REGULAR ARTICLE

Expression of chemokine CXCL10 in dendritic-cell-likeS100β-positive cells in rat anterior pituitary gland

Kotaro Horiguchi & Ken Fujiwara & Masashi Higuchi & Saishu Yoshida &

Takehiro Tsukada & Hiroki Ueharu & Mo Chen & Rumi Hasegawa & Shu Takigami &Shunji Ohsako & Takashi Yashiro & Takako Kato & Yukio Kato

Received: 20 January 2014 /Accepted: 26 February 2014# Springer-Verlag Berlin Heidelberg 2014

Abstract Chemokines are mostly small secreted poly-peptides whose signals are mediated by seven trans-membrane G-protein-coupled receptors. Their functionsinclude the control of leukocytes and the intercellularmediation of cell migration, proliferation, and adhesionin several tissues. We have previously revealed that theCXC chemokine ligand 12 (CXCL12) and its receptor 4(CXCR4) are expressed in the anterior pituitary gland,and that the CXCL12/CXCR4 axis evokes the migration

and interconnection of S100β-protein-positive cells(S100β-positive cells), which do not produce classicalanterior pituitary hormones. However, little is known ofthe cells producing the other CXCLs and CXCRs or oftheir characteristics in the anterior pituitary. We there-fore examined whether CXCLs and CXCRs occurred inthe rat anterior pituitary lobe. We used reverse transcrip-tion plus the polymerase chain reaction to analyze theexpression of Cxcl and Cxcr and identified the cells thatexpressed Cxcl by in situ hybridization. Transcripts ofCxcl10 and its receptor (Cxcr3 and toll-like receptor 4,Tlr4) were clearly detected: cells expressing Cxcl10 andTlr4 were identified amongst S100β-positive cells andthose expressing Cxcr3 amongst adrenocorticotropic hor-mone (ACTH)-producing cells. We also investigatedCxcl10 expression in subpopulations of S100β-positivecells. We separated cultured S100β-positive cells intothe round-type (dendritic-cell-like) and process-type (as-trocyte- or epithelial-cell-like) by their adherent activityto laminin, a component of the extracellular matrix;CXCL10 was expressed only in round-type S100β-positive cells. Thus, CXCL10 produced by a subpopu-lation of S100β-positive cells probably exerts anautocrine/paracrine effect on S100β-positive cells andACTH-producing cells in the anterior lobe.

Keywords Anterior pituitary gland . Chemokine . CXCL10 .

Folliculo-stellate cell . S100β-positive cells . Rat

Introduction

Chemokines are a superfamily of small cytokines (7–16 kDa)that were originally characterized by their ability to regulatethe motility of leukocytes (Baggiolini 1998) and play theirroles through the activation of specific G-protein-coupled

This work was partially supported by JSPS KAKENHI grant nos.21380184 to Y.K. and 24580435 to T.K. and by the Meiji UniversityInternational Institute for BioResource Research (MUIIR). This workalso received funding via a Grant-in-Aid for Young Scientists (B)(25860148) to K.H. from the Ministry of Education, Culture, Sports,Science and Technology of Japan.

The authors declare no conflicts of interest that might prejudice theimpartiality of this research.

K. Horiguchi :R. Hasegawa : S. Takigami : S. OhsakoLaboratory of Anatomy and Cell Biology, Department of HealthSciences, Kyorin University, Tokyo, Japan

K. Horiguchi :M. Higuchi : T. Kato :Y. KatoInstitute of Reproduction and Endocrinology, Meiji University,Kawasaki, Japan

K. Fujiwara : T. Tsukada : T. YashiroDivision of Histology and Cell Biology, Department of Anatomy,Jichi Medical University School of Medicine, Tochigi, Japan

S. Yoshida :H. Ueharu :M. Chen :Y. Kato (*)Division of Life Science, Graduate School of Agriculture, MeijiUniversity, Kawasaki, Japane-mail: yukato@isc.meiji.ac.jp

Y. KatoDepartment of Life Science, School of Agriculture, Meiji University,1-1-1 Higashi-mita, Tama-ku, Kawasaki, Kanagawa 214-8571,Japan

Cell Tissue ResDOI 10.1007/s00441-014-1864-2

receptors (Rajagopal et al. 2010). Over 50 chemokineshave been found; they have been divided into foursubgroups (CC, CXC, CX3C, and C) depending onthe position and the number of the conserved cysteineresidues in the N-terminus of these proteins (Zlotnikand Yoshie 2000). The CXC group has one amino acid(X) between the first two cysteins (C) and includes 21members (CXCL1-21) that bind at least seven receptors(CXCR1-7; Barbieri et al. 2008; Singh et al. 2013).They have the ability to promote the trafficking ofvarious leukocytes and to regulate angiogenesis, vascu-lar remodeling, tumor cell migration, and organ-specificmetastasis (Mackay 2001; Strieter et al. 2006; Colobranet al. 2007).

