D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum...
Transcript of D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum...
![Page 1: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/1.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
1K.C.Singh, H Kudale and
T.Marar
Histopathological and serum enzymes
alterations n rats treated with camptothecin
and prophylactic effect of α tocopherol.
J.Cell and Tissue Res. International 2011 11(3) 2955-2959 0009-2797
2 K.C.Singh and T.Marar ,
Acute toxicity of camptothecin and effect of α
tocopherol on hematological and biochemical
parameters.
J.Cell and Tissue Res. International 2011 11(2) 2833-2837 1816-496X
3 K.C.Singh, R.Kaur and T MararAmeliorative effect of vitamin E on
chemotherapy induced side effects in rat liver. J.Pharmacol. Toxicol International 2011 6(5) 481-492 0973-0028
4 T.MararAmelioration of glucose induced hemolysis of
human erythrocytes by vitamin E
Chemico-Biological
Interactions International 2011 193 149-153 ISSN: 0974-0678
5 A.Singh and T. MararInhibitory effect of extracts of Syzygium
cumini and Psidium guajava on glycosidasesJ.Cell and Tissue Res. International 2011 11 (1) 2535-2539 ISSN: 0974-0678
6
Telke A.A., Kagalkar A.N.,
Desai N.S, Bapat V.A. and S.P.
Govindwar
Biochemical characterization of laccase from
hairy root culture of Brassica juncea L. and
role of redox mediators to enhance its
potential for the decolorization of textile dyes
Planta International 2011 234(6) 1137-1149 0975–3087
7
Palak A. Chaturvedi and
Arindam A. Ghatak, Neetin S.
Desai
Evaluation of radical scavenging potential and
total phenol content in Woodfordia fruticosa
from different altitudes
Journal of Plant Biochemistry
and BiotechnologyNational 2011 21(1) 17-22 0032-0935
8
Hemant K., Meenakshi H.,
Archana P., Abhinav P. Neetin
D.
DNA barcoding in Indian Dipcadi species
JN135362 to JN135381 of cp DNA genes
from genus Dipcadi
GenBank Data base International 2011 2348-0882
9Tareeka S, Namrata C, Jugal U,
Liji T, Dayanand B
Alteration in Testicular Protein following
administration of embelin and vincristine:
Potent Reproductive Toxicant
Journal of cell and tissue
culture researchInternational 2011 11(2) 2815- 2820 0974-0910
10 Vernekar M., and Supali, P
Statistical media optimization for β-
fructofuranosidase production by
Saccharaomyces cerevisiae NCIM 3287
Journal of Cell and Tissue
ResearchInternational 2011 11(2) 2827-2832 ISSN: 0973-6808
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
YEAR 2011
![Page 2: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/2.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
11Mugdha N. Harmalkar and
Pritesh Desai
Comparative Assesment of Antibacterial
Activity of Ginger Extracts with Antimicrobial
Agents
International Journal of
Pharmacology and Biological
Sciences
International 2011 5(2) 33-38 ISSN: 0973-7510
12R. Kamble, S. Venkata and A.
Gupte
Antimicrobial activity of Ganoderma lucidum
mycelia.
Journal of Pure and Applied
MicrobiologyInternational 2011 5(2) 983-986 ISSN: 0022-1155
13 S Ghatge, S Kudale and G Dixit
An improved plant regeneration system for
high frequency multiplication of Rubia
cordifolia L.: A rare medicinal plant
Asian Journal of
BiotechnologyInternational 2011 3(4) 397-402 ISSN-0973-7510
14Neha Dahiya and Priti
Uchgaonkar
Efficacy of Punica granatum L. rind extracts
on gastrointestinal infections
Proceedings of the UGC
sponsored national conference
on current trends in biological
sciences
National 2011 166-169 ISSN-0974-0678
15Priti Uchgaonkar and Neha
Dahiya
Phytochemical Analysis and Antibacterial
Activity of Punica granatum L. rind extracts
on common enteric pathogens
Journal of Pure and Applied
MicrobiologyInternational 2011 5(1) 417-420
ISSN-0973-6808
(Print version)
16 Joshi, N. and Ravindran A.Investigations on chemical mutagen sensitivity
in onion (Allium cepa L.)International J.Botany International 2011 7(3) 243-248 0974-0910
17
Parul Johari,Sagar
Nagare,Venketeshwara Swami,
Chitta Suresh
An insight in to blood clotting disorders
journal of computational
biology and bioinformatics
research
International 2011 3(1) 8-14 ISSN:2141-2227
18Sagar Nagare,Prachiti
Gokhle,Gaurav Singh
System biology approach on role of nf kb
kappa receptor
Proceeding of UGC sponsored
National conference on Bioinf
ormatics and computational
Biology
National 2011 40ISBN:97881-
904926
19
Mandar S Patgaonkar, Ameya
Sathe, C Selvaakumar, K V R
Reddy
A rabbit vaginal cell-derived antimicrobial
peptide, RVFHbαP, blocks lipopolysaccharide-
mediated inflammation in human vaginal cells
in vitro.
Clinical and vaccine
ImmunologyInternational 2011 8(10) 1632-43 1556-6811
20
Sachin Sharma, R D Yedery, M
S Patgaonkar, C Selvaakumar, K
V R Reddy
Antibacterial activity of a synthetic peptide
that mimics the LPS binding domain of Indian
mud crab, Scylla serrata anti-
lipopolysaccharide factor (SsALF) also
involved in the modulation of vaginal immune
functions through NF-kB signaling.
Microbial Pathogenesis International 2011 50 179-191 0882-4010
![Page 3: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/3.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
21 Tagore S, De, R.K.Detecting breakdown points in metabolic
networksComput. Biol. Chem. International 2011 35(6) 371-380 ISSN: 1476-9271
22 Tagore S, Jaju, G.Role of Artifacts in Quantitative Network
AnalysisBIOMIRROR National 2011 2(10) 1-6 ISSN: 0976-9080
23
Gupta, Pramodkumar. P.,
Bastkar Virupaksha A., and Patil
Sonal V
In-silico Design and QSAR Analysis of 2, 5-
Dihydroxy-3-undecyl-1, 4-benzoquinone
Scaffold.
