for 2 weeks. Blood pressure, heart rate, temperature and activity were 805

monitored for a 48h period after 7, 14 and 21 days after osmotic pump 806

implantation. 807

808

Glucose, insulin and lactate tolerant tests 809

All the blood glucose and lactate measurements were carried out with a 810

StatStrip Xpress (nova biomedical) glucose and lactate meters. Blood was 811

sampled from the tail vein. For glucose tolerance test (GTT), mice were 812

placed in clean cages and fasted for 14-15 hours (overnight) with free access 813

to water. Baseline glucose level (0 time point) was measured and then a 814

glucose bolus (Sigma-Aldrich) of 2 g/kg in PBS was intraperitoneally injected. 815

Glucose was monitored after 15, 30, 60, 90, 120 and 150 minutes. For insulin 816

tolerance test, mice were fasted for 4 hours and baseline glucose was 817

measured (0 time point). Next, insulin (Roche, Penzberg, Germany) was 818

intraperitoneally injected (0.75 U/kg) and blood glucose content recorded after 819

15, 30, 60, 90 and 120 minutes. For lactate tolerance test, mice were injected 820



https://doi.org/10.1101/250928


34

with a bolus of 2 g/kg of sodium lactate (Sigma-Aldrich) in PBS and blood 821

lactate measured after 15, 30, 60, 90 and 120 minutes. 822

823

Statistical analysis 824

Particular statistic tests and sample size can be found in the figures and figure 825

legends. Data are presented as the mean ± standard error of the mean (SEM). 826

Shapiro-Wilk normality test was used to determine Gaussian data distribution. 827

Statistical significance between two groups was assessed by un-paired t-test in 828

cases of normal distribution with a Welch’s correction if standard deviations 829

were different. In cases of non-normal distribution (or low sample size for 830

normality test) the non-parametric Mann-Whitney U test was used. For multiple 831

comparisons we used two-way ANOVA followed by Fisher’s LSD test. Non-832

linear regression (one-phase association) curve fitting, using a least squares 833

method, was used to model the time course data in Figs. 3, 5 and 834

Supplemental Fig. S6. Extra sum-of-squares F test was used to compare 835

fittings, and determine whether the data were best represented by a single 836

curve, or by separate ones. Individual area under the curve (AUC) was 837

calculated for the circadian time-courses in Figs. 3, 5; Supplemental Figs. S6, 838

S7, followed by un-paired t-test or non-parametric Mann-Whitney U test as 839

explained above. Statistical significance was considered if p ≤ 0.05. Analysis 840

was carried out using Prism6.0f (GraphPad software, La Jolla, CA US) for Mac 841

OS X. 842

843

Ackowledgements 844

This work is funded by the Wellcome Trust (grant WT092738MA). 845



https://doi.org/10.1101/250928


35

846

Competing interests: 847

No competing interest declared. 848

849

850

Author Contributions 851

Conceptualization, D.M. and R.S.J.; Investigation, D.M., A.C., H.T.T., and 852

P.O.S.; Writing-Original Draft, D.M. and R.S.J.; Writing-Review & Editing, 853

D.M., A.C., H.T.T., P.O.S., J.L.B., and R.S.J.; Supervision, D.M., J.L.B. and 854

R.S.J.; Funding Acquisition, R.S.J. 855

856

857



https://doi.org/10.1101/250928


36

References 858

Annese, V., Navarro-Guerrero, E., Rodriguez-Prieto, I., & Pardal, R. (2017). 859Physiological Plasticity of Neural-Crest-Derived Stem Cells in the Adult 860Mammalian Carotid Body. Cell Rep, 19(3), 471-478. doi: 86110.1016/j.celrep.2017.03.065 862

Arias-Stella, J., & Valcarcel, J. (1976). Chief cell hyperplasia in the human 863carotid body at high altitudes; physiologic and pathologic significance. 864Hum Pathol, 7(4), 361-373. 865

Brugarolas, J., Lei, K., Hurley, R. L., Manning, B. D., Reiling, J. H., Hafen, E., 866. . . Kaelin, W. G., Jr. (2004). Regulation of mTOR function in response 867to hypoxia by REDD1 and the TSC1/TSC2 tumor suppressor complex. 868Genes Dev, 18(23), 2893-2904. doi: 10.1101/gad.1256804 869

Brusselmans, K., Compernolle, V., Tjwa, M., Wiesener, M. S., Maxwell, P. H., 870Collen, D., & Carmeliet, P. (2003). Heterozygous deficiency of hypoxia-871inducible factor-2alpha protects mice against pulmonary hypertension 872and right ventricular dysfunction during prolonged hypoxia. J Clin 873Invest, 111(10), 1519-1527. doi: 10.1172/JCI15496 874

Bryant, A. J., Carrick, R. P., McConaha, M. E., Jones, B. R., Shay, S. D., 875Moore, C. S., . . . Lawson, W. E. (2016). Endothelial HIF signaling 876regulates pulmonary fibrosis-associated pulmonary hypertension. Am J 877Physiol Lung Cell Mol Physiol, 310(3), L249-262. doi: 87810.1152/ajplung.00258.2015 879

Carmeliet, P., Dor, Y., Herbert, J. M., Fukumura, D., Brusselmans, K., 880Dewerchin, M., . . . Keshert, E. (1998). Role of HIF-1alpha in hypoxia-881mediated apoptosis, cell proliferation and tumour angiogenesis. Nature, 882394(6692), 485-490. doi: 10.1038/28867 883

Compernolle, V., Brusselmans, K., Acker, T., Hoet, P., Tjwa, M., Beck, H., . . . 884Carmeliet, P. (2002). Loss of HIF-2alpha and inhibition of VEGF impair 885fetal lung maturation, whereas treatment with VEGF prevents fatal 886respiratory distress in premature mice. Nat Med, 8(7), 702-710. doi: 88710.1038/nm721 888

Cowburn, A. S., Crosby, A., Macias, D., Branco, C., Colaco, R. D., 889Southwood, M., . . . Johnson, R. S. (2016). HIF2alpha-arginase axis is 890essential for the development of pulmonary hypertension. Proc Natl 891Acad Sci U S A, 113(31), 8801-8806. doi: 10.1073/pnas.1602978113 892

Cowburn, A. S., Macias, D., Summers, C., Chilvers, E. R., & Johnson, R. S. 893(2017). Cardiovascular adaptation to hypoxia and the role of peripheral 894resistance. Elife, 6. doi: 10.7554/eLife.28755 895



https://doi.org/10.1101/250928


37

Du, J., Tong, A., Wang, F., Cui, Y., Li, C., Zhang, Y., & Yan, Z. (2016). The 896Roles of PI3K/AKT/mTOR and MAPK/ERK Signaling Pathways in 897Human Pheochromocytomas. Int J Endocrinol, 2016, 5286972. doi: 89810.1155/2016/5286972 899

