Indian Journal of Biotechnology Vol 15, April 2016, pp 178-181

Genetic variants of β-casein in cattle and buffalo breeding bulls in

Karnataka state of India

K P Ramesha1*, Akhila Rao1, M Basavaraju1, Rani Alex2, M A Kataktalware1, S Jeyakumar1 and S Varalakshmi1 1ICAR-National Dairy Research Institute (NDRI), Southern Regional Station, Bengaluru 560 030, India

2ICAR-Central Institute for Research on Cattle, Meerut 250 001, India

Received 4 October 2014; revised 25 February 2015; accepted 17 April 2015

Among the genetic variants of bovine β-casein gene (CSN2), A1 and A2 are the most common. β-Casein contains 209 amino acids and A1 and A2 variants differ only at position 67 in the amino acid chain CAT, which is histidine in A1, and CCT, which is proline in case of A2. Various studies suggest that A1 casein present in milk is likely to cause health problems. The present study involved screening of 391 bulls belonging to seven breeds of cattle and two breeds of buffaloes from different regions of Karnataka for genetic variants A1 and A2 in β-casein gene using ACRS (amplification created restriction sites) method with TaqI restriction enzyme. The results indicated that A2 allele is fixed in Deoni and Khillar breed

of cattle and both the buffalo breeds (Murrah & Surti). It was observed that the frequency of A1 allele was very low in Malnad Gidda (0.014), Kasargod variety (0.042) and Jersey (0.077), while the frequency of A1 allele in Holstein Friesian and Holstein Friesian crossbred males was 0.169 and 0.294, respectively.

Keywords: A1 and A2 allele, ACRS, breeding bulls, β-casein, PCR-RFLP

Introduction Casein and whey proteins are two major protein

groups present in the milk. Casein makes up around

80% of the milk proteins. The caseins are a family of

phosphoproteins synthesized in the mammary gland in response to lactogenic hormones and other

stimuli and secreted as large colloidal aggregates

termed micelles, which are responsible for many of the unique physical properties of milk

1. β-casein

composition of milk and milk products has become an

important economic trait of dairy animals. Four casein genes are known, which are alpha s1, alpha s2, beta

and kappa, and among these β-casein is the second

most abundant protein in the cow’s milk2. Bovine

β-casein gene (CSN2) is located on the sixth chromosome and twelve different genetic variants are

known in coding sequence of the gene3. CSN2 is 8.5

kb in length and consists of nine exons and eight introns. Genetic variants, such as, A1, A2, A3 and B,

are found in Bos taurus and B. indicus populations

and the base change encoding the amino acid

differences between these variants is known to be located in exon 7, which encodes the major part of

mature protein4. Of all the genetic variants, A1 and

A2 are the most commonly known genetic variants.

β-Casein consists of 209 amino acids. The difference

in A1 and A2 β-casein is the amino acid at position

67, which is histidine in A1 and proline in 52A . In the

gene coding bovine A1 β-casein, G is substituted by

A at 8101 position (GenBank M55158). Histidine

found in A1 milk is a weak bond, which is easily broken to release bioactive peptide β-casomorphin 7;

while proline found in A2 milk is a strong bond and

did not break during digestion. Thus polymorphism at

codon 67 leads to the release of bioactive peptide β-casomorphin 7 upon digestion of A1 but not

of A26. Some reports suggest that the A1 present in

milk is likely to cause type 1 diabetes (DM-1), coronary heart disease (CHD), arteriosclerosis and

sudden infant death syndrome6,7

. The effect of the A1

allele on human health is yet to be conclusively studied. Therefore, it is necessary to take

precautionary principle, and is of practical value to

use A2A2 genotype bulls in dairy animal breeding

programmes.

Amplification Created Restriction Sites (ACRS) method mainly involves differentiating restriction

enzyme sites those are created artificially by allele

specific site directed mutagenesis in the amplification

—————— *Author for correspondence: Mobile: +91-9916499636 kpragb@gmail.com

RAMESHA et al: GENETIC VARIANTS OF β-CASEIN IN BULLS

179

step to identify different genotypes among breeding

bulls. The ACRS method involves primers those

function even with mismatch at their 3′ ends. The primers were mismatched at their 3′ end and designed

to end just before the point mutation in the β-casein

(CASB) gene. CASB122 primer had a mismatch of

C-A in the fourth last position and CASB67 primer had a G-G mismatch in the last position of the 3′ end

8.

Earlier researchers have reported varying frequency

of A1 allele ranging from 0 in different breeds of zebu cattle

9 to as high as 0.60 in Holstein Friesian bulls

10,11.