Advances in Pharmacology
and ToxicologyNational 2011 12 (2) 85-94 ISSN: 0973-2381
24 S. S. Nilima and S. JeemitEffect of Hydrogen Peroxide on E. coli and
S. aureus
Journal of Pure and Applied
Microbiology International 2011 5(2) 875-878
25Monali V.Choudhari,Mandalapu
Sarada Devi ,Dr.preeti Bajaj
Driver Drowsiness Detection Using Skin
Color Algorithm and Circular
Hough TransformICETET-11 International 2011 129-134
IEEE-978-0-
7695-4561-5/11
26Monali V.Choudhari,Mandalapu
Sarada Devi Face and facial feature detectionicwet ICWET-11 International 2011 686-689
ISBN-978-1-
4503-0449-8
27Monali V.Choudhari,Mandalapu
Sarada Devi Skin color model for face detection BIONANO FRONTIER National 2011 30-32 ISSN 0974-0678
1
Bilakhia K, D'Souza J, Kudalkar
K, Dasgupta D, Mohite M, Jalan
A
Glutathione as an Indicator of Oxidative
Stress in NeonatesPerinatology International
Jul-Sep
2012.
Vol 13, No.
2, pg 41-45.
2
Manali M. Kocharekar, Sougat
S. Sarkar, Debjani Dasgupta,
Umesh Aigal
A preliminary comparative report of
quantitative buffy coat and modified
quantitative buffy coat with peripheral blood
smear in malaria diagnosis
Pathogens and Global Heath International 2012
vol. 106,
pg 335-339
3Sandip Pawar, Anilkumar
Vaidya, Debjani Dasgupta
In vitro cytotoxixity of traditional herbal
combinations against Human Tumor Cell Line
DWD
Asian Pacific Journal of
Tropical Biomedicine International 2012 1 - 3
4Kiran Narasinha Mahale, Vivek
Kempraj, Debjani Dasgupta
Does the growth temperature of a prokaryote
influence the purine content of its mRNAs? Gene International 202 497 83 - 89 0378-1119
YEAR 2012
![Page 4: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/4.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
5Amita J., Ankita J., Hemant K.,
Neetin S., Anil P., Sanjay D.
Analysis of genetic fidelity of important local
Rice varieties grown in Konkan region of
Maharashtra using RAPD
Bionano Frontiers International 2012 5 (2) 196-198 ISSN 2231-010X
6 Desai N.S. and Mohini Gore
Computer Aided Drug Designing Using
Phytochemicals- Bacoside A3 and Myricetin
and Nitric Oxide Donors- S-Nitroso-N-
Acetylpenicillamine and Nitroglycerin as a
Potential Treatment of Pancreatic Cancer
J Comput Sci Syst Biol International 2012 5 07-Jan 2301-8216
7
Suprasanna P., V. Y. Patade, N.
S. Desai, R. M. Devarumath, P.
G. Kawar, M. C. Pagariya, A.
Ganapathi, M. Manickavasagam,
K. H. Babu
Biotechnological Developments in Sugarcane
Improvement: An OverviewSugar. Tech International 2012 13(4) 322-335 0971-7811
8
Renitta Jobby, Pamela Jha,
Subhash Kudale, Abhilasha Kale
and Neetin Desai
Biodegradation of Textile dyes using soil
bacteria Rhizobium sp
Proceedings of The 5th
Indonesia Biotechnology
conference on Green Industrial
Innovation Through
Biotechnology, held at
Lombok, Indonesia
International 2012 514-518 0975–3087
9 Amita Jain and Desai N.S.
Effect of salt, Heat and Sea water on seed
germination and seedling growth of few
varieties of rice of Konkan region of
Maharashtra (India)
Bionano frontier National 2012 5(2) 182-185 0032-0935
10Neetin D., Hemant K.,
Ghansahm D.
Biosystematics and Evolutionary studies in
Indian Drimia species
Journal of Biosystematics and
EvolutionInternational 2012 50 (6) 512-518
11Kanchanlata Singh and
Thankamani Marar.
Prophylactic role of Vitamin E on
camptothecin induced oxidative stress in the
small intestine of rats.
Journal of Pharmacy Research, International 2012 5(12) 5480-5484 0974-6943
12Kanchanlata Singh ,Veena Pillai
and Thankamani Marar,
Influence of vitamin E on camptothecin
induced oxidant injury-an in vitro study on
erythrocytes.
Journal of Pharmacy Research, International 2012 5(6) 3116-3119
13
Singh Kanchanlata, Malviya
Abha, Bhori Mustansir and
Thankamani Marar.
An in vitro study of the ameliorative role of α-
tocopherol on methotrexate-induced oxidative
stress in rat heart mitochondria.
Journal of Basic & Clinical
Physiology & PharmacologyInternational 2012 23(4) 163-168 0975-8585
![Page 5: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/5.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
14
Ravi Narayan Venkatachalam,
Kanchanlata Singh, Thankamani
Marar.
Bougainvillea spectabilis, a good source of
antioxidant phytochemicals.
Research Journal of
Pharmaceutical, Biological
and Chemical Sciences
International 2012 3(3) 605-613 0975-8585
15
Ravi Narayan Venkatachalam,
Kanchanlata Singh, Thankamani
Marar.
Phytochemical screening and in vitro
antioxidant activity of Psidium guajavaFree Rad. Antiox International 2012 2(1) 31-36 0973-0028
16
Deepa Garg, Ayesha Sheikh,
Aditya Muley, Thankamani
Marar
In-vitro antioxidant activity and
phytochemical analysis in extracts of Hibiscus
rosa-sinensis stem and leaves.
Free Rad.Antiox. International 2012 2 (3) 41-46 0974-6943
17
Deepa Garg, Aditya Muley,
Nishtha Khare, Thankamani
Marar
Comparative Analysis of Phytochemical
Profile and Antioxidant Activity of some
Indian Culinary Herbs.
Research Journal of
Pharmaceutical, Biological
and Chemical Sciences
International 2012 3(3), 845-854
18Singh S, Reddy K S and Jawali
N
Genetic diversity analysis of Mungbean
germplasm Vigna radiata (L. Wilczeck.) by
ISSR
The International Journal of
Plant BreedingInternational 2012 6(2) 73-83 ISSN: 1752-3478
19Tareeka S, Seethlaxmi, Mohit D,
Hiten J, Liji T, Dayanand B
Alteration in gene expression of steroidogenic
pathway of testosterone synthesis in testis of
male rats after embelin treatmnet
Journal of pharmacy research International 2012 5(12) 5520- 5529 0974- 6943
20Mohammed S. K., Mugdha, N.