Recently, the expression of CXC chemokines andtheir receptors has been reported in several tissues inaddition to the immune system, such as the nervous andendocrine systems (Bajetto et al. 2001; Christophersonand Hromas 2001). In the anterior pituitary gland, Leeet al. (2008) have shown that growth hormone (GH)-producing cells express CXCR4, a CXCL12 receptor,and that the CXCL12/CXCR4 interaction has importantroles in the synthesis and release of GH. We have alsorevealed that CXCL12 and CXCR4 are expressed inS100β-protein-positive cells (non-endocrine cells) ofthe anterior lobe, and that the CXCL12/CXCR4 axisbetween their cells has important functions in the direc-tional extension of cytoplasmic processes and their in-terconnections (Horiguchi et al. 2012). However, little isknown of chemokines and their receptor expressionother than CXCL12/CXCR4. We have thus investigateduncharacterized chemokines and their receptors in theanterior lobe of the pituitary gland.

The anterior pituitary (adenohypophysis) consists of theanterior and the intermediate lobes. The anterior lobe is com-posed of five types of hormone-producing cells, S100β-protein-positive cells (S100β-positive cells), and fenestratedsinusoids (i.e., endothelial cells and pericytes). The analysis ofchemokines and their receptor expression in the anterior lobehas led us to clarify the cell-to-cell interaction and the regula-tion of hormone production. In the present study, we haveexamined whether CXC chemokines are present in therat anterior lobe by analyzing the expression of Cxcrsand their ligand Cxcls and its histology by in situhybridization and immunohistochemistry. In addition tocytokines and their previously identified receptors(Cxcr3 and toll-like receptor 4, Tlr4; Schulthess et al.2009), we have newly found that Cxcl10 and its recep-tor (Cxcr3 and Tlr4) are expressed in the round-typecells, a subpopulation of S100β-positive cells, and ad-renocorticotropic hormone (ACTH)-producing cells, re-spectively, indicating autocrine/paracrine communicationbetween non-endocrine cells and hormone-producing

cells through the interaction of CXCL10/TLR4 andCXCL10/CXCR3.

Materials and methods

Animals

The S100β-green fluorescent protein (GFP) transgenicWistar-crlj strain (S100β-GFP) of rat was generated by inte-grating the reporter gene GFP driven by a rat S100β promoter(Itakura et al. 2007). Adult Wistar rats were purchased fromJapan SLC (Shizuoka, Japan). Eight- to 10-week-old male ratsweighing 250–300 g were given ad libitum access to food andwater and housed under conditions of 12 h light and 12 hdarkness. The rats were killed by exsanguination from theright atrium under deep sodium pentobarbital anesthesia.The present study was approved by the Institutional AnimalCare and Use Committee, Meiji University and by JichiMedical University, based on NIH Guidelines for the Careand Use of Laboratory Animals.

Analysis of transcripts of chemokines and their receptor genesby reverse transcription plus the polymerase chain reaction

Total RNA fractions were prepared with Trizol reagent(Life Technologies, Palo Alto, Calif., USA) from ante-rior pituitary glands of S100β-GFP male rats, the GFP-positive and -negative cell fraction of S100β-GFP malerats, and cultured cells. They were incubated withRNase-free DNase I (1 U/tube; Promega, Madison,Wis., USA). cDNAs were synthesized by a SuperscriptIII reverse transcription kit with oligo-(dT)20 primer(Life Technologies). For the polymerase chain reaction(PCR), 1 μl of the reverse transcription (RT) reactionproduct was added to 9 μl PCR buffer containing 1 μldNTPs (2 mM), 0.1 μl KOD Dash DNA polymerase(2.5U/μl; TOYOBO, Osaka, Japan), and 0.1 μl of eacholigonucleotide primer (10 μM) listed in Table 1. Sam-ples were subjected to 2 min at 94 °C, 30 cycles of30 s at 94 °C, 2 s at 58 °C, 30 s at 74 °C, and then anadditional 7 min at 72 °C in a PTC-200 (MJ Research,Waltham, Mass., USA). The amplified products wereanalyzed on 1.5 % agarose gels and visualized byethidium bromide staining. Negative controls were sub-jected to RT-PCR but with no reverse transcriptase,cDNA, or KOD Dash DNA polymerase and showedno reaction bands.

In situ hybridization and immunohistochemistry

Rats were perfused through the left ventricle with 4 %formaldehyde in 0.05 M phosphate buffer (pH 7.4) for

Cell Tissue Res

5 min under deep sodium pentobarbital anesthesia. Pi-tuitary glands were then excised and immersed in thesame fixative for 24 h at 4 °C, after which the tissueswere immersed for at least 2 days in phosphate buffercontaining 30 % sucrose at 4 °C. A cryostat was usedto obtain frozen sections (8 μm), which were thenmounted on glass slides. In situ hybridization was per-formed with digoxigenin (DIG)-labeled cRNA probes,as described in our previous report (Fujiwara et al.2007a). The DNA fragments were amplified from ratpituitary cDNA by using PCR. Primer sequences forCxcr3, Cxcl10, and Tlr4 are detailed in Table 1. Am-plified cDNA fragments were ligated into the pGEM-Tvector (Promega) and cloned. Gene-specific antisense orsense DIG-labeled cRNA probes were made by meansof the Roche DIG RNA labeling kit (Roche Diagnostics,Penzberg, Germany). DIG-labeled cRNA probe hybridi-zation was performed at 55 °C for 16 h. Visualizationof each type of mRNA was performed with alkaline-phosphatase-conjugated anti-DIG antibody (Roche Diag-nostics) by using 4-nitroblue tetrazolium chloride (NBT)and 5-bromo-4-chloro-3-indolyl phosphate (BCIP; Roche