Elorza, A., Soro-Arnaiz, I., Melendez-Rodriguez, F., Rodriguez-Vaello, V., 900Marsboom, G., de Carcer, G., . . . Aragones, J. (2012). HIF2alpha acts 901as an mTORC1 activator through the amino acid carrier SLC7A5. Mol 902Cell, 48(5), 681-691. doi: 10.1016/j.molcel.2012.09.017 903

Favier, J., Amar, L., & Gimenez-Roqueplo, A. P. (2015). Paraganglioma and 904phaeochromocytoma: from genetics to personalized medicine. Nat Rev 905Endocrinol, 11(2), 101-111. doi: 10.1038/nrendo.2014.188 906

Gao, L., Bonilla-Henao, V., Garcia-Flores, P., Arias-Mayenco, I., Ortega-907Saenz, P., & Lopez-Barneo, J. (2017). Gene expression analyses 908reveal metabolic specifications in acute O2 -sensing chemoreceptor 909cells. J Physiol, 595(18), 6091-6120. doi: 10.1113/JP274684 910

Goda, N., Ryan, H. E., Khadivi, B., McNulty, W., Rickert, R. C., & Johnson, R. 911S. (2003). Hypoxia-inducible factor 1alpha is essential for cell cycle 912arrest during hypoxia. Mol Cell Biol, 23(1), 359-369. 913

Gruber, M., Hu, C. J., Johnson, R. S., Brown, E. J., Keith, B., & Simon, M. C. 914(2007). Acute postnatal ablation of Hif-2alpha results in anemia. Proc 915Natl Acad Sci U S A, 104(7), 2301-2306. doi: 91610.1073/pnas.0608382104 917

Heath, D., & Edwards, C. (1971). The carotid body in cardiopulmonary 918disease. Geriatrics, 26(12), 110-111 passim. 919

Heath, D., Smith, P., & Jago, R. (1982). Hyperplasia of the carotid body. J 920Pathol, 138(2), 115-127. doi: 10.1002/path.1711380203 921

Hodson, E. J., Nicholls, L. G., Turner, P. J., Llyr, R., Fielding, J. W., Douglas, 922G., . . . Bishop, T. (2016). Regulation of ventilatory sensitivity and 923carotid body proliferation in hypoxia by the PHD2/HIF-2 pathway. J 924Physiol, 594(5), 1179-1195. doi: 10.1113/JP271050 925

Hubbi, M. E., & Semenza, G. L. (2015). Regulation of cell proliferation by 926hypoxia-inducible factors. Am J Physiol Cell Physiol, 309(12), C775-927782. doi: 10.1152/ajpcell.00279.2015 928

Iturriaga, R., Del Rio, R., Idiaquez, J., & Somers, V. K. (2016). Carotid body 929chemoreceptors, sympathetic neural activation, and cardiometabolic 930disease. Biol Res, 49, 13. doi: 10.1186/s40659-016-0073-8 931



https://doi.org/10.1101/250928


38

Iyer, N. V., Kotch, L. E., Agani, F., Leung, S. W., Laughner, E., Wenger, R. H., 932. . . Semenza, G. L. (1998). Cellular and developmental control of O2 933homeostasis by hypoxia-inducible factor 1 alpha. Genes Dev, 12(2), 934149-162. 935

Kameda, Y. (2005). Mash1 is required for glomus cell formation in the mouse 936carotid body. Dev Biol, 283(1), 128-139. doi: 93710.1016/j.ydbio.2005.04.004 938

Kameda, Y., Ito, M., Nishimaki, T., & Gotoh, N. (2008). FRS2 alpha 2F/2F 939mice lack carotid body and exhibit abnormalities of the superior cervical 940sympathetic ganglion and carotid sinus nerve. Dev Biol, 314(1), 236-941247. doi: 10.1016/j.ydbio.2007.12.002 942

Kapitsinou, P. P., Rajendran, G., Astleford, L., Michael, M., Schonfeld, M. P., 943Fields, T., . . . Haase, V. H. (2016). The Endothelial Prolyl-4-944Hydroxylase Domain 2/Hypoxia-Inducible Factor 2 Axis Regulates 945Pulmonary Artery Pressure in Mice. Mol Cell Biol, 36(10), 1584-1594. 946doi: 10.1128/MCB.01055-15 947

Kline, D. D., Peng, Y. J., Manalo, D. J., Semenza, G. L., & Prabhakar, N. R. 948(2002). Defective carotid body function and impaired ventilatory 949responses to chronic hypoxia in mice partially deficient for hypoxia-950inducible factor 1 alpha. Proc Natl Acad Sci U S A, 99(2), 821-826. doi: 95110.1073/pnas.022634199 952

Koshiji, M., Kageyama, Y., Pete, E. A., Horikawa, I., Barrett, J. C., & Huang, 953L. E. (2004). HIF-1alpha induces cell cycle arrest by functionally 954counteracting Myc. EMBO J, 23(9), 1949-1956. doi: 95510.1038/sj.emboj.7600196 956

Laplante, M., & Sabatini, D. M. (2012). mTOR signaling in growth control and 957disease. Cell, 149(2), 274-293. doi: 10.1016/j.cell.2012.03.017 958

Le Douarin, N. M. (1986). Cell line segregation during peripheral nervous 959system ontogeny. Science, 231(4745), 1515-1522. 960

Lindeberg, J., Usoskin, D., Bengtsson, H., Gustafsson, A., Kylberg, A., 961Soderstrom, S., & Ebendal, T. (2004). Transgenic expression of Cre 962recombinase from the tyrosine hydroxylase locus. Genesis, 40(2), 67-96373. doi: 10.1002/gene.20065 964

Liu, L., Cash, T. P., Jones, R. G., Keith, B., Thompson, C. B., & Simon, M. C. 965(2006). Hypoxia-induced energy stress regulates mRNA translation 966and cell growth. Mol Cell, 21(4), 521-531. doi: 96710.1016/j.molcel.2006.01.010 968



https://doi.org/10.1101/250928


39

Lopez-Barneo, J., Macias, D., Platero-Luengo, A., Ortega-Saenz, P., & 969Pardal, R. (2016). Carotid body oxygen sensing and adaptation to 970hypoxia. Pflugers Arch, 468(1), 59-70. doi: 10.1007/s00424-015-1734-9710 972

Lopez-Barneo, J., Ortega-Saenz, P., Gonzalez-Rodriguez, P., Fernandez-973Aguera, M. C., Macias, D., Pardal, R., & Gao, L. (2016). Oxygen-974sensing by arterial chemoreceptors: Mechanisms and medical 975translation. Mol Aspects Med, 47-48, 90-108. doi: 97610.1016/j.mam.2015.12.002 977