H and Madhavi R V
Sequential optimization of xylanase
production by an indigenously isolated
Acinetobacter species using solid state
fermentation
International Journal of Food
and Fermentation TechnologyInternational 2012 2(2) 185-195 1930-2126
21Singh D., Vernekar M. and
Harmalkar M
Isolation and Characterization of Xylanase
producing Acinetobacter sp from garbage
dump
International Journal of
Pharmacology and Biological
Sciences
International 2012 6(2) 59-64
22 Bhat M.RMicrobial L- Asparaginase an Enzyme with
Encrypted Potential
JOURNAL OF PURE AND
APPLIED MICROBIOLOGYInternational 2012 6(2) 895-898 ISSN 2277-2502
23 Bhat M.R1, Limaye S.R2Nutrient status and plant growth promoting
potential of prepared vermicompost
INTERNATIONAL
JOURNAL OF
ENVIRONMENTAL
SCIENCES
International 2012 3(1) 312-321
24Vibha Gajbe, Alok Mittal, Vijay
Thakur
Evaluation of adsorption characteristics of an
anionic azo dye Brilliant Yellow onto hen
feathers in aqueous solutions
International 2012 19 (6) 2438-2447
ISSN-1219-4956
(print version)
ISSN-1532-2807
25 Sheetal Sonawadekar Bioremediation: A boon to hydrocarbon
degradation
International Journal of
Environmental SciencesInternational 2012 2(4) 2408-2424 0257-8050
![Page 6: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/6.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
26Rekha Bhagwat, Arpita Gupte
and Yadav K.S.
Diagnostic utility of hs-CRP in coronary heart
disease.
International Journal of
Molecular BiologyInternational 2012 3(1) 36-39 ISSN: 0022-4456
27Manal K., A. M. Gupte and J. S.
Nair
Biosorption of copper using mucilaginous
seeds of Ocimum basilicum .Acta Biologica Indica International 2012 1(1) 113-119
28Arpita Gupte, and Stanislaus F.
D’Souza
Biosorption of Chromium (VI) by
Kluyveromyces fragilis grown on whey.
Proceedings of The fifth
Indonesia Biotechnology
Conference, an International
forum, on Green Industrial
Innovation through
Biotechnology,Indonesia
Biotechnology Consortium,
Mataram, Lombok Island,
Indonesia.
International 2012 624-632 ISSN: 0975-7384
29Pratibha C., Abhay C., Hemant
K.
Molecular characterization of Tylophora
indica regenerated plants in vitro by
RAPD and ISSR analysis
International Journal of
Research in Phytochemistry &
Pharmacology
International 2012 2 (4) 175-179
30 Joshi, N and Sawant, P.
Response of onion (Allium cepa L.) seed
germination and early seedling development
to salt level.
International J. Vegetable
SciencesInternational 2012 13 41707
31 Joshi, N., Purohit, S.D.
Optimization of factors influencing shoot
multiplication during micropropagation of
Chlorophytum borivilianum Sant. Et Fernand
Proc. Natl. Acad. Sci. India,
sect.B Biol. Sci.National 2012 0972-5849
32K V R Reddy, D Sukanya, M S
Patgaonkar, C Selvaakumar
Effect of Rabbit Epididymal Antimicrobial
Peptide, REHbβP, on LPS-Induced
Proinflammatory Cytokine Responses in
Human Vaginal Cells In vitro
International Journal of
PeptidesInternational 2012
DOI:10.1155
/2012/78201
9
1687-9775
33 Tagore S, De, R.K.Structural Grammar-based Automated
Pathway Reconstruction
Interdiscip Sci Comput Life
SciInternational 2012 4(2) 116-27 1913-2751
34 Tagore S, Sarangi, V. Cost Analysis: Its Role in MetabolomicsOpen Access Scientific
ReportsInternational 2012 1 246 0974-7230
35 Tagore S, Varghese, N.J.Community Based Pattern Recognition in
Metabolomics
Open Access Scientific
ReportsInternational 2012 1 247 0974-7230
![Page 7: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/7.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
36 Tagore S, De, R.K.
Automated Reconstruction of Metabolic
Pathways of Homo Sapiens involved in the
Functioning of GAD1 and GAD2 Genes based
on Structural Grammars
Metabolomics: Open Access International 2012 S1 005 2153-0769
37
Bastikar V, Deb R, Gupta PP,
Gupte A, Shah R P, Desai DM
and Gangawane AK
Prediction and Analysis of 3D Structure of
DNA Gyrase Subunit-A as Potential Target
Protein for Bacterial Infection
International Journal of
Biology, Pharmacy and Allied
Sciences (IJBPAS)
International 2012 1(9) 1281-1292. ISSN: 2277-4998
38
Bastikar V, Anjum AA, Gupta
PP, Gpte A, Shah R P, Desai D
M and Gangawane AK
Structure Prediction and Analysis of G-Protein
Coupled Receptors,
International Journal of
Biology, Pharmacy and Allied
Sciences (IJBPAS)
International 2012 1(9) 1258-1269 ISSN: 2277-4998
39Nilima S. Shivale and Avinash
Kumar
Study of Microbial Degradation of Caffeine
from Different Samples of Coffee
Journal of Pure and Applied
MicrobiologyInternational 2012 6(1) 249-256
1Deepali K. Kothekar, Debjani
Dasgupta
Evaluation of in vitro conditions influencing
phosphotidylinositol-specific phospholipase C
production by Staphylococcus aureus ATTCC
9144
International Journal of
Pharma and Bio SciencesInternational Jan-13
4(1): (B) 59-
690975-6299
2
P Jha, R Jobby, S Kudale, N
Modi, A Dhaneshwar and N
Desai
Biodegradation of phenol using hairy roots of
Helianthus annuus L.
International Biodeterioration
and Biodegradation.International 2013 77 106-113
3Jayesh S Anerao, Neetin Desai
and Manjushri A. Deodhar
Karyomorphology of Garcinia Indica
(Thomas-Dupettite) Choisy
Journal of Tropical
AgricultureInternational 2013
51(1-2):140-
1432249-555X
4Jayesh S Anerao, Neetin Desai
and Manjushri A. Deodhar
A comparative study of karyomorphology
among three populations of Garcinia indica
Pakistan Journal of Biological
SciencesInternational 2013 16 (1) 530-535 2249-555X
5 Bandre Anurag and Neetin DeasiOmega3: An Effective Nutritional Dietary
SupplementD Y Patil J of Health Sciences National 2013 1(1) 16-18 1774-0746
6Nishtha K. Singh, Umesh Luthra
and Neetin S Desai
Evaluation of Vitamin B12 Synthesis by
isolated Rhizobium sp. from Sesbania sesban
found in Mumbai and its suburban areas
Indian journal of Applied
ResearchInternational 2013 3(7) 68-72 1094-2912
YEAR 2013
![Page 8: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/8.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
7Nishtha K. Singh, Umesh Luthra
and Neetin S Desai
Phenotypic and Genotypic Characterization of
Rhizobium species isolated from the root
nodules of Sesbania sesban found in Mumbai
and its suburban areas
Indian journal of Applied
ResearchNational 2013 3(7) 60-67 0974-7230
8
Vinayak H. Lokhande, Bhoomi
K. Gor, Neetin S. Desai,
Tukaram D. Nikam & Penna
Suprasanna
Sesuvium portulacastrum , a plant for drought,
salt stress, sand fixation, food and
phytoremediation: A review
Agronomy for sustainable
developmentInternational 2013 33,(2) 329-348 0974-0678
9Arindam A. Ghatak, Palak A.