Diagnostics). For double-staining, after Cxcl10, Cxcr3and Tlr4 mRNAs had been detected by in situ hybrid-ization, the sections were immunostained, as describedin our previous report (Fujiwara et al. 2007b). Primaryantibodies against the following proteins were used forimmunostaining: ACTH, GH, prolactin, thyroid-stimulating hormone β-subunit (TSHβ), luteinizing hor-mone β-subunit (LHβ), and S-100 protein, as reportedpreviously (Yoshida et al. 2011). Absence of an observ-able nonspecific reaction was confirmed by using nor-mal rabbit serum. After being washed with phosphate-buffered saline (PBS), sections were incubated in PBSwith biotinylated anti-rabbit IgG (Vector Laboratories,Burlingame, Calif., USA) for 30 min at 30 °C. TheABC method (Vector Laboratories) was performed with3,3’-diaminobenzidine (Dojindo Laboratories, Kumamo-to, Japan) as the substrate.

Isolation of a subpopulation of S100β-positive cells

Anterior pituitary cells of male S100β-GFP rats weredispersed as described previously (Horiguchi et al.

Table 1 List of primers used forthe polymerase chain reaction inthe analysis of CXC chemokineligands (Cxcl) and their receptors(Cxcr and toll-like receptor 4[Tlr4]) in rat anterior pituitarygland (Gadph D-glyceraldehyde-3-phosphate dehydrogenase as acontrol)

Genes Primer sequence (5′-3′) Product size Genbank accession number

Cxcr1 Forward: CCTGGGGTCTATCCTTGGTT 406 NM_019310

Reverse: AAGCCCAGGATCTCGGTAAT

Cxcr2 Forward: TCTGTTCTTTGCCCTGACCT 415 NM_017183

Reverse: CCCATAGCAGAACAGCATGA

Cxcr3 Forward: GTTTTCGGCTCTGGTCTCTG 565 NM_053415

Reverse: TGCCTGAGGTGACTGACTTG

Cxcr4 Forward: GCCATGGCTGACTGGTACTT 484 NM_022205

Reverse: TCCCCACGTAATACGGTAGC

Cxcr5 Forward: GCCCTGCACAAGATCAATTT 438 NM_053303

Reverse: CCAGCAGAGAAGGAAGATGC

Cxcr6 Forward: GACAGACGTGTTCCTGCTGA 556 NM_001102587

Reverse: GGCAATGTTGAAGGGTGTCT

Cxcr7 Forward: GGTCAGTCTCGTGCAGCATA 495 NM_053352

Reverse: AGCCAACACACCAGGAAGAC

Cxcrl9 Forward: CATTCTCAGCCTTGACTCCA 452 NM_145672

Reverse: GCGCTTGTTGGTAAAGTGGT

Cxcrl10 Forward: TGTCCGCATGTTGAGATCAT 544 NM_139089

Reverse: ATTTGCCATCTCACCTGGAC

Cxcrl11 Forward: CGAGTAACGGCTGTGACAAA 464 NM_182952

Reverse: TCGTGTTATTTGGGGAAAGG

Cxcrl12 Forward: GCTCTGCATCAGTGACGGTA 608 NM_022177

Reverse: GCTCTGGTGGAAGGTTGCTA

Tlr4 Forward: TCAGTGTGGTTGTGGTAGCC 549 NM_019178

Reverse: TCAAGGCTTTTCCATCCAAC

Gadph Forward: CCATCACCATCTTCCAGGAG 457 M_17701

Reverse: TTCAGCTCTGGGATGACCTT

Cell Tissue Res

2010). The dispersed cells were separated into GFP-positive and -negative cells by a cell sorter (MoFloXDP; Beckman Coulter, Fullerton, Calif, USA). GFP-positive cells were plated, in 400 μl Medium 199 withEarle’s salts (Life Technologies), supplemented with 10% fetal bovine serum (Sigma-Aldrich, St. Louis, Mo.,USA), 0.5 U/ml penicillin, and 0.5 μg/ml streptomycin(Life Technologies), onto 8-well glass chamber slides(1 cm2/well; Nalge Nunc International Rochester, N.Y.,USA), which had been coated with laminin substrate(10 μg/cm2 laminin; Millipore, Bedford, Mass., USA).The GFP-positive cells were cultured for 24 h at whichtime the majority of GFP-positive cells showed flattenedand markedly extended cytoplasmic processes (process-type), although a small number of GFP-positive cellsretained their rounded shape (round-type). The round-type cells were removed from the dish with gentlepipetting and collected by centrifugation from the re-trieved medium followed by cultivation again for 24 hin 400 μl medium on laminin-coated 8-well glass. Freshmedium (400 μl) was added to the remaining adheringcells. The round-type cells were then cultured for a totalof 48 h at 37 °C in a humidified atmosphere of 5 %CO2 and 95 % air.

