Download - D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Transcript
Page 1: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

1K.C.Singh, H Kudale and

T.Marar

Histopathological and serum enzymes

alterations n rats treated with camptothecin

and prophylactic effect of α tocopherol.

J.Cell and Tissue Res. International 2011 11(3) 2955-2959 0009-2797

2 K.C.Singh and T.Marar ,

Acute toxicity of camptothecin and effect of α

tocopherol on hematological and biochemical

parameters.

J.Cell and Tissue Res. International 2011 11(2) 2833-2837 1816-496X

3 K.C.Singh, R.Kaur and T MararAmeliorative effect of vitamin E on

chemotherapy induced side effects in rat liver. J.Pharmacol. Toxicol International 2011 6(5) 481-492 0973-0028

4 T.MararAmelioration of glucose induced hemolysis of

human erythrocytes by vitamin E

Chemico-Biological

Interactions International 2011 193 149-153 ISSN: 0974-0678

5 A.Singh and T. MararInhibitory effect of extracts of Syzygium

cumini and Psidium guajava on glycosidasesJ.Cell and Tissue Res. International 2011 11 (1) 2535-2539 ISSN: 0974-0678

6

Telke A.A., Kagalkar A.N.,

Desai N.S, Bapat V.A. and S.P.

Govindwar

Biochemical characterization of laccase from

hairy root culture of Brassica juncea L. and

role of redox mediators to enhance its

potential for the decolorization of textile dyes

Planta International 2011 234(6) 1137-1149 0975–3087

7

Palak A. Chaturvedi and

Arindam A. Ghatak, Neetin S.

Desai

Evaluation of radical scavenging potential and

total phenol content in Woodfordia fruticosa

from different altitudes

Journal of Plant Biochemistry

and BiotechnologyNational 2011 21(1) 17-22 0032-0935

8

Hemant K., Meenakshi H.,

Archana P., Abhinav P. Neetin

D.

DNA barcoding in Indian Dipcadi species

JN135362 to JN135381 of cp DNA genes

from genus Dipcadi

GenBank Data base International 2011 2348-0882

9Tareeka S, Namrata C, Jugal U,

Liji T, Dayanand B

Alteration in Testicular Protein following

administration of embelin and vincristine:

Potent Reproductive Toxicant

Journal of cell and tissue

culture researchInternational 2011 11(2) 2815- 2820 0974-0910

10 Vernekar M., and Supali, P

Statistical media optimization for β-

fructofuranosidase production by

Saccharaomyces cerevisiae NCIM 3287

Journal of Cell and Tissue

ResearchInternational 2011 11(2) 2827-2832 ISSN: 0973-6808

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

YEAR 2011

Page 2: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

11Mugdha N. Harmalkar and

Pritesh Desai

Comparative Assesment of Antibacterial

Activity of Ginger Extracts with Antimicrobial

Agents

International Journal of

Pharmacology and Biological

Sciences

International 2011 5(2) 33-38 ISSN: 0973-7510

12R. Kamble, S. Venkata and A.

Gupte

Antimicrobial activity of Ganoderma lucidum

mycelia.

Journal of Pure and Applied

MicrobiologyInternational 2011 5(2) 983-986 ISSN: 0022-1155

13 S Ghatge, S Kudale and G Dixit

An improved plant regeneration system for

high frequency multiplication of Rubia

cordifolia L.: A rare medicinal plant

Asian Journal of

BiotechnologyInternational 2011 3(4) 397-402 ISSN-0973-7510

14Neha Dahiya and Priti

Uchgaonkar

Efficacy of Punica granatum L. rind extracts

on gastrointestinal infections

Proceedings of the UGC

sponsored national conference

on current trends in biological

sciences

National 2011 166-169 ISSN-0974-0678

15Priti Uchgaonkar and Neha

Dahiya

Phytochemical Analysis and Antibacterial

Activity of Punica granatum L. rind extracts

on common enteric pathogens

Journal of Pure and Applied

MicrobiologyInternational 2011 5(1) 417-420

ISSN-0973-6808

(Print version)

16 Joshi, N. and Ravindran A.Investigations on chemical mutagen sensitivity

in onion (Allium cepa L.)International J.Botany International 2011 7(3) 243-248 0974-0910

17

Parul Johari,Sagar

Nagare,Venketeshwara Swami,

Chitta Suresh

An insight in to blood clotting disorders

journal of computational

biology and bioinformatics

research

International 2011 3(1) 8-14 ISSN:2141-2227

18Sagar Nagare,Prachiti

Gokhle,Gaurav Singh

System biology approach on role of nf kb

kappa receptor

Proceeding of UGC sponsored

National conference on Bioinf

ormatics and computational

Biology

National 2011 40ISBN:97881-

904926

19

Mandar S Patgaonkar, Ameya

Sathe, C Selvaakumar, K V R

Reddy

A rabbit vaginal cell-derived antimicrobial

peptide, RVFHbαP, blocks lipopolysaccharide-

mediated inflammation in human vaginal cells

in vitro.