Chaturvedi and Neetin S. Desai
Indian Grapes Wines: A tential Source of
phenols, polyphenols and antioxidants.
International Journal of Food
PropertiesInternational 2013 17(4) 818–828 0972-1525
10
Tapasya V. Pai, Siddhi Y.
Sawant, Arindam A. Ghatak,
Palak A. Chaturvedi, Arpita M.
Gupte and Neetin S. Desai
Characterisation of Indian Beers : Chemical
composition and antioxidant potential
Journal of Food Science and
TechnologyInternational 2013
DOI
10.1007/s13
197-013-
1152-2
ISSN: 2278-7844
11Deepa Garg*, Ayesha S, Nishtha
K, Thankamani M.
Comparitive evaluation of various total
antioxidant capacity assays applied to
phytochemical compounds of Indian culinary
spices.
International Food Reasearch
JournalInternational 2013 20(4) 1711-1716
12
Kanchanlata Singh, Varsha
Mhatre, Mustansir Bhori and
Thankamani Marar.
Vitamins E and C reduce oxidative stress and
mitochondrial permeability transition caused
by camptothecin – an in vitro study
Toxicological &
Environmental ChemistryInternational 2013 95(4) 646–657
13 Parvathi J. R. and Sunita S Epigenetic and Non-epigenetic Switch
Mechanisms in Escherichia coli
Journal of Pure and Applied
Microbiology International 2013 7 (1) 533-541 ISSN: 0973-7510
14 Parvathi J.R., Sunita S Singh
Probe|31781046|PRIMERF Forward PCR
primer (outermost) 23SP2_F_682 (20b):
CCGACCTGCACGAATGGCGT and
Probe|31781046|PRIMERR Reverse PCR
primer (outermost) 23SP2_R_682 (20b):
CAGTTCTCCAGCGCCCACGG
Genebank International 2013
![Page 9: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/9.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
15 Parvathi J.R., Sunita S Singh
Probe|31778738|PRIMERF Forward PCR
primer (outermost) 23SP1_880
(20b)GGCGAAAAGAACCCCGGCGA and
Probe|31778738|PRIMERR Reverse PCR
primer (outermost) 23SP1 RP (20b):
AGGGGTCGACTCACCCTGCC
Genebank International 2013
16 Parvathi JR and S SinghEscherichia coli strain ATCC 15223 23S
ribosomal RNA gene, partial sequence GenBank: JX869172.1 International 2013
17 Parvathi J.R. and Singh S.D.
Citrobacter freundii ATCC 8090 = MTCC
1658 23S ribosomal RNA gene, partial
sequence. Broad range PCR analysis of 23S
rrn
GenBank: JX869173.1 International 2013
18 Parvathi J.R. and Singh S.D.
Citrobacter koseri strain ATCC 27028 23S
ribosomal RNA gene, partial sequence, ,
Broad range PCR analysis of 23S rrn.
GenBank: JX869174.1 International 2013
19 Parvathi J.R. and Singh S.D.
Klebsiella pneumoniae strain ATCC 33495
23S ribosomal RNA gene, partial
sequence, Broad range PCR analysis of
23S rrn.
GenBank: JX869175.1 International 2013
20 Parvathi J.R. and Singh S.D.
Enterobacter aerogenes strain ATCC 13048
23S ribosomal RNA gene, partial sequence,
Broad range PCR analysis of 23S
GenBank: JX869176.1 International 2013
21 Parvathi J.R. and Singh S.D.
Escherichia coli strain ATCC 15223 23S
ribosomal RNA gene, partial sequence,
Barcoding and Genetic diversity in microbes.
GenBank: KF034790.1 International 2013
22 Parvathi J.R. and Singh S.D. Escherichia coli strain ATCC 25922 23S
ribosomal RNA gene, partial sequence, GenBank: KF034791.1 International 2013
23 Parvathi J. R. and Sunita S Pitfalls of bacterial identification methods
International Journal of
Chemical, Ecological and
Biological Sciences
International 2013 1(1) 169-172 ISSN: 2320-4087
24 Parvathi J.R. and Singh S.D.
Escherichia coli DSM 30083 = JCM 1649
strain ATCC 11775 23S ribosomal RNA gene,
partial sequence, Barcoding and Genetic
diversity in microbes.
GenBank: KF034792.1, International
![Page 10: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/10.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
25 Bhat M.R, Shewade Leena
Isolation and characterization of
microorganisms from mangrove soil of CBD
Belapur creek , Navi Mumbai , MS India
INTERNATIONAL
JOURNAL OF
ENVIRONMENTAL
SCIENCES
International 2013 3(5) 2304-2312 ISSN: 0944-1344
26Vibha Gajbe, Alok Mittal, Vijay
Thakur
Adsorptive removal of toxic azo dye Amido
Black 10B by hen feather
Environmental Science &
Pollution ResearchInternational 2013 20 (1) 260-269
Print: ISSN 0974-
0678 Online:
ISSN 2320-9593
27 J M Patki (J R Tope), S S Pawar Hsp90: Chaperone-me-notPathology and Oncology
ResearchInternational 2013 19 631-640 0976 – 4402
28 Roma Yadav Bhakti MhatreEffect of Diesel Hydrocarbon on growth and
Degration of diesel by Algae Ectocarpus SpPollution Research International 2013 32(3) 583-587
ISSN : 0974-
0678
29 Aditya Kaul Bhakti MhatreIsolation of Diesel degrading microorganisms
from mangroves of Navi Mumbai region.Journal of Ecobiology International 2013 32(2) 105-111 ISSN: 0973-7510
30 Kamble R.B. and Gupte A. M.Isolation and screening of cyclodextrinase
producer from soilGenBank International 2013
Accession
Number :
KF415293
31 A. M. Gupte and J. S. NairBiosorption of copper by the yeast
Kluyveromyces marxianus grown on whey
D Y Patil Journal of Health
sciencesNational 2013 1(1) 35-38 ISSN: 0976-0482
32Vidhate D. A., Thomas J., Gupte
A. M.
Association of IL-6 with Diabetes Mellitus in
Indian population from Navi Mumbai.
International Journal of Recent
Trends in Science and
Technology
National 2013 8(2) 100-102 ISSN: 2319-1244
33Vidhate D. A., Thomas J., Gupte
A. M.
IL-6, an important mediator of obesity based
inflammation.