Immunoblot analysis

GFP-positive and negative cells, which had been separated bya cell sorter, and primary cultured cells were washed in PBSand lysed in RIPA buffer (20 mMTRIS, 150 mMNaCl, 2 mMEDTA, 0.1 % v/v SDS, 1% v/v Triton X-100, pH 7.5), and theamount of total protein was estimated by using a bicinchoninicacid (BCA) protein assay kit (Pierce, Rockford, Ill., USA)according to the manufacturer’s instructions. The protein(20 μg) from each sample was separated by 12 % SDS-polyacrylamide gel electrophoresis and then transferred elec-trophoretically to Immobilon-P transfer membrane (Millipore,Bedford, Mass., USA). The membrane was blocked with 5 %(w/v) nonfat dried milk in TBST (50 mM TRIS, 100 mMNaCl, 0.1 % v/v Tween 20, pH 7.4) for 1 h. After beingwashed with TBST, the membrane was incubated overnightwith rabbit polyclonal CXCL10 (1:10,000; Biorbyt, Cam-bridge, UK), rabbit CXCL12 alpha (1:10,000; eBioscience,San Diego, Calif., USA), mouse monoclonal TLR4(0.01 μg/ml; Abcam, Cambridge, Mass., USA), or mousemonoclonal β-actin (0.1 μg/ml; BioVision, Mountain View,Calif., USA) antibodies diluted in Can Get Signal Solution(TOYOBO), followed by washes with TBST, and incubatedfor 1 h with horseradish peroxidase (HRP)-labeled secondaryantibodies (Envision+System-HRP, anti-rabbit and anti-mouse,Dako, Glostrup, Denmark). After being washed again withTBST, specific immunoreactivity was visualized by using aChemiluminescence ECL Plus System (GE Healthcare,

Mississauga, Ont, Canada) with lumi-shot film (Fujifilm, To-kyo, Japan). Each analysis was performed in triplicate.

Immunocytochemistry

Cultured cells fixed with 4 % paraformaldehyde in25 mM phosphate buffer for 20 min at room tempera-ture were first immersed in PBS containing 2 % normalgoat serum for 20 min at 30 °C and then incubatedovernight with anti-rat CXCL10 (1:200; Biorbyt) atroom temperature. After being washed with PBS, cellswere incubated with Alexa-Fluor-568-conjugated goatanti-rabbit IgG diluted to 1:200 in PBS. The absenceof an observable nonspecific reaction was confirmed byusing normal rabbit serum. Cells were scanned via aconfocal laser microscope (FV500; Olympus, Tokyo,Japan).

Results

Expression of Cxcrs and Cxcls in anterior pituitary gland

To narrow Cxcls candidates expressing in the anterior lobe ofthe rat pituitary gland, we first examined the expression ofCxcrs by RT-PCR and confirmed that transcripts of Cxcr3, 4and 7, but not Cxcr1, 2, 5, and 6, were present in the anteriorpituitary (Fig. 1a). We then analyzed the expression of Cxcr3ligands (Cxcl9, 10, and 11), Cxcr 4 (Cxcl11 and 12), andCxcr7 (Cxcl12) ligands. We found Cxcl10 and Cxcl12 to becytokines expressed in the anterior lobe (Fig. 1b). Thus,CXCL10 and its receptor CXCR3 have the potential to actin the anterior lobe, in addition to CXCL12 whose actionshave been investigated previously (Horiguchi et al. 2012).

Localization of Cxcl10 and its receptor in anterior lobe

Cxcl10 mRNA was detected in the anterior lobe by in situhybridization with a DIG-labeled antisense cRNA probe(Fig. 2a, c); no specific signals were observed when sectionswere hybridized with DIG-labeled sense cRNA probes(Fig. 2b). With regard to the histological features of Cxcl10-expressing cells in the rat anterior lobe, only a few werelocated in the marginal layer of the anterior lobe facing theresidual lumen of Rathke’s pouch (Fig. 2d). To identify thecells that expressed Cxcl10, we performed double-staining byin situ hybridization to detect Cxcl10mRNA and immunohis-tochemistry to detect anterior pituitary hormone and S100protein. Cxcl10 mRNA was detected in S100-protein-positive cells (Fig. 2d). A cell sorter was used to isolateS100β-positive cells from male S100β-GFP rat anterior pitu-itary for RT-PCR and Western blotting as described in ourprevious reports (Horiguchi et al. 2010, 2012). CXCL10 was

Cell Tissue Res

detected in GFP-positive cells, which are S100β-positive cellsin the anterior pituitary gland (Fig. 2e, f). However, GFP-negative cells, which include hormone-producing cells,pericytes, and endothelial cells, did not express Cxcl10 andits protein (Fig. 2e, f).