The present study aimed at screening of 7 breeds of

cattle and 2 breeds of buffalo reared in Karnataka state in India for A1 and A2 variants in milk in order

to apply the precautionary principle and to reduce

A1 allele from the population.

Materials and Methods

Animals

The breeding bulls and males intended for breeding purpose maintained at organized frozen semen

stations, dairy farms and farmers' field were included

in the present study. A total of 391 breeding bulls from different regions of Karnataka were screened for

genetic variants A1 and A2 in β-casein gene. Holstein

Friesian (HF) (n=59), HF crossbred (n=17), Jersey (n=39), indigenous breeds, viz., Khillar (n=12) and

Deoni (n=40), males maintained at different farms

and State Frozen Semen stations located in Karnataka,

and Malnad Gidda (n=104) males reared by farmers of Malnad and coastal region of Karnataka, Kasargod

cattle (n=48) reared in Kasargod district in Kerala,

which is an adjoining district to coastal region in Karnataka, and buffalo bulls Murrah (n=47) and Surti

(n=25) reared in Semen stations in Karnataka were

utilized for the study.

Sample Collection

Blood sample (8-10 mL) from each animal was

collected aseptically by jugular vein-puncture into vacutainer tubes containing EDTA and was stored at

4°C prior to DNA isolation.

PCR-RFLP Technique

After collection of blood, within 24 h, genomic

DNA was isolated by the high salt method as

described by previous researchers with minor modifications

12. Agarose gel electrophoresis and

spectrophotometric methods were used to determine

quality and quantity of DNA. The samples showing an optical density (OD) ratio (260 nm/280 nm) of

between 1.8 and 2.0 were stored at –20°C, and diluted

to 100 ng µL-1

and used for further analysis. The

technique involved in the study was restriction fragment length polymorphism (RFLP) method. Primers used

were those reported in earlier studies, CASB122L- 5′ GAGTCGACTGCAGATTTTCAACATCAGTGAGAG

TCA GGCCCTG 3′ and CASB67R- 5′CCTGCAGAATTCTA

GTCTATCCCTTCCCTGGGCCCATCG 3′, which was

used to amplify a 251 bp fragment in case of exon 7

in β-casein gene8.The primers had the amplification

created restriction sites. PCR parameter consisted of total volume of 25 µL consisting of 20 pmol/µL each

of forward and reverse primer, 10× PCR incomplete

buffer, 25 mM magnesium chloride, 2.5 mM dNTPs,

1 U of Taq DNA polymerase and 100 ng genomic DNA. PCR conditions involved an initial denaturation

at 94°C for 5 mins, final denaturation at 94°C for

1 min, followed by 35 cycles with an annealing temperature of 65°C for 1 min, initial extension at

72°C for 1 min, followed by a final extension of 72°C

for 10 mins. After PCR, the samples were analyzed by loading on 1.5% agarose gel along with a 100 bp

DNA marker. The gels were visualized and documented

using Gel documentation system (Gel doc 1000,

Bio-Rad, USA). The PCR products were then digested by making use of TaqI enzyme at 65°C for

5 h in the incubator to liberate the restriction

fragments. After incubation, the digested products along with 6× gel loading dye were mixed and loaded

on 3% agarose gel in 1× TBE buffer along with 100

bp DNA marker. The gels were examined for

different band patterns.

Results and Discussion

Breeding bulls and males intended for breeding

purposes (n=391) belonging to seven cattle breeds and two buffalo breeds were screened for genotyping of

the β-casein gene for A1 and A2 variants at position

8101 (GenBank M55158). A2A2 genotype showed the product size of 251 bp, while A1A2 genotype showed

the product size of 251 bp and 213 bp. The A1A1

genotype, which is expected to show the product size of 213 and 38 bp, were absent in the present study.

Genetic variants of β-casein observed in different

breeds of cattle are shown in Fig. 1. Among the 391 bulls screened, 348 animals were of A2A2 and

43 animals were of A1A2 genotypes, while none of

the animal was of A1A1 genotype. The genotypic frequency and allelic frequency of A1 and A2 variants

among different breeds of cattle and buffalo are

presented in Table 1. It was observed that A2 allele is

INDIAN J BIOTECHNOL, APRIL 2016

180

fixed in case of Deoni and Khillar breeds of cattle as

well as in both the breeds of buffalo. In Malnad Gidda and Kasargod variety of dwarf cattle very low

frequency of A1 allele was observed, which could be

due to crossing of those cattle with Jersey breed. In the herds where few Malnad Gidda and Kasargod

cattle showed A1A2 genotype, it was observed

that they were going for grazing along with Jersey cattle. The presence of A1 allele might have come

from Jersey cattle. The presence of A1 allele in low

frequency in some of the indigenous breeds of cattle and crossbred cattle in India could be due to