International Journal of
advanced and innovative
research
International 2013 2 283-286 ISSN: 2301-8216
34S Parte, K Rokade, G Mali and
S Kudale
Biodegradation of sulfonated aromatic amines
by Pseudomonas desmolyticum NCIM 2112
Journal of Chemical and
Pharmaceutical ResearchInternational 2013 5(4) 335-339 ISSN: 1996-0700
35 Joshi, N., Arya, K.and Jain A.Alleviation of salt stress in cucumis sativus L.
through seed priming with calcium chlorideIndian J. Applied Research National 2013 3(11) 22-25 1749-4753
36 Sagar Nagare
Homology modeling ofinternatio GPCR
kinase and its role in genetic oriented
Hypertension
International journal of
multidiciplinary researchNational 2013 1(ii) 49-51 ISSN:2277-9302
![Page 11: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/11.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
37
Faiza Hanif Waghu, Lijin Gopi,
Ram Shankar Barai, Pranay
Ramteke, Bilal Nizami and
Susan Idicula-Thomas
CAMP: Collection of sequences and structures
of antimicrobial peptidesNucleic Acids Research International 2013 42
D1154-
D11580305-1048
38Selvaa kumar c, Sudheer M. M.
Mohammed
An In silico Based Comparison of Drug
Interactions in Wild and Mutant Human β-
tubulin through Docking Studies
Research Journal of
BiotechnologyNational 2013 8 20-29 22278-4535
39Selvaa kumar c, Sudheer M. M.
Mohammed
Identification of Leads from Marine seaweeds
against Human beta tubulin
Letters in Drug design and
DiscoveryInternational 2013 10 67-64 1570-1808
40 P. Padwal & S. KulkarniSurface Morphology of Polyaniline Thin
Films Prepared by RF Plasma Polymerization
International Journal of
Physics and ResearchInternational 2013
3
Issue 129-32 ISSN 2250-0030
41 P. Padwal & S. Kulkarni
Preparation of Aluminium Oxide Film by
Anodic Oxidation and Effect of Plasma
Etching on Its Surface
International Journal of
Applied Engineering and
Technology
International 2013 3 (1) 69-72ISSN: 2277-
212X (Online)
42Padwal P, Kulkarni S and Patil
A
Comparative and Morphological Study of
Anodized Aluminium Oxide Thin Films
Formed at Different Current Densities
International Journal of
Physics and Mathematical
Sciences
International 2013 3 (2) 21-24ISSN: 2277-2111
(Online)
43Padwal P , Kulkarni S and Patil
A
Modification and Morphological Study of
Plasma Etched Aluminium Oxide Thin Film
International Journal of
Physics and Mathematical
Sciences
International 2013 3 (2) 25-28ISSN: 2277-2111
(Online)
44 P.Padwal,
S.V.Madhuskar,S.Kulkarni
Study of Electrical Properties of Polyaniline
Films Prepared by RF Plasma Polymerization
Journal of Applied Physics
(IOSR-JAP)International 2013
3
Issue 359-61 ISSN: 2278-4861
45 Tagore S, De, R.K.
Simulating an infection growth model in
certain healthy metabolic pathways of Homo
sapiens for highlighting their role in Type I
Diabetes Mellitus using re-spread strategy,
feedbacks and sensitivities
PLoS ONE International 2013 8(9) e69724 ISSN: 1932-6203
46 Tagore S, Vijayaraghavan, T.
Carnitine translocase in cardiac cell:
structural, functional and flux balance analysis
in pre-β-oxidation pathway of Homo sapiens
International Journal of
Systems, Algorithms &
Applications
International 2013 3(2) 26-29 ISSN: 2250-3749
47 Tagore S, Chatterjee, A.Implementing Cellular Neural Networks to
Identify Abnormalities in Brain MRI Images
UACEE International Journal
of Artificial Intelligence and
Neural Networks – IJAINN
National 20133
(ICRASE13)60-63 ISSN: 2277-2677
![Page 12: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/12.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
48 Tagore S, Chatterjee, A.
Using Run Length Encoding in Cellular
Neural Networks for detecting abnormalities
in biomedical images in real time
In Proceedings: IEEE - 2nd
Students' Conference on
Engineering and Systems
(SCES 2013)
International 2013 171-174 ISSN: 2277-2679
49Nidhi Sharma, Vivek Gupta,
Vinay Shetty and Ashish RanjanVARYSTIM
International Journal of
Computer Applications International 2013 1 1-3 0975-8887
50
Pramodkumar P. Gupta,
Vishakha Nanavaty and Pranav
Shah
Homology Modeling of MTNR1B and
Insilico Structure Activity Relationship study
of Melatonin analogs for therapeutic
application in Insomnia and Insomnia related
diabetes.
Int Journal of Pharma and
Biological SciencesInternational 2013 4(1): (B) 494 - 506
ISSN: 0975 –
6299
51Parvathi.J.R and Mrinal Sanjog
Gokhale
Collation of data for barcoding and restriction
profiling of ribosomal segments of bacterial
genome
Copyright L-55194/2013 National 2013
52 Bhat MR,Nair JS,Marar T,Extracellur L-asparaginase from Salinicoccus
speciesBionano Frontier National 2013 6(3) 137-139 0974 - 0678
53 Kamble R. B., and Gupte, A. M.
Antimicrobial, Anticholesterol and
Antioxidant activity studies of Ganoderma
lucium mycelia
Proceedings of “Prospects and
Challenges in Biotechnology
and Printing & Packaging
Industry”
International 2013
54 Kamble R. B., and Gupte, A. M. NCBI (Bacterial Sequence - B. oshimensis ) GenBank International 2013
1Manali M. Kocharekar, Sougat
S. Sarkar, Debjani Dasgupta
Comparative Study of Modified Quantitative
Buffy Coat and Two Rapid Tests in
Comparision with Peripheral Blood Smear in
Malaria Diagnosis in Mumbai, India
Journal of Parasitology
ResearchInternational 2014 Pg 1-7
2Priyanka Pushkaraj Vartak and
Debjani Dasgupta
Optimization of culture conditions and media
components for laccase production using
wood rotting fungal isolate
International Journal of
Pharma and Bio SciencesInternational 2014 5(1) (B) 801-809 0975-6299
3
Sandip P, Shreewardhan R,
Sandeepan M, Abhay C, Debjani
D
Phytochemical evaluation and free radical
scavenging potential of Hugonia mystax (L.)
leaf extract
Bionano Frontier National 2014 Vol. 7(2) 3-6 0974-0678
4 Manan D, Debjani D Structural insights of FtsA Bionano Frontier National 2014 Vol.7(2) 42-46 0974-0678
YEAR 2014
![Page 13: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/13.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
5
Arindam A Ghataka, Nishita D
Bhembre , Anisha A Kamath ,
Sneha S Mehta , Michelle R
Mendoncaa, Azriel W D'souza,
Papalk Chaturvedi and Neetin S
Desai
Antiproliferative, antioxidant activity and total
phenolic content of Mitragyna parvifolia
(Roxb.) Korth.