CXCL10 also has at least two receptors, CXCR3 andTLR4 (Schulthess et al. 2009). We examined their gene ex-pression in GFP-positive and -negative cells by RT-PCR.Interestingly, Cxcr3 was expressed in GFP-negative cells,but Tlr4 occurred in GFP-positive cells (Fig. 3a). Using insitu hybridization and immunohistochemistry, we observedthat Cxcr3 mRNA was located in ACTH-producing cells(Fig. 3b, d), whereas Tlr4 was present in S100β-positive cells(Fig. 3e, g). Under the same conditions, a specific signal wasnot detected in sections hybridized with the DIG-labeled sensecRNA probe of Cxcr3 or Tlr4 (Fig. 3c, f).

Localization of CXCL10 in subpopulation of S100β-positivecells

We recently demonstrated that, with reference to theadhesiveness to the culture dish with gentle pipetting,pure GFP-positive cells in primary culture can be

Fig. 1 Expression of CXC chemokine receptors (Cxcr) and their ligands(Cxcl) in the anterior lobe of the pituitary gland. Expression of Cxcrs (a)and Cxcls (b) mRNA in the anterior lobe of adult rats, as determined byreverse transcription plus the polymerase chain reaction (RT-PCR;GadphD-glyceraldehyde-3-phosphate dehydrogenase as a control)

Fig. 2 Localization of CXCL10in the pituitary gland. a In situhybridization for Cxcl10 detectedby antisense probe. Cxcl10mRNAwas detected in theanterior lobe (AL). b In situhybridization for Cxcl10 withsense probe was negative (ILintermediate lobe, PL posteriorlobe). c High-magnificationimage of AL (from a). dCharacterization of Cxcl10-expressing cells in the anteriorlobe. mRNA and protein areshown in blue (NBT/BCIP) andbrown (3,3’-diaminobenzidine),respectively. In situ hybridizationfor Cxcl10 andimmunohistochemistry for S100protein was performed. Cxcl10mRNAwas expressed in S100-protein-positive cells (arrow).Bar 10 μm. e Expression ofCxcl10 (top) in the GFP-negativecell fraction (GFP-) and the GFP-positive cell fraction (GFP+) wasanalyzed by RT-PCR with Gapdh(bottom) as a control. Cxcl10 wasexpressed in GFP+. f CXCL10protein in the GFP-negative cellfraction (GFP-) and the GFP-positive cell fraction (GFP+) wasdetermined by Western blotting.Top CXCL10. Bottom β-Actin asa control

Cell Tissue Res

separated into two types, a process-type (adhesive,Fig. 4a) and a round-type (less-adhesive, Fig. 4b;Horiguchi et al. 2013). The morphology of the round-type was unaltered on the laminin-coated surface after24 h cultivation (data not shown), indicating that theseparation of S100β-positive cells with reference totheir adhesiveness is an easy and effective method foranalyzing these subpopulations. We examined whetherCXCL10 showed a difference in abundance in each ofthe subpopulations of S100β-positive cells. To estimatethe transcripts and translation products of Cxcl10 in theisolated round- and process-types of S100β-positivecells, we performed RT-PCR and Western blotting.CXCL10 and TLR4 were detected in the round-type(Fig. 4c, d) and CXCL12 in the process-type (Fig. 4c,d). Immunocytochemistry for CXCL10 carried out onthe two separate cell types revealed the absence ofCXCL10 in the process-type (Fig. 5a–d), but its pres-ence in the round-type (Fig. 5e–h).

Discussion

In this study, we have found that CXCL10, which isone of the CXC chemokine family members, isexpressed in a subpopulation of S100β-positive cellsin the rat anterior pituitary lobe. We have also

demonstrated that CXCR3 and TLR4 as the CXCL10receptor are expressed in ACTH-producing cells andS100β-positive cells, respectively, showing the possibil-ity of chemokine-mediated cell-cell communication be-tween S100β-positive cells and ACTH-producing cells.

The CXC chemokines promote the trafficking of var-ious leukocytes and contribute to the homing of hema-topoietic progenitors and B lymphocyte development(Mackay 2001; Strieter et al. 2006; Colobran et al.2007). The effects of these chemokines are mediatedthrough seven trans-membrane domain G-protein-coupled receptors, known as the seven CXC receptors(CXCR1-7; Singh et al. 2013). We have previouslyreported that Cxcr4 and Cxcl12 are expressed inS100β-positive cells (Horiguchi et al. 2012). The recentproduction of transgenic rats (S100β-GFP rats) thatexpress GFP specifically in S100β-positive cells in theanterior lobe (Itakura et al. 2007) provides a powerfultool for characterizing S100β-positive cells with morethan 95 % purity by cell sorter (Horiguchi et al. 2010,2012). In the present study, we have further successive-ly demonstrated that S100β-positive cells expressCxcl10 not only by histological methods, but also bio-chemical and molecular biological methods, by usingthis transgenic rat.