crossbreeding with exotic cattle. Earlier reports on

Malnad Gidda cattle showed allelic frequency of

0.096 for A1 allele9. In the present study, Malnad

Gidda males showed the frequency of A1 allele to be 0.014. This variation could be due to area of sample

collection. In the present case, the blood samples were

collected from animals belonging to the interior parts of their breeding tract, while in the earlier study, the

samples were collected from animals near to towns

where the presence of Jersey males are also higher as compared to interior villages. In case of Kherigarh

cattle, A1 allele was reported to be 0.109. The overall

mean A1 and A2 allele frequency among 15 Indian zebu cattle breeds screened was 0.013 and 0.987,

respectively, indicating very high frequency of A2

variant9. Previous reports on Kangayam cattle showed

fixation of A2 genotype13

. There was predominance of

the β-casein A2 allele with frequency of 0.93 in the

Sahiwal cattle14

. Earlier reports on Kasargod cattle showed allelic frequency of A1 and A2 to be 0.39 and

0.61, respectively15

. The present results show very

low frequency (0.042) of A1 allele and high frequency (0.958) of A2 allele across the breeds.

The frequency of A1 allele observed in the present

study among Holstein Friesian bulls was lower compared to earlier reports in other countries

10,11.

In Polish Holstein bulls, the frequency of A1 and A2

allele was found to be 0.402 and 0.598, respectively10

and in Slovakia the frequencies of A1 allele

Table 1—Genotypic frequency and allelic frequency of A1 and A2 variants among cattle and buffalo breeds

Breeds No. of animals Genotype frequency Allele frequency

Cattle A1A1 A1A2 A2A2 A1 A2

Malnad Gidda 104 0.000 0.029 (3)

0.971

(101)

0.014 0.986

Deoni 40 0.000 0.000 1.000 (40)

0.000 1.000

HF 59 0.000 0.338

(20)

0.662

(39)

0.169 0.831

HF crossbred 17 0.000 0.588 (10)

0.412 (7)

0.294 0.706

Jersey 39 0.000 0.153 (6)

0.847 (33)

0.077 0.923

Kasargod cattle 48 0.000 0.083

(4)

0.917

(44)

0.042 0.958

Khillar 12 0.000 0.000 1.000 (12)

0.000 1.000

Buffalo

Murrah 47 0.000 0.000 1.000 (47)

0.000 1.000

Surti 25 0.000 0.000 1.000

(25)

0.000 1.000

Figures in parenthesis indicate number of animals/sample size (25)

Fig. 1—Genetic variant A1A2 and A2A2 of β-casein gene in cattle. [Lanes 1-3, 7, 10-12: 251 bp for A2A2 genotype; Lanes 4-6, 8, 9: 251 bp and 213 bp bands for A1A2 genotype. Lanes 1-3: Deoni;

Lanes 4-6: HF Crossbreds; Lanes 7-9: HF; Lanes 10-12: Malnad Gidda; Lane 13: 100 bp DNA marker.]

RAMESHA et al: GENETIC VARIANTS OF β-CASEIN IN BULLS

181

was 0.54 in cows and 0.60 in case of bulls,

respectively11

. In an another study the allelic

frequency for A1 and A2 variants was 0.33 and 0.67 among Polish Holstein Friesian cattle

16. The observed

frequency of A1 allele among Holstein Friesian

crossbred bulls was found to be lower compared to earlier reports. Previous two reports on Indian

crossbred cattle showed allelic frequency of A1 to be

0.405 and 0.46, respectively13,15

. However, in Karan Fries cross breed cattle, recently

17 the frequency

of A1 allele was reported to be 0.175. Previous study

on Mexican Jersey cattle18

showed A2 allele frequency to be 0.71, which was lower compared to the

result obtained (A2 allele frequency 0.923 in Jersey

cattle) in the present study. All the buffaloes in the

present study showed A2A2 genotype, indicating

fixation of A2 allele among buffalo, which is in

agreement with the earlier report carried out on 8 different Indian buffalo breeds

9. In the current study,

low frequency of A1A2 genotype was observed in HF

crossbred cattle, which is due to crossbreeding with Holstein Friesian bulls. Hence, as a precautionary

approach, it is desirable to screen breeding bulls

among cattle and buffalo population and use A2A2 bulls desirable for breeding purpose to reduce the risk

to human health.