Clinical and vaccine

ImmunologyInternational 2011 8(10) 1632-43 1556-6811

20

Sachin Sharma, R D Yedery, M

S Patgaonkar, C Selvaakumar, K

V R Reddy

Antibacterial activity of a synthetic peptide

that mimics the LPS binding domain of Indian

mud crab, Scylla serrata anti-

lipopolysaccharide factor (SsALF) also

involved in the modulation of vaginal immune

functions through NF-kB signaling.

Microbial Pathogenesis  International 2011 50 179-191 0882-4010

Page 3: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

21 Tagore S, De, R.K.Detecting breakdown points in metabolic

networksComput. Biol. Chem. International 2011 35(6) 371-380 ISSN: 1476-9271

22 Tagore S, Jaju, G.Role of Artifacts in Quantitative Network

AnalysisBIOMIRROR National 2011 2(10) 1-6 ISSN: 0976-9080

23

Gupta, Pramodkumar. P.,

Bastkar Virupaksha A., and Patil

Sonal V

In-silico Design and QSAR Analysis of 2, 5-

Dihydroxy-3-undecyl-1, 4-benzoquinone

Scaffold.

Advances in Pharmacology

and ToxicologyNational 2011 12 (2) 85-94 ISSN: 0973-2381

24 S. S. Nilima and S. JeemitEffect of Hydrogen Peroxide on E. coli and

S. aureus

Journal of Pure and Applied

Microbiology International 2011 5(2) 875-878

25Monali V.Choudhari,Mandalapu

Sarada Devi ,Dr.preeti Bajaj

Driver Drowsiness Detection Using Skin

Color Algorithm and Circular

Hough TransformICETET-11 International 2011 129-134

IEEE-978-0-

7695-4561-5/11

26Monali V.Choudhari,Mandalapu

Sarada Devi Face and facial feature detectionicwet ICWET-11 International 2011 686-689

ISBN-978-1-

4503-0449-8

27Monali V.Choudhari,Mandalapu

Sarada Devi Skin color model for face detection BIONANO FRONTIER National 2011 30-32 ISSN 0974-0678

1

Bilakhia K, D'Souza J, Kudalkar

K, Dasgupta D, Mohite M, Jalan

A

Glutathione as an Indicator of Oxidative

Stress in NeonatesPerinatology International

Jul-Sep

2012.

Vol 13, No.

2, pg 41-45.

2

Manali M. Kocharekar, Sougat

S. Sarkar, Debjani Dasgupta,

Umesh Aigal

A preliminary comparative report of

quantitative buffy coat and modified

quantitative buffy coat with peripheral blood

smear in malaria diagnosis

Pathogens and Global Heath International 2012

vol. 106,

pg 335-339

3Sandip Pawar, Anilkumar

Vaidya, Debjani Dasgupta

In vitro cytotoxixity of traditional herbal

combinations against Human Tumor Cell Line

DWD

Asian Pacific Journal of

Tropical Biomedicine International 2012 1 - 3

4Kiran Narasinha Mahale, Vivek

Kempraj, Debjani Dasgupta

Does the growth temperature of a prokaryote

influence the purine content of its mRNAs? Gene International 202 497 83 - 89 0378-1119

YEAR 2012

Page 4: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

5Amita J., Ankita J., Hemant K.,

Neetin S., Anil P., Sanjay D.

Analysis of genetic fidelity of important local

Rice varieties grown in Konkan region of

Maharashtra using RAPD

Bionano Frontiers International 2012 5 (2) 196-198 ISSN 2231-010X

6 Desai N.S. and Mohini Gore

Computer Aided Drug Designing Using

Phytochemicals- Bacoside A3 and Myricetin

and Nitric Oxide Donors- S-Nitroso-N-

Acetylpenicillamine and Nitroglycerin as a

Potential Treatment of Pancreatic Cancer

J Comput Sci Syst Biol International 2012 5 07-Jan 2301-8216

7

Suprasanna P., V. Y. Patade, N.