CXCL10, also known as interferon-γ (IFN-γ) induc-ible protein 10 kDa (IP-10), is secreted from a variety

Fig. 3 Identification of Cxcl10receptor expression in anterior lobe.Expression of Cxcr3 and Tlr4mRNA in the GFP-negative cellfraction (GFP-) and the GFP-positive cell fraction (GFP+) wasanalyzed by RT-PCR (a) withGapdh as a control. Cxcr3 wasexpressed in GFP-, but Tlr4 wasfound in GFP+. In situhybridization for Cxcr3 (b,antisense probe; c, sense probe) andTlr4 (e, antisense probe; f, senseprobe); Cxcr3 and Tlr4 mRNAwere detected in the anterior lobe.Double-staining by in situhybridization (blue with NBT/BCIP) for Cxcr3 (d) and Tlr4 (g)and by immunohistochemistry(brown with 3,3’-diaminobenzidine) for ACTH (d)and S100 protein (g); Cxcr3 andTlr4mRNAs localized in ACTH-producing cells and S100-protein-positive cells, respectively (d, g,arrows). Bars 10 μm

Cell Tissue Res

of cell types, such as leukocytes, monocytes, endothe-lial cells, stromal cells, and keratinocytes in responseto IFN-γ (Lo et al. 2010). It recruits Th1 lymphocytesto the area of inflammation, and its expression isassociated with Th1 immune responses (Bonecchiet al. 1998; Khan et al. 2000). In addition, Vankelecomet al. (1992) have demonstrated that IFN-γ inhibits therelease of ACTH, GH, and prolactin in the rat anteriorlobe; they have also showed that S100β-positive cellsmediate this inhibitory effect but have not clarified themechanism of the INF-γ-dependent inhibition of thehormone secretion. Accordingly, the present studyleads us to suggest that the down-regulation of ACTHsecretion by IFN-γ might be transduced by theCXCL10/CXCR3 axis. In addition to the action ofCXCL10 on the ACTH cells, it might also act on theS100β-positive cells, since another type of CXCL10receptor (Tlr4) is expressed in the same cells. As

CXCL10 is known to elicit monocytes, T cells, andNK (natural killer) cells, it might attract adjacentS100β-positive cells in the anterior lobe the sameway as observed for CXCL12 (Horiguchi et al.2012). Although further study is necessary to deter-mine the function of CXCL10 in the anterior lobe,our data suggest that CXCL10 is secreted in an auto-crine and/or paracrine fashion in the anterior lobe andmodulates the biological function of hormone-producing cells and S100β-positive cells.

S100β-positive cells were first found in brain (Moore1965) and thereafter in several tissues. They have a star-like appearance and are interconnected by cytoplasmicprocesses and encircle hormone-producing cells or ag-gregate homophilically to form a central lumen in theanterior pituitary (Soji and Herbert 1989). Based onthese histological features, S100β-positive cells in theanterior lobe are usually referred to as folliculo-stellate

Fig. 4 Expression of CXCL10 and CXCL12 in primary cultures ofS100β-positive cell subpopulations. Pure GFP-positive cells in primaryculture can be separated into two types, a process-type and a round-type(Horiguchi et al. 2013). a, b GFP images of cells on laminin-coatedsurface (green, S100β-positive cells). a Incubation for 24 h in primaryculture of S100β-positive cells and further incubation for 2 h afterremoval of round-type S100β-positive cells by pipetting, leaving theprocess-type (Process). b Incubation of the round-type S100β-positive

cells (Round) for 2 h. Bars 100 μm c Expression of Cxcl10, Cxcl12, andTlr4 in the process-type (Process) and round-type (Round) of S100β-positive cells was analyzed by RT-PCR. Cxcl10 and Tlr4 were expressedin the round-type, whereas Cxcl12 was detected in the process-type. dCXCL10, CXCL12, and TLR4 proteins in the process-type (Process) andround-type (Round) were detected by Western blotting. Top panelCXCL10, second panel CXCL12, third panel TLR4, bottom panel β-actin as a control

Cell Tissue Res

cells (Vila-Porcile 1972). However, some S100β-positive cells have subsequently been suggested to actas stem cells, phagocytes, or to regulate hormone re-lease (Inoue et al. 1999; Allaerts and Vankelecom2005). In addition, the gap junctions between S100β-positive cells form an intercellular channel that facili-tates the transmission of ions and small molecules be-tween adjacent cells and that allows direct cell-to-cellcommunication within the anterior lobe (Fauquier et al. 2001).The origin of S100β-positive cells has often been discussedwith respect to the morphological and physiological relevanceof their functionally heterogeneous subpopulations. This het-erogeneity was assumed following the observation of differentmarkers in three subpopulations. A proportion of S100β-positive cells was found to express glial fibrillary acidic pro-tein (GFAP) or/and vimentin (astrocyte-like), and anotherproportion contained keratin (epithelial cell-like) orinterleukin-6 (dendritic-cell-like; Höfler et al. 1984;Tachibana and Yamashima 1988; Allaerts et al. 1996). In aprevious study, we have observed the behavior of S100β-positive cells in primary culture and demonstrated that theyare separated into two types by morphological changes underthe influence of the extracellular matrix, and that the process-type expresses GFAP and vimentin, whereas the round-typeexpresses interleukin-6 (Horiguchi et al. 2013). As is wellknown, Cxcl10 and Tlr4 are expressed in dendritic cells(Visintin et al. 2001; Fujita et al. 2005). These findings con-firm that the process-type is composed of astrocyte- orepithelial-like cells, whereas the round-type is composed of