Inter J. of Pharmacy and
Pharmaceutical Sci International 2014 6(4) 632-637 0971-636X
6
Mahajan P.V., Bandre A. , Patil
C., Wagh V., More A . and
Desai N.S
Study of cell therapy assisted regeneration of
cartilage in avascular bone necrosis.
D Y Patil J. of Health
Sciences National 2014 2(1) 41-45 1028-8880
7Amita Jain,Prakurti Sinha and
Neetin Desai
Estimation of flavonoid, phenol content and
antioxidant potential of Indian screw tree
(Helicteres isora l.)
Int. Jr. of Pharm Sci Res International 2014 5( 4) 1320-30
8
Nihal S. Jay S. Priyanka K.
Shilpa N. Thankmani M. Rekha
B,
Comparative studies on anti-diabetic effect of
three medicinal plant leaves extract in alloxan
induced diabetic albino wistar rats:
histological and biochemical analysis.
Bionano Frontier National 2014 7(2) 114-117 0974-0678
9V Jindal, M Bhori, K Singh and
T Marar
A preliminary study on the effect of vitamin E
supplementation towards camptothecin
induced in MCF cell line.
Bionano Frontier National 2014 7(2) 82-85 0974-0678
10Neha S, Bhakti M, Rekha B,
Marar.T
Hepatoprotective effect of Bacopa Monneri
extract on imatinib induced toxicity in chick
embryo.
Bionano Frontier National 2014 7(1) 101-103 0974-0678
11 Bhat MR,Nair JS,Marar T
Optimization of media components and
cultural conditions for extracellular production
of L asparaginase from Salinicoccus species.
Bionano Frontier National 2014 7(1) 5-8 0974-0678
12 Mala P. Arpita G and Sunita SCoccinia grandis (L.) voigt: A chemo profile
study.Bionano Frontier National 2014 7 (2) 108-113 ISSN: 0974-0678
13Mala P. Parvathi JR, Payel D
and Sunita S
mCTAB: A Rapid Plant Genomic DNA
Extraction. 7 (12): 19-24. ISSN: 0974-0678 Bionano Frontier National 2014 7 (12) 19-24 ISSN: 0974-0678
14 Rekha B, Selvaakumar C, Liji T.
Interaction of lignan from Phyllanthus niruri
and their metabolites with estrogen receptors:
an in silico study
Bionano Frontiers National 2014 7(2) 74-76ISSN 0976 –
4402
15 Anuj H C and Madhavi R VIsolation and Characterization of a novel ε-
poly L-lysine producing strain: Bacillus cereusBIONANO FRONTIER National 2014 7(2) 86-89 ISSN: 2277-9396
![Page 14: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/14.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
16Anuj H C , Mugdha, N H.,
Madhavi R V
Optimization of xylanase production by
Aceinetobacter sp. Isolated from garbage
dump
BIONANO FRONTIER National 2014 7(2) 77-81 ISSN: 0973-6808
17Lipika Mishra, Madhavi
Vernekar, Mugdha Harmalkar
Effect of UV and nitrous acid treatment on
production of xylanase enzyme by
Acinetobacter sp
Int. J. Curr. Microbiol. Appl.
SciInternational 2014 3(1) 45-53 ISSN: 0973-0028
18Chande Ashish and Bhat
Manish*
Isolation and Characterization of L-
asparginase producing isolate from
Lonar Lake, Buldhana District, MS, India
Research Journal of Recent
SciencesInternational 2014 3 38-41 ISSN: 0944-1344
19 Jyoti R T, Priyanka S
Crude purification and characterization of
bacteriocins produced by lactic acid bacteria
isolated from vegetables and Indian fermented
food samples.
Bionano Frontier National 2014 7(2) 90-94ISBN 978-9-
3804-2806-2
20 Bhakti Mhatre, Roma KundeBiodegradation of diesel using microbes from
clams(Mertrix Meritrix) shell
ndian Journal of Geo Marine
SciencesNational 2014 43(5) 877-881 0970-9037
21 Reshma K and Arpita GStudies on Ganoderma lucidum mycelia
cultivated on agro based waste.Bionano Frontier National 2014 7(2) 66-68 0974 - 0678
22 Vidhi U and Priti UAntibacterial activity of Origanum vulgare
(Oregano) oilBionano Frontier National 2014 7(2) 47-49 ISSN: 0974-0678
23 Joshi, N. and Srivastav, A.
Salinity induced modulations in growth and
biochemcial traits in callus cultures of Allium
cepa L.
Research J. Pharmaceutical
and Biological Sci.National 2014 5(3) 291-299 2249-555X
24 Matkar,S.Joshi, N. NaCl priming mediated alleviation of salinity
stress in onion (Allium cepa L.)Bionano Frontiers National 2014 7(2) 60-65 1931-5260
25 Ranade R.,Joshi, N.
Effects of ascorbic acid, activated charcoal
and low temperature on oxidative browning in
tissue culture of medicinal plant Barleria
prionitis L
Bionano Frontiers National 2014 7(2) 103-107 1811-9700
26Selvaa kumar c, Sudheer M. M.
Mohammed
An In silico Based Comparison of Drug
Interactions in Wild and Mutant Human β-
tubulin through Docking Studies
Avicenna Journal of Medical
BiotechnologyInternational 2014 6(2) 81-93 2008-2835
27 Deepa Garg*, P.VaidyaEffect of Alcohol on serum lipids,lipoproteins
and lipid peroxidation in AlcoholicsBionano Frontier National 2014 (7) 57-59 2230-9593
28Shine Devarajan, Jeya Sundara
Sharmila
Molecular dynamics study of GM1
ganglioside complex with amyloid β
peptide (Aβ42) in lipid membrane
Journal of Molecular Liquids International 2014 195 59-64 0167-7322
![Page 15: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/15.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
29Tagore S, Chowdhury, N., De,
R.K.