Lorenzo, F. R., Yang, C., Ng Tang Fui, M., Vankayalapati, H., Zhuang, Z., 978Huynh, T., . . . Prchal, J. T. (2013). A novel EPAS1/HIF2A germline 979mutation in a congenital polycythemia with paraganglioma. J Mol Med 980(Berl), 91(4), 507-512. doi: 10.1007/s00109-012-0967-z 981

Ma, X. M., & Blenis, J. (2009). Molecular mechanisms of mTOR-mediated 982translational control. Nat Rev Mol Cell Biol, 10(5), 307-318. doi: 98310.1038/nrm2672 984

Macias, D., Fernandez-Aguera, M. C., Bonilla-Henao, V., & Lopez-Barneo, J. 985(2014). Deletion of the von Hippel-Lindau gene causes 986sympathoadrenal cell death and impairs chemoreceptor-mediated 987adaptation to hypoxia. EMBO Mol Med, 6(12), 1577-1592. doi: 98810.15252/emmm.201404153 989

Madden, J. A., Vadula, M. S., & Kurup, V. P. (1992). Effects of hypoxia and 990other vasoactive agents on pulmonary and cerebral artery smooth 991muscle cells. Am J Physiol, 263(3 Pt 1), L384-393. 992

Madisen, L., Zwingman, T. A., Sunkin, S. M., Oh, S. W., Zariwala, H. A., Gu, 993H., . . . Zeng, H. (2010). A robust and high-throughput Cre reporting 994and characterization system for the whole mouse brain. Nat Neurosci, 99513(1), 133-140. doi: 10.1038/nn.2467 996

McBryde, F. D., Abdala, A. P., Hendy, E. B., Pijacka, W., Marvar, P., Moraes, 997D. J., . . . Paton, J. F. (2013). The carotid body as a putative 998therapeutic target for the treatment of neurogenic hypertension. Nat 999Commun, 4, 2395. doi: 10.1038/ncomms3395 1000

Ortega-Saenz, P., Pascual, A., Piruat, J. I., & Lopez-Barneo, J. (2007). 1001Mechanisms of acute oxygen sensing by the carotid body: lessons 1002from genetically modified animals. Respir Physiol Neurobiol, 157(1), 1003140-147. doi: 10.1016/j.resp.2007.02.009 1004



https://doi.org/10.1101/250928


40

Pardal, R., Ortega-Saenz, P., Duran, R., & Lopez-Barneo, J. (2007). Glia-like 1005stem cells sustain physiologic neurogenesis in the adult mammalian 1006carotid body. Cell, 131(2), 364-377. doi: 10.1016/j.cell.2007.07.043 1007

Pearse, A. G., Polak, J. M., Rost, F. W., Fontaine, J., Le Lievre, C., & Le 1008Douarin, N. (1973). Demonstration of the neural crest origin of type I 1009(APUD) cells in the avian carotid body, using a cytochemical marker 1010system. Histochemie, 34(3), 191-203. 1011

Peng, J., Zhang, L., Drysdale, L., & Fong, G. H. (2000). The transcription 1012factor EPAS-1/hypoxia-inducible factor 2alpha plays an important role 1013in vascular remodeling. Proc Natl Acad Sci U S A, 97(15), 8386-8391. 1014doi: 10.1073/pnas.140087397 1015

Peng, Y. J., Nanduri, J., Khan, S. A., Yuan, G., Wang, N., Kinsman, B., . . . 1016Prabhakar, N. R. (2011). Hypoxia-inducible factor 2alpha (HIF-2alpha) 1017heterozygous-null mice exhibit exaggerated carotid body sensitivity to 1018hypoxia, breathing instability, and hypertension. Proc Natl Acad Sci U 1019S A, 108(7), 3065-3070. doi: 10.1073/pnas.1100064108 1020

Peng, Y. J., Yuan, G., Ramakrishnan, D., Sharma, S. D., Bosch-Marce, M., 1021Kumar, G. K., . . . Prabhakar, N. R. (2006). Heterozygous HIF-1alpha 1022deficiency impairs carotid body-mediated systemic responses and 1023reactive oxygen species generation in mice exposed to intermittent 1024hypoxia. J Physiol, 577(Pt 2), 705-716. doi: 102510.1113/jphysiol.2006.114033 1026

Pijacka, W., Moraes, D. J., Ratcliffe, L. E., Nightingale, A. K., Hart, E. C., da 1027Silva, M. P., . . . Paton, J. F. (2016). Purinergic receptors in the carotid 1028body as a new drug target for controlling hypertension. Nat Med, 102922(10), 1151-1159. doi: 10.1038/nm.4173 1030

Platero-Luengo, A., Gonzalez-Granero, S., Duran, R., Diaz-Castro, B., Piruat, 1031J. I., Garcia-Verdugo, J. M., . . . Lopez-Barneo, J. (2014). An O2-1032sensitive glomus cell-stem cell synapse induces carotid body growth in 1033chronic hypoxia. Cell, 156(1-2), 291-303. doi: 103410.1016/j.cell.2013.12.013 1035

Ryan, H. E., Lo, J., & Johnson, R. S. (1998). HIF-1 alpha is required for solid 1036tumor formation and embryonic vascularization. EMBO J, 17(11), 3005-10373015. doi: 10.1093/emboj/17.11.3005 1038

Saldana, M. J., Salem, L. E., & Travezan, R. (1973). High altitude hypoxia and 1039chemodectomas. Hum Pathol, 4(2), 251-263. 1040

Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., 1041Pietzsch, T., . . . Cardona, A. (2012). Fiji: an open-source platform for 1042



https://doi.org/10.1101/250928


41

biological-image analysis. Nat Methods, 9(7), 676-682. doi: 104310.1038/nmeth.2019 1044

Schnell, P. O., Ignacak, M. L., Bauer, A. L., Striet, J. B., Paulding, W. R., & 1045Czyzyk-Krzeska, M. F. (2003). Regulation of tyrosine hydroxylase 1046promoter activity by the von Hippel-Lindau tumor suppressor protein 1047and hypoxia-inducible transcription factors. J Neurochem, 85(2), 483-1048491. 1049

Scortegagna, M., Ding, K., Oktay, Y., Gaur, A., Thurmond, F., Yan, L. J., . . . 1050Garcia, J. A. (2003). Multiple organ pathology, metabolic abnormalities 1051and impaired homeostasis of reactive oxygen species in Epas1-/- mice. 1052Nat Genet, 35(4), 331-340. doi: 10.1038/ng1266 1053

Slingo, M. E., Turner, P. J., Christian, H. C., Buckler, K. J., & Robbins, P. A. 1054(2014). The von Hippel-Lindau Chuvash mutation in mice causes 1055carotid-body hyperplasia and enhanced ventilatory sensitivity to 1056hypoxia. J Appl Physiol (1985), 116(7), 885-892. doi: 105710.1152/japplphysiol.00530.2013 1058