Conclusion

The screening of bulls and males intended for

breeding belonging to 7 breeds of cattle and 2 breeds

of buffaloes from different regions of Karnataka, India for genetic variants A1 and A2 in β-casein gene

indicated that A2 allele is fixed in Deoni and Khillar

breeds of cattle and buffaloes, while A1 allele was present at a very low frequency in Malnad Gidda,

Jersey and Kasargod cattle. The frequency of A1 allele

in Holstein Friesian and Holstein Friesian crossbred males was 0.169 and 0.294, respectively. Therefore,

genotyping bulls in terms of β-casein gene variants

could be employed as a breeding strategy to enhance A2 milk production.

Acknowledgement

The present work was supported by funds from the Karnataka Livestock Development Agency

(KLDA), Government of Karnataka, India. The

authors are thankful to the Director, NDRI, Karnal and Head, Southern Regional Station of ICAR-NDRI,

Bengaluru for providing necessary facilities and

support.

References 1 Swaisgood H E, Chemistry of caseins, in Advanced dairy

chemistry 1. Proteins, 2nd edn, edited by P F Fox (Elsevier Applied Science, London, UK) 1992, 63-110.

2 Rijnkels M, Multispecies comparison of the casein gene loci and evolution of casein gene family, J Mammary Gland Biol

Neoplasia, 7 (2002) 327-345. 3 Farrell H M Jr, Jimenez-Florez R, Bleck G T, Brown E M,

Butler J E et al, Nomenclature of the proteins of cows’ milk—Sixth revision, J Dairy Sci, 87 (2004) 1641-1674.

4 Bonsing J, Ring J M, Stewart A F & Mackinlay A G, Complete nucleotide sequence of the bovine β-casein gene, Aust J Biol Sci, 41 (1988) 527-537.

5 Bell S J, Grochoski G T & Clarke A J, Health implications of milk containing beta-casein with the A2 genetic variant, Crit

Rev Food Sci Nutr, 46 (2006) 93-100. 6 Elliot R B, Harris D P, Hill J P, Bibby N J & Wasmuth H E,

Type I (insulin dependent) diabetes mellitus and cow milk: Casein variant consumption, Diabetologia, 42 (1999) 292-296.

7 Truswell A S, The A2 milk case: A critical review, Eur J

Clin Nutr, 59 (2005) 623-631. 8 Lien S, Alestrom P, Klungland H & Rogne S, Detection of

multiple β-casein (CASB) alleles by amplification created restriction sites (ACRS), Anim Genet, 23 (1992) 333-338.

9 Mishra B P, Mukesh M, Prakash B, Sodhi M, Kapila R et al, Status of milk protein, β-casein variants among Indian milch animals, Indian J Anim Sci, 79 (2009) 722-725.

10 Kaminski S, Rusc A & CieSlinska A, A note on frequency of

A1 and A2 variants of bovine beta-casein locus in Polish Holstein bulls, J Anim Feed Sci, 15 (2006) 195-198.

11 Hanusova E, Huba J, Oravcova M, Polak P & Vrtkova I, Genetic variants of beta-casein in Holstein Dairy cattle in Slovakia, Slovak J Anim Sci, 43 (2010) 63-66.

12 Miller S A, Dykes D D & Polesky H F, A simple salting out procedure for extracting DNA from human nucleated cells, Nucleic Acids Res,16 (1988) 1215.

13 Malarmathi M, Senthil Kumar T M A, Parthiban M, Muthuramalingam T & Palanisammi A, Analysis of β-casein gene for A1 and A2 genotype using allele specific PCR in Kangeyam and Holstein Friesian crossbred cattle in Tamil

Nadu, Indian J Vet Anim Sci Res, 43 (2014) 310-315. 14 Mir S N, Ullah O & Sheikh R, Genetic polymorphism of

milk protein variants and their association studies with milk yield in Sahiwal cattle, Afr J Biotechnol,13 (2014) 555-565.

15 Muhammed E M & Stephen M, Beta casein A1A2 polymorphism and milk yield in Vechur, Kasargode Dwarf and crossbred cattle, J Indian Vet Assoc,10 (2012) 5-9.

16 Olenski K, Cieslinska A, Suchocki T, Szyda J & Kaminski S, Polymorphism in coding and regulatory sequences of beta-casein gene is associated with milk production traits in Holstein Friesian cattle, Anim Sci Papers Rep, 30 (2012)

5-12. 17 Kailash J, Sachinandan D & Anil S, Detection of single

nucleotide polymorphism by T-ARMS PCR of cross bred cattle Karan Fries for A1, A2 beta casein types, Int J Sci Res

Biol Sci, 1 (2014) 18-22. 18 Zepeda-Batista J L, Alarcon-Zuniga B, Ruiz-Flores A,

Nunez-Dominguez R & Ramirez-Valverde R, Polymorphism of three milk protein genes in Mexican Jersey cattle, Electron

J Biotechnol, 18 (2015) 1-4.