Analyzing methods for Path Mining with
application in MetabolomicsGene International 2014 534 (2014) 125-138 ISSN: 0378-1119
30 Tagore S, Bendre, S.
Stability and fitness analysis of β-catenin Wnt
pathway for exploring roles of certain
potential genes in Alzheimer’s disease
Bionano Frontier National 2014 7 (2) 1-2 ISSN: 0974-0678
31 Tagore S, Sheikh, F.
Analysis of differential gene expressions of
insulin signaling pathway in Type – II
Diabetes mellitus
Bionano Frontier National 2014 7 (2) 69-71 0974-0678
32 Tagore S, Anande, G.
Contact pair-based evolutionary interaction
analysis of carbohydrate metabolism in Homo
sapiens
Bionano Frontier National 2014 7 (2) 72-73 0974-0678
33
Pramodkumar P. Gupta,
Vishakha Nanavaty and Pranav
Shah
Insilico modeling and screening of Daidzein
an isoflavonoid from soya to increase the
binding effect against apoptosis regulator Bcl-
2 protein in breast cancer
Indo American Journal of
Pharmaceutical ResearchInternational 2014 4(04) 1889-1894 ISSN 2231-6876
34 Nilima S and Swati J.Antioxidant and anticancer study of the extract
of neem leaves Bionano Frontier National 2014 7(2) 29 - 31 0974-0678
35
Nilima Shivale, Shernik Shah,
Komal Sampat, Krutika
Deshpande
Broad range activity of sulforaphane extracted
from broccoliBionano Frontier National 2014 7 82 - 85 0974-0678
36
Kritika Braroo, Amit Kumar
Sharma, Mukeshchand Thakur,
Yasar Arfat Kasu, Kanchanlata
Singh and Mustansir Bhori
Colloidal Silver Nanoparticles from Ocimum
sanctum: Synthesis, Separation and Their
Implications on Pathogenic Microorganisms,
Human Keratinocyte Cells, and Allium cepa
Root Tips
Journal of Colloid Science and
Biotechnology International 2014 3 (3) 1 - 8
37Jasnaik Danish I., L. Hariharan,
Pramodkumar Gupta P.
In silico 3D Structure Modeling and Analysis
of Galactoside 2-alpha-L-fucosyltransferase 1
Research & Reviews: A
Journal of Bioinformatics National 2014 1 (3) 2393 - 8722
38Shine Devarajan and Jeya
Sundara Sharmila
Computational Studies of Beta Amyloid
(Aβ42) with p75NTR Receptor: A Novel
Therapeutic Target in Alzheimer's Disease
Advances in Bioinformatics National 2014 2014Article ID
736378
39Bijal Shah, Pramodkumar P.
Gupta
Fragment based homology modeling and
simulation based study of endoglin (CD-105)
from Homo sapiens
International Journal of
Biosciences International 2014 5 (12) 374 - 389
P - 2220 - 6655
E - 2222 - 5234
![Page 16: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/16.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
40Dr. Sunita Singh, Rutuja G. and
Mala P.
Fingerprinting Antioxidant Activities in Stress
Induced Coccinia Grandis L. Voigt
International Journal of
Pharmaceutical Research and
Development
International 2014 6 (8) 52 - 59 0974 - 9446
41 Pramodkumar P. Gupta
Computer Aided Drug Design and Discovery
Economical Approach to Drug Discovery
Industry
Austin Journal of
Biotechnology and
Bioengineering
International 2014 1 (4) 2
42Shine Devarajan and Sharmila
Jeya Sundara
A Conformational Study of GM1 headgroup
with amyloid β (1-42) protein to identify the
molecular specificity and interactions in
Alzheimer's disease
Research Jouornal of
Biotechnology National 2014 9 (12) 36 - 43
43
Pritam kumar Panda, Dinesh
Ibrahim and Pramodkumar P.
Gupta
Computational Modeling and Analysis of
Theoretical Structure of Corneodesmosin
Receptor Protein with Existing
Phytochemicals in Psoriasis
Indian Journal of Fundamental
and Applied Life Sciences International 2014 4 (4) 346 - 355 2231 - 6345
44 K Singh, M Bhori, T Marar
α-Tocopherol mediated amelioration of
camptothecin-induced free radical damage to
avert cardiotoxicities
Human & Experimental
ToxicologyInternational 2014 1-10
45 R. Kamble and A. Gupte
Cyclodextrin Glycosyltransferase production
by alkaliphilic Bacillus SP. Isolated from
Rice Cultivated Soil and Media Optimization
using Taguchi Method
International Journal of
Pharmaceutical Sciences and
Research
International 2014 5 (7) 2754 - 2762 0975 - 8232
46 Mohini Gore & N. S. Desai
Characterization of phytochemicals and
evaluation of anti-cancer potential of Blumea
eriantha DC.
Physiology and Molecular
Biology of Plants International 2014 0971 - 5894
47
S.M. Mallakmir, G.R. Kane,
S.S. Mallakmir, D.A. Vidhate, S.
Deshpande, J. Nadkarni, M.
David, G. Ravindranathan, J.
Shah
A study of Apo lipoprotein 'E' polymorphism
and lipid profile in coronary artery disease
International Journal of Recent
Trends in Science and
Technology
International 2014 11 (2) 234 - 237 2277 - 2812
48Anuj H. Chheda, Madhavi R.
Vernekar
Omproved production of natural food
preservative ε - poly-L-lysine using a novel
producer Bacillus cereus
Food Bioscience International 2014 7 56 - 63 2212 - 4292
49
Sunil Kumar Singh, Ankita
Singh, Ved Prakash & Selvaa
Kumar C
Structure modeling and dynamics driven
mutation and phosphorylation analysis of Beta-
amyloid peptides
Bioinformation International 2014 10 (9) 569 - 574 0973 - 8894
![Page 17: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/17.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
1Chheda A. H. and Vernekar M.
R.
A natural preservative ε - poly-L-lysine:
fermentative production and applications in
food industry
International Food Research
Journal International 2015 22 (1) 23 - 30
2A. H. Chheda and Madhavi
Vernekar
Optimization of Medium Components and
Feeding Strategies for Epsilon Poly-L-Lysine
Production by Streptomyces Noursei NRRL
5126
International Journal of
Pharmaceutical Sciences and
Research
International 2015 6 (5) 1000 - 10E - 09755 - 8232
P - 2320 - 5148
3Amita Jain and Pramodkumar P.
Gupta
In silico Comparative Molecular Docking
Study and Analysis of Glycyrrhizin from
Abrus precatorius (L.) against Antidiabetic
Activity
European Journal of Medicinal
Plants International 2015 6 (4) 212 - 222 2231 - 0894
4 Sunita Singh and Mala ParabFingerprinting Intra - Specific Diversity
Among Coccinia Grandis Landraces
International Journal of Recent
Scientific Research International 2015 6 (3) 3025 - 3032 0976 - 3031
5Dudwadkar S., Parab M. and
Singh S.