Stenmark, K. R., Meyrick, B., Galie, N., Mooi, W. J., & McMurtry, I. F. (2009). 1059Animal models of pulmonary arterial hypertension: the hope for 1060etiological discovery and pharmacological cure. Am J Physiol Lung Cell 1061Mol Physiol, 297(6), L1013-1032. doi: 10.1152/ajplung.00217.2009 1062

Tan, Q., Kerestes, H., Percy, M. J., Pietrofesa, R., Chen, L., Khurana, T. S., . . 1063. Lee, F. S. (2013). Erythrocytosis and pulmonary hypertension in a 1064mouse model of human HIF2A gain of function mutation. J Biol Chem, 1065288(24), 17134-17144. doi: 10.1074/jbc.M112.444059 1066

Teppema, L. J., & Dahan, A. (2010). The ventilatory response to hypoxia in 1067mammals: mechanisms, measurement, and analysis. Physiol Rev, 106890(2), 675-754. doi: 10.1152/physrev.00012.2009 1069

Tian, H., Hammer, R. E., Matsumoto, A. M., Russell, D. W., & McKnight, S. L. 1070(1998). The hypoxia-responsive transcription factor EPAS1 is essential 1071for catecholamine homeostasis and protection against heart failure 1072during embryonic development. Genes Dev, 12(21), 3320-3324. 1073

Torres-Capelli, M., Marsboom, G., Li, Q. O., Tello, D., Rodriguez, F. M., 1074Alonso, T., . . . Aragones, J. (2016). Role Of Hif2alpha Oxygen Sensing 1075Pathway In Bronchial Epithelial Club Cell Proliferation. Sci Rep, 6, 107625357. doi: 10.1038/srep25357 1077

Wang, Z. Y., & Bisgard, G. E. (2002). Chronic hypoxia-induced morphological 1078and neurochemical changes in the carotid body. Microsc Res Tech, 107959(3), 168-177. doi: 10.1002/jemt.10191 1080



https://doi.org/10.1101/250928


42

Zhou, T., Chien, M. S., Kaleem, S., & Matsunami, H. (2016). Single cell 1081transcriptome analysis of mouse carotid body glomus cells. J Physiol, 1082594(15), 4225-4251. doi: 10.1113/JP271936 1083

Zhuang, Z., Yang, C., Lorenzo, F., Merino, M., Fojo, T., Kebebew, E., . . . 1084Pacak, K. (2012). Somatic HIF2A gain-of-function mutations in 1085paraganglioma with polycythemia. N Engl J Med, 367(10), 922-930. 1086doi: 10.1056/NEJMoa1205119 1087

1088

1089

1090

1091

1092

1093

1094

1095

1096

1097

1098

1099

1100

1101

1102

1103

1104

1105

1106

1107

1108



https://doi.org/10.1101/250928


43

Figures 1109

Macias_Figure 1 1110

1111

1112



https://doi.org/10.1101/250928


44

Macias_Fig1-figure supplement 1 1113

1114



https://doi.org/10.1101/250928


45


1116

1117

1118

1119

1120

1121

1122

1123

1124



https://doi.org/10.1101/250928


46


1126

1127

1128

1129

1130

1131

1132

1133

1134

1135

1136

1137

1138



https://doi.org/10.1101/250928


47

Macias_Figure 3-figure supplement 1 1139

1140

1141

1142

1143

1144

1145

1146

1147

1148

1149

1150

1151



https://doi.org/10.1101/250928


48


1153

1154

1155

1156



https://doi.org/10.1101/250928


49


1158

1159

1160

1161

1162

1163

1164

1165

1166

1167

1168



https://doi.org/10.1101/250928


50


1170



https://doi.org/10.1101/250928


51


1172

1173

1174

1175

1176

1177

1178

1179

1180

1181

1182

1183

1184

1185

1186



https://doi.org/10.1101/250928


52


1188

1189

1190

1191



https://doi.org/10.1101/250928


53


1193

1194

1195



https://doi.org/10.1101/250928


54


1197

1198

1199

1200

1201

1202

1203

1204

1205

1206

1207

1208

1209

1210



https://doi.org/10.1101/250928


55


1212

1213

1214

1215

1216

1217

1218

1219

1220

1221

1222

1223

1224

1225



https://doi.org/10.1101/250928


56


1227

1228

1229

1230

1231



https://doi.org/10.1101/250928


57


1233

1234

1235

1236

1237

1238

1239

1240

1241

1242



https://doi.org/10.1101/250928


58

Figure Legends 1243

Figure 1. Selective loss of carotid body glomus cells in sympathoadrenal-1244

specific Hif-2α, but not Hif-1α, deficient mice. (A and B) Tyrosine hydroxylase 1245

(TH) immunostaining on carotid bifurcation sections from HIF-2αWT (A, top 1246

panels), TH-HIF-2αKO (A, bottom panels), HIF-1αWT (B, top panels) and TH-1247

HIF-1αKO (B, bottom panels) mice. Micrographs showed in A (bottom) were 1248

selected to illustrate the rare presence of TH+ glomus cells in TH-HIF-2αKO 1249

mice (white arrowheads). Dashed rectangles (left panels) are shown at higher 1250

magnification on the right panels. SCG, superior cervical ganglion; CB, carotid 1251

body; ICA, internal carotid artery; ECA, external carotid artery. Scale bars: 1252

200 µm (left panels), 50 µm (right panels). (C-F) Quantification of total SCG 1253

volume (C), total CB volume (D), TH+ cell number (E) and TH+ cell density (F) 1254

on micrograph from HIF-2αWT (black dots, n = 4 for SCG and n = 6 for CB), 1255

TH-HIF-2αKO (red squares, n = 4), HIF-1αWT (black triangles, n = 4) and TH-1256

HIF-1αKO (blue triangles, n = 3) mice. Data are expressed as mean ± SEM. 1257

Mann-Whitney test, **p < 0.001; ns, non-significant. (G and H) TH-1258

immunostained adrenal gland sections from HIF-2αWT (G, top panel), TH-HIF-1259

2αKO (G, bottom panel), HIF-1αWT (H, top panel) and TH-HIF-1αKO (H, bottom 1260

panel) littermates. AM, adrenal medulla. Scale bars: 200 µm. (I) Normalized 1261

adrenaline (left) and noradrenaline (right) urine content measured by ELISA. 1262

HIF-2αWT (black dots, n = 8), TH-HIF-2αKO (red squares, n = 7), HIF-1αWT 1263

(black triangles, n = 7) and TH-HIF-1αKO (blue triangles, n = 4). Mann-Whitney 1264

test, ns, non-significant. 1265

1266



https://doi.org/10.1101/250928


59

Figure 1-figure supplement 1. Sympathoadrenal gene deletion by TH-IRES-1267

Cre mouse strain. (A) TH-Cre-mediated recombination in carotid bifurcation 1268

(left panels) and adrenal gland (right panels) sections dissected from the TH-1269