dendritic-like cells. In addition, only a few of the round-typeare located in the marginal cell layer of the anterior lobe(Fig. 2d). The marginal cell layer faces the residual lumenwith the interstitial fluid between the anterior and posteriorlobes. We suggest that the dendritic-like S100β-positive cellssense inflammation signals through a receptor such as TLR4.

In conclusion, we have found that CXCL10 and its receptorCXCR3 are expressed in the dendritic-like S100β-positivecells and ACTH-producing cells, a finding that suggests thatCXCL10 affects the function of ACTH-producing cells as aparacrine factor. We intend, in future studies, to identify thefunction of CXCL10 and the mechanism of its expression.

Acknowledgments We thank Professor K. Inoue (Saitama University,Japan) for supplying the transgenic rats. We are grateful to K. Tateno(Kyorin University, Japan) for excellent technical assistance and to Pro-fessor Y. Hanazono (Jichi Medical University, Japan) for his generousassistance with fluorescence-activated cell sorting.

References

Allaerts W, Vankelecom H (2005) History and perspectives of pituitaryfolliculo-stellate cell research. Eur J Endocrinol 153:1–12

Allaerts W, Fluitsma DM, Hoefsmit EC, Jeucken PH, Morreau H,Bosman FT, Drexhage HA (1996) Immunohistochemical, morpho-logical and ultrastructural resemblance between dendritic cells andfolliculo-stellate cells in normal human and rat anterior pituitaries. JNeuroendocrinol 8:17–29

Baggiolini M (1998) Chemokines and leukocyte traffic. Nature 392:565–568

Fig. 5 Localization of CXCL10 in a subpopulation of S100β-positivecells. Phase-contrast images (a, e), GFP images (green, S100β-positivecells) (b, f), immunocytochemistry of CXCL10 (red, CXCL10; c, g), and

merged images (d, h) of the process-type (Process; a–d) and the round-type (Round; e–h) of S100β-positive cells. Bar 10 μm

Cell Tissue Res

Bajetto A, Bonavia R, Barbero S, Florio T, Schettini G (2001)Chemokines and their receptors in the central nervous system.Front Neuroendocrinol 22:147–184

Barbieri F, Bajetto A, Stumm R, Pattarozzi A, Porcile C, Zona G,Dorcaratto A, Ravetti JL, Minuto F, Spaziante R, Schettini G,Ferone D, Florio T (2008) Overexpression of stromal cell-derivedfactor 1 and its receptor CXCR4 induces autocrine/paracrine cellproliferation in human pituitary adenomas. Clin Cancer Res 14:5022–5032

Bonecchi R, Bianchi G, Bordignon PP, D'Ambrosio D, Lang R, BorsattiA, Sozzani S, Allavena P, Gray PA, Mantovani A, Sinigaglia F(1998) Differential expression of chemokine receptors and chemo-tactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J ExpMed 187:129–134

Christopherson K 2nd, Hromas R (2001) Chemokine regulation of nor-mal and pathologic immune responses. Stem Cells 19:388–396

Colobran R, Pujol-Borrell R, Armengol MP, Juan M (2007) The chemo-kine network. I. How the genomic organization of chemokinescontains clues for deciphering their functional complexity. ClinExp Immunol 148:208–217

Fauquier T, Guérineau NC, McKinney RA, Bauer K, Mollard P (2001)Folliculostellate cell network: a route for long-distance communica-tion in the anterior pituitary. Proc Natl Acad Sci U S A 98:8891–8896

Fujita H, Asahina A, SugayaM,Nakamura K, Gao P, Fujiwara H, TamakiK (2005) Differential production of Th1- and Th2-type chemokinesby mouse Langerhans cells and splenic dendritic cells. J InvestDermatol 124:343–350

Fujiwara K, Kikuchi M, Takigami S, Kouki T, Yashiro T (2007a)Expression of retinaldehyde dehydrogenase 1 in the anterior pitui-tary glands of adult rats. Cell Tissue Res 329:321–327

Fujiwara K, Maekawa F, Kikuchi M, Takigami S, Yada T, Yashiro T(2007b) Expression of retinaldehyde dehydrogenase (RALDH)2and RALDH3 but not RALDH1 in the developing anterior pituitaryglands of rats. Cell Tissue Res 328:129–135