Diversity Analysis among few Cucurbitaceae
Using Seed Protein Profile
International Journal of Plant,
Animal and Environmental
Sciences
International 2015 5 (1) 146 - 151 2231 - 4490
6
Dhanashree D. Jagtap,
Divyambari S. Gupte, Madhuri
R. Thakar, Hari Om Singh,
Sudhanshu Pandey, Selvaa
Kumar C., Ramesh S. Paranjape.
Molecular characterization of tetherin/BST-2
gene promoter in Indian HIV infected long
term non progressors
Indian Journal of Human
Genetics International 2015 20 1 - 33
7
Jaykumar J. Chavan, Dhanaji M.
Ghadage, Parthraj R. Kshirsagar
and Shubahs S. Kudale
Optimization of Extraction Techniques and
RP-HPLC Analysis of Antidiabetic and
Anticancer Drug Mangiferin from Roots of
'Saptarangi' (Salacia chinensis L.)
Journal of Liquid
Chromatography and Related
Technologies
International 2015 38 963 - 969
8Subhash Kudale, Swaroopa
Ghatge and Neetin Desai
Quantification of Phytochemicals in hary root
cultures of Rubia cordifolia Linn
International Journal of
Advanced Research (2015)International 2015 3 (3) 903 - 913 2320 - 5407
9
Selvaa Kumar C, Nikhil
Gadewal, Sudheer MM
Mohammed
Seminal role of deletion of amino acid
residues in H1-S2 and S-loop regions in
eukaryotic β-tubulin investigate from docking and
dynamics perspective
Journal of Theoretical Biology International 2015 378 79 - 88
10Manish Bhat and Thankamani
Marar
Cytotoxic Effect of Purified L-asparaginase
from Salinicoccus sp. M KJ997975
International Journal of
Current Microbilogy and
Applied Sciences
International 2015 4 (4) 701 - 712 2319 - 7706
YEAR 2015
![Page 18: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/18.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
11Pritam Kumar Panda, Sneha
Patil, Priyam Patel
In silico Stabolity Analysis and
Phosphorylation Induced Structural
Simulation of Alpha-synuclein in Parkinson's
disease
Research and Reviews : A
Journal of Bioinformatics International 2015 2 (1) 15 - 21 2393 - 8722
12
Tahir Bashir, Mandar
Patgaonkar, Selvaa Kumar C,
Achhelal Pasi, Kudumula
Venkata Rami Reddy
HbAHP-25, an In-Silico Designed Peptide,
Inhibits HIV-1 Entry by Bblocking gp120
Binding to CD4 Receptor
PLOS ONE International 2015 10 (4) 1 - 25
13Anuj H. Chheda, Madhavi R.
Vernekar
Enhancement of ε-poly-L-lysine (ε-PL)
production by a novel producer Bacillus
cereus using metabolic precursors and
glucose feeding
3 Biotech International 2015DOI
10.1007/s
13205-015-
0291-8
14De Payel, Parab Mala, Singh
Sunita
Inter-genus variation analysis in few members
of Cucurbitaceae based on ISSR markers
Biotechnology and
Biotechnical EquipmentInternational 2015
DOI
10.1080/131
02818.2015
1 - 5
15Kinjal Shah, Priyanka Burange,
Sunita Singh
Phytochemical, Antimicrobial and Anti-
Adherence Analysis of Plant and Ayurvedic
Extracts
International Journal of
Applied Biology and
Pharmaceutical Technology
International 2015 6(3) 72 - 79 0976-4550
16Padmadas N, Chellasamy S,
Durairaj S
Identification of Distant Structural Prtholog
and A Possible Evolutionary Linkage of
HSP60 - A Fold Based Approach
International Journal of
Bbioinformatics Research International 2015 7 (1) 313 - 320
0975-3087
E-ISSN:
0975-9115
17 M. R. Bhat, J. S. Nair, T. Marar
Isolation and identification of L-asparaginase
producing salinicoccus SP. M KJ997975
from soil microbial flora
Internation Joournal of
Pharmaceutical Sciences and
Research
International 2015 6 (8) 3599-3605
2320-5148
EISSN:
0975-8232
18
Manasvee Dhanesha,
Kanchanlata Singh, Mustansir
Bhori, Thankamani Marar
Impact of antioxidant supplementation on
toxicity of methotrexate: an in vitro study on
erythrocytes using vitamin E
Asian Journal of
Pharmaceutical and Clinical
Resaerch
International 2015 8 (3) 339-343 0974-2441
19 Garg Deepa, Sheth U, Marar T.
Inhibitory Effect of Allium sativum on Low-
Density Lipoprotein (LDL) Oxidatoin
Induceed by CuSO4In-Vitro
Research Journal of
Pharmaceutical, Biological
and Chemical Sciences
International 2015 6 (3) 1123-1129 0975-8585
20Manish Bhat and Thankamani
Marar
Media Optimization, Extraction and Partial
Characterization of an Orange Pigment from
Salinicoccus sp. MKJ997975
Internation Joournal of Life
Sciences Biotechnology and
Pharma Research
International 2015 4 (2) 85 - 89
![Page 19: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α](https://reader031.fdocument.org/reader031/viewer/2022013120/5ab8f2487f8b9ad5338d6bb0/html5/thumbnails/19.jpg)
Sr.
No.
Name of the authors/ co-
authorsTittle of the paper Name of the Journal
Natio/
InternationalYear Volume
Page
Number
Whether
journal is
indexed? ISSN
D. Y. Patil University, Navi Mumbai
School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614
21J.M. Patki, S. Singh and S.
Mehta
Partial Purification and Characterization of
Phytase from Bacteria Inhabiting the
Mangroves of the Western Coast of India
International Journal of
Current Microbilogy and
Applied Sciences
International 2015 4 (9) 156 - 169 2319-7706
22Deepali K. Kothekar, Debjani
Dasgupta
Differential Action of Bacterial
Phosphatidylinositol-Specific Phospholipases
C on Bovine Erythrocyte Membrane Ghost
Indian Journal of Applied
Research International 2015 5 (7) 42 - 44 2249 - 555X
23Bhakti Mhatre and Thankamani
Marar
Vetting and Comparative Analysis of
Antioxidants and Phytochemicals from
Methanolic, Aqueous and a Popular
Commercial Fruit Juice (Noni) Morinda
Citrifolia L.
Research Journal of
Pharmaceutical, Biological
and Chemical Sciences
International 2015 6 (6) 884 - 890 0975 - 8585
24 J. R. Parvathi and S. Singh
Facile Approaches for Microbial DNA
Extraction: Comparative Study with Colonies
"Picked" from three Different Bacteriological
Mediums
Journal of Pure and Applied
MicrobiologyInternational 2015 9 (3) 1373 - 2378