Td-tomato reporter mice (Cre+) compared to Td-Tomato (Cre-) mice. Notice 1270

the presence of Td-tomato fluorescence into the CB glomus cells, SCG 1271

sympathetic neurons and adrenal medulla due to TH-Cre activity (lower 1272

panels). Dashed lines delineate the location of SCG and AM within Td-tomato 1273

(Cre-) sections. SCG, superior cervical ganglion; CB, carotid body; AM, 1274

adrenal medulla. Scale bars: 100 µm for carotid bifurcation and 200 µm for 1275

adrenal gland sections. (B-C) Relative Hif-2α (B) and Hif-1α (C) gene deletion 1276

of dissected SCG (left graphs) and AM (right graphs) from TH-HIF-2αKO (red, 1277

n = 4) and TH-HIF-1αKO (blue, n = 4) compared to their respective littermate 1278

controls (HIF-2αWT, n = 4; HIF-1αWT, n = 2). Data are expressed as mean 1279

±SEM. Unpaired t-test, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. 1280

1281

Figure 2. Progressive CB glomus cells death during development of TH-1282

HIF2αKO mouse. (A) Representative micrographs illustrating CB TH+ glomus 1283

cells appearance at embryo stage E18.5 (left) and postnatal stage P0 (right) 1284

in HIF-2αWT (top panels) and TH-HIF-2αKO (bottom panels) mice. Dashed 1285

rectangles (left panels) are shown at higher magnification on the right panels. 1286

SCG, superior cervical ganglion; CB, carotid body; ICA, internal carotid artery; 1287

ECA, external carotid artery. Scale bars: 100 µm. (B-E) Quantitative 1288

histological analysis of CB volume (B), TH+ cells number (C), TH+ cell density 1289

(D) and SCG volume (E) from TH-HIF-2αKO compared to HIF-2αWT mice. HIF-1290

2αWT (E18.5, n = 8; P0, n = 4; SCG, n = 5), TH-HIF-2αKO (E18.5, n = 7; P0, n 1291



https://doi.org/10.1101/250928


60

= 5; SCG, n = 5). SCG, superior cervical ganglion. Data are expressed as 1292

mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 1293

0.0001, ns, non significant. (F) Representative pictures of double TH+ and 1294

TUNEL+ (white arrows) stained carotid bifurcation sections from HIF-2αWT (top 1295

panels) and TH-HIF-2αKO (bottom panels) mice at E18.5 (left) and P0 (right) 1296

stages. (G) Number of TUNEL+ cells within the CB (TH+ area) of HIF-2αWT 1297

(E18.5, n = 9; P0, n = 5) and TH-HIF-2αKO (E18.5, n = 5; P0, n = 4) mice at 1298

E18.5 and P0 stages. Data are expressed as mean ±SEM. Two-way ANOVA, 1299

*p < 0.05, **p < 0.01, ****p < 0.0001. Scale bars: 50 µm 1300

1301

Figure 3. Effects of HIF-2α and HIF-1α sympathoadrenal loss on the HVR 1302

and whole-body metabolic activity in response to hypoxia. (A and E) HVR in 1303

TH-HIF-2αKO (A, red line, n = 4) and TH-HIF-1αKO (E, blue line, n = 3) 1304

deficient mice compared to control HIF-2αWT (A, black line, n = 4) and HIF-1305

1αWT (E, black line, n = 3) mice. Shift and duration of 10% O2 stimulus (30 1306

minutes) are indicated. Shaded areas represent the period of time analysed in 1307

B and C or F and G, respectively. Data are presented as mean breaths/min 1308

every minute ±SEM. Two-way ANOVA, **p < 0.01, ns, non-significant. (B and 1309

C) Averaged respiratory rate (B) and minute volume (C) of HIF-2αWT (black, n 1310

= 4) and TH-HIF-2αKO (red, n = 4) mice before and during the first 5 minutes 1311

of 10% O2 exposure (shaded rectangle in A). Data are expressed as mean 1312

±SEM. Two-way ANOVA, *p < 0.05, ***p < 0.001, ****p < 0.0001, ns, non-1313

significant. (D) Peripheral O2 saturation before, during and after hypoxia in 1314

HIF-2αWT (black, n = 8) and TH-HIF-2αKO (red, n = 9) mice. Data are 1315

expressed as mean percentage every 10 seconds ±SEM. Two-way ANOVA, 1316



https://doi.org/10.1101/250928


61

****p < 0.0001. (F and G) Averaged respiratory rate (F) and minute volume (F) 1317

of HIF-1αWT (black, n = 3) and TH-HIF-1αKO (blue, n = 3) mice before and 1318

during the first 5 minutes of 10% O2 exposure (shaded rectangle in E). Data 1319

are expressed as mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01. (H 1320

and I) Baseline metabolic activity of HIF-2αWT (black, n = 3) and TH-HIF-2αKO 1321

(red, n = 3) mice. Data are presented as mean oxygen consumption (VO2, H) 1322

and carbon dioxide generation (VCO2, I) every hour ± SEM. White and black 1323

boxes depict diurnal and nocturnal periods, respectively. Area under the curve 1324

followed by Mann-Whitney test, ns, non-significant. (J and K) Whole-body 1325

metabolic analysis of HIF-2αWT (black, n = 4) and TH-HIF-2αKO (red, n = 6) 1326

mice in response to 10% O2. Shift and duration of 10% O2 stimulus are 1327

indicated. Data are presented as mean oxygen consumption (VO2, J) and 1328

carbon dioxide generation (VCO2, K) every hour ± SEM. White and black 1329

boxes depict diurnal and nocturnal periods, respectively. Recovery across the 1330

hypoxia period was analysed by one-phase association curve fitting. ****p < 1331

0.0001. 1332

1333

Figure 3-figure supplement 1.Secretory and electrophysiological properties 1334

in AM and SCG from TH-HIF-2αKO mice. (A and B) Representative 1335

amperometric recordings of catecholamine release by chromaffin cells from 1336

HIF-2αWT and TH-HIF-2αKO mice (8-12 weeks old) in response to low PO2 1337

(PO2 ≈ 10-15 mmHg), hypercapnia (20% CO2) and 20 mM KCl. (C) 1338

Percentage of AM slices with response to hypoxia, 20% CO2 and 20 mM KCl, 1339

respectively. HIF-2αWT n = 8; TH-HIF-2αKO, n = 7. (D) Averaged secretion rate 1340