Höfler H, Denk H, Walter GF (1984) Immunohistochemical demonstra-tion of cytokeratins in endocrine cells of the human pituitary glandand in pituitary adenomas. Virchows Arch A Pathol AnatHistopathol 404:359–368

Horiguchi K, Kikuchi M, Kusumoto K, Fujiwara K, Kouki T, KawanishiK, Yashiro T (2010) Living-cell imaging of transgenic rat anteriorpituitary cells in primary culture reveals novel characteristics offolliculo-stellate cells. J Endocrinol 204:115–123

Horiguchi K, Ilmiawati C, Fujiwara K, Tsukada T, Kikuchi M, Yashiro T(2012) Expression of chemokine CXCL12 and its receptor CXCR4in folliculostellate (FS) cells of the rat anterior pituitary gland: theCXCL12/CXCR4 axis induces interconnection of FS cells.Endocrinology 153:1717–1724

Horiguchi K, Fujiwara K, Yoshida S, Higuchi M, Tsukada T, Kanno N,Yashiro T, Tateno K, Osako S, Kato T, Kato Y (2013) Isolation ofdendritic cell-like S100β-positive cells in rat anterior pituitarygland. Cell Tissue Res. doi:10.1007/s00441-014-1817-9 (in press)

Inoue K, Couch EF, Takano K, Ogawa S (1999) The structure andfunction of folliculo-stellate cells in the anterior pituitary gland.Arch Histol Cytol 62:205–218

Itakura E, Odaira K, Yokoyama K, Osuna M, Hara T, Inoue K (2007)Generation of transgenic rats expressing green fluorescent protein inS-100beta-producing pituitary folliculo-stellate cells and brain as-trocytes. Endocrinology 148:1518–1523

Khan IA,MacLean JA, Lee FS, Casciotti L, DeHaan E, Schwartzman JD,Luster AD (2000) Resolution of ST-segment elevation after strepto-kinase therapy in anterior versus inferior wall myocardial infarction.Clin Cardiol 23:490–494

Lee Y, Kim JM, Lee EJ (2008) Functional expression of CXCR4 insomatotrophs: CXCL12 activates GH gene, GH production andsecretion, and cellular proliferation. J Endocrinol 199:191–199

Lo BK, Yu M, Zloty D, Cowan B, Shapiro J, McElwee KJ (2010)CXCR3/ligands are significantly involved in the tumorigenesis ofbasal cell carcinomas. Am J Pathol 176:2435–2446

Mackay CR (2001) Chemokines: immunology's high impact factors. NatImmunol 2:95–101

Moore BW (1965) A soluble protein characteristic of the nervous system.Biochem Biophys Res Commun 19:739–744

Rajagopal S, Rajagopal K, Lefkowitz RJ (2010) Teaching old receptorsnew tricks: biasing seven-transmembrane receptors. Nat Rev DrugDiscov 9:373–386

Schulthess FT, Paroni F, Sauter NS, Shu L, Ribaux P, Haataja L, StrieterRM, Oberholzer J, King CC, Maedler K (2009) CXCL10 impairsbeta cell function and viability in diabetes through TLR4 signaling.Cell Metab 9:125–139

Singh AK, Arya RK, Trivedi AK, Sanyal S, Baral R, Dormond O,Briscoe DM, Datta D (2013) Chemokine receptor trio: CXCR3,CXCR4 and CXCR7 crosstalk via CXCL11 and CXCL12.Cytokine Growth Factor Rev 24:41–49

Soji T, Herbert DC (1989) Intercellular communication between ratanterior pituitary cells. Anat Rec 224:523–533

Strieter RM, BurdickMD,Mestas J, Gomperts B, KeaneMP, Belperio JA(2006) Cancer CXC chemokine networks and tumour angiogenesis.Eur J Cancer 42:768–778

Tachibana O, Yamashima T (1988) Immunohistochemical study offolliculo-stellate cells in human pituitary adenomas. ActaNeuropathol 76:458–464

Vankelecom H, Andries M, Billiau A, Denef C (1992) Evidence thatfolliculo-stellate cells mediate the inhibitory effect of interferon-gamma on hormone secretion in rat anterior pituitary cell cultures.Endocrinology 130:3537–3546

Vila-Porcile E (1972) The network of the folliculo-stellate cells and thefollicles of the adenohypophysis in the rat (pars distalis). ZZellforsch Mikrosk Anat Histochem 129:328–369

Visintin A, Mazzoni A, Spitzer JH, Wyllie DH, Dower SK, Segal DM(2001) Regulation of Toll-like receptors in human monocytes anddendritic cells. J Immunol 166:249–255

Yoshida S, Kato T, Yako H, Susa T, Cai LY, Osuna M, Inoue K, KatoY (2011) Significant quantitative and qualitative transition inpituitary stem /progenitor cells occurs during the postnatal de-velopment of the rat anterior pituitary. J Neuroendocrinol 23:933–943

Zlotnik A, Yoshie O (2000) Chemokines: a new classification system andtheir role in immunity. Immunity 12:121–127

Cell Tissue Res