of chromaffin cells from HIF-2αWT and TH-HIF-2αKO mice exposed to hypoxia 1341



https://doi.org/10.1101/250928


62

(PO2 ≈ 10-15 mmHg), hypercapnia (20% CO2) and 20 mM KCl. Each data 1342

point represents the mean of 2-3 recordings per mouse. HIF-2αWT, n = 8; TH-1343

HIF-2αKO, n = 7. Data are expressed as mean ±SEM. One-way ANOVA, non-1344

significant. (E and F) Ca2+ and K+ current/voltage (I/V) curves of AM 1345

chromaffin cells (E) and SCG sympathetic neurons (F) dissociated from HIF-1346

2αWT (n = 9 cells from 3 mice) and TH-HIF-2αKO (n = 10 cells from 3 mice) 1347

mice. Data are expressed as mean ±SEM. Two-way ANOVA, ns, non-1348

significant. 1349

1350

Figure 3-figure supplement 2. Respiratory parameters of TH-HIF-2αKO and 1351

TH-HIF-1αKO mice exposed to acute hypoxia. (A-J) Averaged tidal volume (A 1352

and F), inspiration time (B and G), expiration time (C and H), peak inspiratory 1353

flow (D and I) and peak expiratory flow (E and J) of TH-HIF-2αKO (n = 4) and 1354

TH-HIF-1αKO (n = 3) respect to control mice (HIF-2αWT, n = 4; HIF-1αWT, n = 1355

3) before and during the first 5 minutes breathing 10% O2. Data are 1356

expressed as mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01, ***p < 1357

0.001. 1358

1359

Figure 4. Impaired acclimatisation to chronic hypoxia and severe pulmonary 1360

hypertension in mice lacking CBs. (A) Kaplan-Meier survival curve of the 1361

indicated mice housed at 10% O2 up to 21 days. HIF-2αWT (n = 12), TH-HIF-1362

2αKO (n = 11), HIF-1αWT (n = 8) and TH-HIF-1αKO (n = 8). ***p < 0.001. (B and 1363

C) Haematocrit (B) and haemoglobin (C) levels of HIF-2αWT (black) and TH-1364

HIF-2αKO (red) littermates kept in normoxia (21% O2) and after 21 days at 1365

10% O2. In B, HIF-2αWT (21% O2, n = 6; 10% O2, n = 21), TH-HIF-2αKO (21% 1366



https://doi.org/10.1101/250928


63

O2, n = 7; 10% O2, n = 8). In C, HIF-2αWT (21% O2, n = 5; 10% O2, n = 8), TH-1367

HIF-2αKO (21% O2, n = 5; 10% O2, n = 7). Data are expressed as mean 1368

±SEM. Two-way ANOVA, *p < 0.05, ***p < 0.001, ****p < 0.0001, ns, non-1369

significant. (D and E) Normalized heart (D) and spleen (E) weight of HIF-2αWT 1370

(black) and TH-HIF-2αKO (red) before and after 21 days in hypoxia (10% O2). 1371

In D, HIF-2αWT (21% O2, n = 16; 10% O2, n = 23), TH-HIF-2αKO (21% O2, n = 1372

15; 10% O2, n = 13). In E, HIF-2αWT (21% O2, n = 5; 10% O2, n = 23), TH-HIF-1373

2αKO (21% O2, n = 5; 10% O2, n = 13). Data are expressed as mean ±SEM. 1374

Two-way ANOVA, ****p < 0.0001, ns, non-significant. (F) Fulton index on 1375

hearts dissected from HIF-2αWT (black, 21% O2, n = 17; 10% O2, n = 23) and 1376

TH-HIF-2αKO (red, 21% O2, n = 15; 10% O2, n = 17) mice before and after 21 1377

days in hypoxia (10% O2). Data are expressed as mean ±SEM. Two-way 1378

ANOVA, ****p < 0.0001, ns, non-significant. RV, right ventricle. LV, left 1379

ventricle. (G) Right ventricular systolic pressure (RVSP) recorded on HIF-1380

2αWT (black, 21% O2, n = 6; 10% O2, n = 7) and TH-HIF-2αKO (red, 21% O2, n 1381

= 5; 10% O2, n = 5) mice maintained in normoxia (21% O2) or hypoxia (10% 1382

O2) for 21 days. Data are expressed as mean ±SEM. Two-way ANOVA, **p < 1383

0.01, ***p < 0.001, ****p < 0.0001, ns, non-significant. (H and I) Lung 1384

peripheral vessels muscularization (H) and arterial medial thickness (I) in HIF-1385

2αWT and TH-HIF-2αKO mice exposed to 10% O2 for 14 and/or 21 days. In H, 1386

HIF-2αWT (10% O2 14d, n = 4; 10% O2 21d, n = 3), TH-HIF-2αKO (10% O2 1387

14d, n = 6; 10% O2 21d, n = 3). In I, HIF-2αWT (21% O2, n = 5; 10% O2 21d, n 1388

= 8), TH-HIF-2αKO (21% O2, n = 5; 10% O2 21d, n = 8). Data are expressed 1389



https://doi.org/10.1101/250928


64

as mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01, ****p < 0.0001, ns, 1390

non-significant. 1391

1392

Figure 4-figure supplement 1. Impaired hypoxia-induced CB proliferation in 1393

TH-HIF-2αKO mice. (A) Glial fibrillary acidic protein (GFAP) immunostaining to 1394

illustrate the presence of CB stem cells in carotid bifurcation of both HIF-2αWT 1395

and TH-HIF-2αKO mice. Scale bars: 50 µm. (B) Double TH+ BrdU+ 1396

immunofluorescence performed on carotid bifurcation sections from HIF-2αWT 1397

(top) and TH-HIF-2αKO (bottom) mice exposed to 10% O2 for 14 days. Dashed 1398

rectangles are shown at higher magnification on the right panels. Newly 1399

formed TH+ cells are indicated with white arrows. Scale bars: 200 µm (left 1400

pictures), 50 µm (right pictures). (C and D) Quantification of total CB volume 1401

(C, n = 4 per genotype and condition) and double BrdU+ TH+ cells number (D, 1402

n = 3 per genotype and condition) in HIF-2αWT (black) and TH-HIF-2αKO (red) 1403

mice maintained for 14 days in hypoxia (10% O2). Data are presented as 1404

mean ±SEM. Unpaired t-test, **p < 0.01, ***p < 0.001. 1405

1406

Figure 4-figure supplement 2. Adaptation to hypoxia in TH-HIF-1αKO 1407

animals. (A) Haematocrit levels of HIF-1αWT (black, 21% O2, n = 4; 10% O2, n 1408

= 8) and TH-HIF-1αKO (blue, 21% O2, n = 4; 10% O2, n = 8) mice housed at 1409

21% O2 or after 21 days at 10% O2. Data are expressed as mean ±SEM. 1410

Two-way ANOVA, ****p < 0.001, ns, non-significant. (B and C) Normalized 1411

heart (B) and spleen (C) weight of HIF-1αWT (black) and TH-HIF-1αKO (blue) 1412

mice before and after 21 days of hypoxia (10% O2) exposure. In B, HIF-1αWT, 1413

21% O2, n = 9; 10% O2, n = 8; TH-HIF-1αKO, n = 9, per condition. In C, 21% 1414



https://doi.org/10.1101/250928


65

O2, n = 4 per genotype; 10% O2, n = 5 per genotype. Data are expressed as 1415

mean ±SEM. Two-way ANOVA, *p < 0.05, ns, non-significant. (D) Fulton 1416

index on hearts dissected from HIF-1αWT (black) and TH-HIF-1αKO (blue) mice 1417

before and after 21 days in hypoxia (10% O2). HIF-1αWT, 21% O2, n = 7; 10% 1418

O2, n = 8; TH-HIF-1αKO, n = 8, per condition. Data are expressed as mean 1419

±SEM. Two-way ANOVA, ****p < 0.0001, ns, non-significant. RV, right 1420

ventricle. LV, left ventricle. 1421

1422

Figure 5. Effects of CB dysfunction on blood pressure regulation. (A-C) 1423

Circadian variations in baseline systolic blood pressure (A, continued line), 1424

diastolic blood pressure (A, broken line), mean blood pressure (B) and heart 1425

rate (C) of HIF-2αWT (black, n = 10) and TH-HIF-2αKO (red, n = 8) littermates 1426

recorded by radiotelemetry. White and black boxes depict diurnal and 1427

nocturnal periods, respectively. Data are presented as averaged values every 1428

hour ±SEM. Area under the curve followed by unpaired t-test are shown. BP, 1429

blood pressure. HR, heart rate in beats per minute. (D-F) Mean blood 1430

pressure (D), heart rate (E) and subcutaneous temperature (F) alteration in 1431

response to hypoxia in radiotelemetry-implanted TH-HIF-2αKO (red, n = 5) 1432

compared to HIF-2αWT (black, n = 5). Shift and duration of 10% O2 are 1433

indicated in the graph. White and black boxes represent diurnal and nocturnal 1434

periods, respectively. Data are presented as averaged values every hour 1435

±SEM. Recovery across the hypoxia period was analysed by one-phase 1436

association curve fitting. BP, blood pressure. HR, heart rate in beats per 1437

minute. (G) Schematic representation of the protocol followed in the Ang II-1438

induced experimental hypertension model. (H-M) Mean blood pressure and 1439



https://doi.org/10.1101/250928


66

heart rate recorded from HIF-2αWT (black, n = 8) and TH-HIF-2αKO (red, n = 8) 1440

mice after 7 days (H and K), 14 days (I and L) and 21 days (J and M) of Ang II 1441

infusion. White and black boxes depict diurnal and nocturnal periods, 1442

respectively. Data are presented as averaged values every hour ±SEM. Area 1443

under the curve followed by unpaired t-test are shown. BP, blood pressure. 1444

HR, heart rate in beats per minute. 1445

1446

Figure 5-figure supplement 1. Cardiovascular homeostasis in response to 1447

hypoxia and Ang II-induced experimental hypertension. (A and B) Circadian 1448

oscillations in subcutaneous temperature (A) and physical activity (B) of 1449

radiotelemetry-implanted HIF-2αWT (black, n = 10) and TH-HIF-2αKO (red, n = 1450

8). White and black boxes depict diurnal and nocturnal periods, respectively. 1451

Data are presented as averaged values every hour ±SEM. Area under the 1452

curve followed by unpaired t-test are shown. (C and D) Systolic blood 1453

pressure (C) and diastolic blood pressure (D) alteration in response to 1454

hypoxia in TH-HIF-2αKO (red, n = 5) compared to HIF-2αWT (black, n = 5) 1455

measured by radiotelemetry. Shift and duration of 10% O2 are indicated in the 1456

graph. White and black boxes depict diurnal and nocturnal periods, 1457

respectively. Data are presented as averaged blood pressure values every 1458

hour ±SEM. Recovery across the hypoxia period was analysed by one-phase 1459

association curve fitting. (E) Physical activity recorded by radiotelemetry of 1460

HIF-2αWT (black, n = 5) and TH-HIF-2αKO (red, n = 5) littermates exposed to 1461

10% O2 environment. Shift and duration of 10% O2 are indicated in the graph. 1462

White and black boxes depict diurnal and nocturnal periods, respectively. 1463

Data are presented as averaged blood pressure values every hour ±SEM. 1464



https://doi.org/10.1101/250928


67

Area under the curve followed by unpaired t-test is shown. (F-Q) Circadian 1465

fluctuations in systolic blood pressure, diastolic blood pressure, subcutaneous 1466

temperature and physical activity of HIF-2αWT (black, n = 5) and TH-HIF-2αKO 1467

(red, n = 5) after 7 days (F-I), 14 days (J-M) and 21 days (N-Q) of Ang II 1468

infusion recorded by radiotelemetry. White and black boxes represent diurnal 1469

and nocturnal periods, respectively. Data are presented as averaged values 1470

every hour ±SEM. Area under the curve followed by unpaired t-test are 1471

shown. ns, non-significant. 1472

1473

Figure 6. Exercise performance and glucose management in mice lacking 1474

CBs. (A-D). Time course showing the increment in O2 consumption (A), 1475

increment in CO2 generation (B), respiratory exchange ratio (C) and 1476

increment in heat production (D) from HIF-2αWT (black, n = 8) and TH-HIF-1477

2αKO (red, n = 10) mice during exertion on a treadmill. Mice were warmed up 1478

for 5 minutes (5m/min) and then the speed was accelerated 2m/min at 2.5 1479

minutes intervals until exhaustion. Averaged measurements every 2.5 1480

minutes intervals ±SEM are charted. Two-way ANOVA, *p < 0.05, **p < 0.01, 1481

***p < 0.001, ****p < 0.0001. RER, respiratory exchange ratio. (E) Running 1482

total time spent by HIF-2αWT (black, n = 8) and TH-HIF-2αKO (red, n = 10) 1483

mice to become exhausted. Data are expressed as mean ±SEM. Unpaired t-1484

test. (F and G) Aerobic capacity (F) and power output (G) measured in HIF-1485

2αWT (black, n = 8) mice compared to TH-HIF-2αKO (red, n = 10) mice when 1486

performing at VO2max. Data are expressed as mean ±SEM. Unpaired t-test. 1487

*p < 0.05. (H and I) Plasma glucose (H) and lactate (I) levels of HIF-2αWT 1488

(black, before, n = 7; after, n = 12) and TH-HIF-2αKO (black, before, n = 6; 1489



https://doi.org/10.1101/250928


68

after, n = 12) littermates before and after running to exhaustion. Data are 1490

expressed as mean ±SEM. Two-way ANOVA, *p < 0.05. ***p < 0.001. ns, 1491

non-significant. (J and K) Plasma glucose levels of HIF-2αWT (black, n = 6) 1492

and TH-HIF-2αKO (red, n = 6) mice fed (J, n = 6 per genotype) or fasted over 1493

night (K, HIF-2αWT (n = 8) and TH-HIF-2αKO (n = 10). Data are expressed as 1494

mean ±SEM. Unpaired t-test. (L-M) Time courses showing the tolerance of 1495

HIF-2αWT and TH-HIF-2αKO mice to glucose (L, n = 7 per genotype) insulin 1496

(M, n = 11 per genotype) and lactate (N, n = 7 per genotype) injected bolus. 1497

Data are presented as mean ±SEM. Two-way ANOVA, *p < 0.05, **p < 0.01, 1498

ns, non-significant. 1499

1500

Figure 6-figure supplement 1. Related to Figure 6. Whole-body metabolic 1501

activity of TH-HIF-2αKO in response to fasting-induced hypoglycemia. (A-D) 1502

Oxygen consumption (A, VO2), carbon dioxide generation (B, VCO2), 1503

respiratory exchange rate (C) and heat production (D) of HIF-2αWT (black, n = 1504

7) and TH-HIF-2αKO (red, n = 7) littermates under feed and over night fasting 1505

conditions. White and black boxes represent diurnal and nocturnal periods, 1506

respectively. Data are presented as averaged values every hour ±SEM. Area 1507

under the curve followed by unpaired t-test are shown. ns, non-significant. 1508

1509

Figure 7. mTORC1 activation in CB development and hypoxia-induced CB 1510

neurogenesis. (A) Double TH and p-S6 (mTORC1 activation marker) 1511

immunofluorescence on adult wild type CB slices to illustrate the increased p-1512

S6 expression after 14 days in hypoxia (10% O2). For clarity, bottom panels 1513

only show p-S6 staining. TH+ outlined area (top panels) indicates the region 1514



https://doi.org/10.1101/250928


69

used for pixels quantification. Scale bars: 50 µm. (B) Quantification of p-S6 1515

(top) and TH (bottom) mean pixels intensity within the CB TH+ cells of wild 1516

type mice breathing 21% O2 or 10% O2 for 14 days. Each data point depicts 1517

the average of 3-4 pictures. 21% O2, n = 5; 10% O2 14d, n = 9 per genotype. 1518

Data are presented as mean ±SEM. Unpaired t-test, *p < 0.05. (C) 1519

Representative micrographs of TH and p-S6 double immunostaining of HIF-1520

2αWT and TH-HIF-2αKO embryonic (E18.5) carotid bifurcations. TH+ outlined 1521

area indicates the region used for pixels quantification. Scale bars: 50µm. (D) 1522

Quantitative analysis performed on HIF-2αWT (black, n = 12) and TH-HIF-2αKO 1523

(red, n = 10) micrographs previously immuno-stained for p-S6 and TH. Each 1524

data point depicts the average of 3-4 pictures. Data are presented as mean 1525

±SEM. Unpaired t-test, **p < 0.01. (E) Double BrdU and TH 1526

immunofluorescence on carotid bifurcation sections from wild type mice 1527

exposed to 10% O2 and injected with rapamycin or vehicle control for 14 days. 1528

Notice the striking decrease in double BrdU+ TH+ cells (white arrowheads) in 1529

the rapamycin treated mice compared to vehicle control animals. Scale bars: 1530

100µm. (F-H) Quantification of total CB volume (F), TH+ cells number (G) and 1531

percentage of double BrdU+ TH+ over the total TH+ cells (H) in wild type mice 1532

breathing 10% O2 and injected with rapamycin or vehicle control for 14 days. 1533

n = 5 mice per treatment. (K) Averaged breaths per minute during the first 2 1534

minutes of acute hypoxia (10% O2) exposure from vehicle or rapamycin 1535

injected mice before and after 7 days of chronic hypoxia (10% O2) treatment. 1536

n = 14 mice per condition and treatment. Data are presented as mean ±SEM. 1537

B, D, F, G and H, unpaired t-test, *p < 0.05, ****p < 0.0001. K, two-way 1538



https://doi.org/10.1101/250928


70

ANOVA followed by Tukey’s multiple comparison test. ****p < 0.0001, ns, 1539


1541

Figure 7-figure supplement 1. mTORC1 activity in SCG TH+ sympathetic 1542

neurons and effect of rapamycin treatment. (A) Double TH and p-S6 1543

(mTORC1 activation marker) immunofluorescence on adult wild type SCG 1544

slices after 14 days in hypoxia (10% O2). TH+ outlined area indicates the 1545

region used for pixels quantification. Scale bars: 100 µm. SCG, superior 1546

cervical ganglion. (B) Quantification of p-S6 (red) and TH (green) mean pixels 1547

intensity within the SCG TH+ area of wild type mice breathing 21% O2 or 10% 1548

O2 for 14 days. Each data point depicts the average of 3-4 pictures. 21% O2, 1549

n = 3; 10% O2, n = 4. Data are presented as mean ±SEM. Unpaired t-test, ns, 1550

non-significant. (C) Representative micrographs of TH and p-S6 double 1551

immunostaining of HIF-2αWT and TH-HIF-2αKO embryonic (E18.5) carotid 1552

bifurcations. SCG TH+ outlined area indicates the region used for pixels 1553

quantification. SCG, superior cervical ganglion. Scale bars: 100 µm. (D) 1554

Quantitative analysis performed on HIF-2αWT (black) and TH-HIF-2αKO (red) 1555

micrographs previously immune-stained for TH (green) and p-S6 (red). Each 1556

data point depicts the average of 3-4 pictures. 21% O2, n = 12; 10% O2, n = 1557

10. Data are presented as mean ±SEM. Unpaired t-test, ns, non-significant. 1558

(E) Double TH and p-S6 immunofluorescence on vehicle control or rapamycin 1559

injected adult wild type SCG slices after 14 days breathing in a 10% O2 1560

atmosphere. Notice the absence of p-S6 signal as a consequence of mTORC 1561

inhibition by rapamycin. SCG, superior cervical ganglion. CB, carotid body. 1562

Scale bars: 100 µm. (F) Haematocrit levels of vehicle control (n = 14) and 1563



https://doi.org/10.1101/250928


71

rapamycin (n = 14) injected mice after 7 days at 10% O2. Un-paired t-test, ns, 1564


1566

1567

1568

1569

1570

1571

1572

1573

1574

1575

1576

1577 1578



https://doi.org/10.1101/250928


HIF-2α is essential for carotid body development and function · 2018. 1. 19. · 6 133 Results...

Documents

Transcript of HIF-2α is essential for carotid body development and function · 2018. 1. 19. · 6 133 Results...