S. Desai, R. M. Devarumath, P.

G. Kawar, M. C. Pagariya, A.

Ganapathi, M. Manickavasagam,

K. H. Babu

Biotechnological Developments in Sugarcane

Improvement: An OverviewSugar. Tech International 2012 13(4) 322-335 0971-7811

8

Renitta Jobby, Pamela Jha,

Subhash Kudale, Abhilasha Kale

and Neetin Desai

Biodegradation of Textile dyes using soil

bacteria Rhizobium sp

Proceedings of The 5th

Indonesia Biotechnology

conference on Green Industrial

Innovation Through

Biotechnology, held at

Lombok, Indonesia

International 2012 514-518 0975–3087

9 Amita Jain and Desai N.S.

Effect of salt, Heat and Sea water on seed

germination and seedling growth of few

varieties of rice of Konkan region of

Maharashtra (India)

Bionano frontier National 2012 5(2) 182-185 0032-0935

10Neetin D., Hemant K.,

Ghansahm D.

Biosystematics and Evolutionary studies in

Indian Drimia species

Journal of Biosystematics and

EvolutionInternational 2012 50 (6) 512-518

11Kanchanlata Singh and

Thankamani Marar.

Prophylactic role of Vitamin E on

camptothecin induced oxidative stress in the

small intestine of rats.

Journal of Pharmacy Research, International 2012 5(12) 5480-5484 0974-6943

12Kanchanlata Singh ,Veena Pillai

and Thankamani Marar,

Influence of vitamin E on camptothecin

induced oxidant injury-an in vitro study on

erythrocytes.

Journal of Pharmacy Research, International 2012 5(6) 3116-3119

13

Singh Kanchanlata, Malviya

Abha, Bhori Mustansir and

Thankamani Marar.

An in vitro study of the ameliorative role of α-

tocopherol on methotrexate-induced oxidative

stress in rat heart mitochondria.

Journal of Basic & Clinical

Physiology & PharmacologyInternational 2012 23(4) 163-168 0975-8585

Page 5: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

14

Ravi Narayan Venkatachalam,

Kanchanlata Singh, Thankamani

Marar.

Bougainvillea spectabilis, a good source of

antioxidant phytochemicals.

Research Journal of

Pharmaceutical, Biological

and Chemical Sciences

International 2012 3(3) 605-613 0975-8585

15

Ravi Narayan Venkatachalam,

Kanchanlata Singh, Thankamani

Marar.

Phytochemical screening and in vitro

antioxidant activity of Psidium guajavaFree Rad. Antiox International 2012 2(1) 31-36 0973-0028

16

Deepa Garg, Ayesha Sheikh,

Aditya Muley, Thankamani

Marar

In-vitro antioxidant activity and

phytochemical analysis in extracts of Hibiscus

rosa-sinensis stem and leaves.

Free Rad.Antiox. International 2012 2 (3) 41-46 0974-6943

17

Deepa Garg, Aditya Muley,

Nishtha Khare, Thankamani

Marar

Comparative Analysis of Phytochemical

Profile and Antioxidant Activity of some

Indian Culinary Herbs.

Research Journal of

Pharmaceutical, Biological

and Chemical Sciences

International 2012 3(3), 845-854

18Singh S, Reddy K S and Jawali

N

Genetic diversity analysis of Mungbean

germplasm Vigna radiata (L. Wilczeck.) by

ISSR

The International Journal of

Plant BreedingInternational 2012 6(2) 73-83 ISSN: 1752-3478

19Tareeka S, Seethlaxmi, Mohit D,

Hiten J, Liji T, Dayanand B

Alteration in gene expression of steroidogenic

pathway of testosterone synthesis in testis of

male rats after embelin treatmnet

Journal of pharmacy research International 2012 5(12) 5520- 5529 0974- 6943

20Mohammed S. K., Mugdha, N.

H and Madhavi R V

Sequential optimization of xylanase

production by an indigenously isolated

Acinetobacter species using solid state

fermentation

International Journal of Food

and Fermentation TechnologyInternational 2012 2(2) 185-195 1930-2126

21Singh D., Vernekar M. and

Harmalkar M

Isolation and Characterization of Xylanase

producing Acinetobacter sp from garbage

dump

International Journal of

Pharmacology and Biological

Sciences

International 2012 6(2) 59-64

22 Bhat M.RMicrobial L- Asparaginase an Enzyme with

Encrypted Potential

JOURNAL OF PURE AND

APPLIED MICROBIOLOGYInternational 2012 6(2) 895-898 ISSN 2277-2502

23 Bhat M.R1, Limaye S.R2Nutrient status and plant growth promoting

potential of prepared vermicompost

INTERNATIONAL

JOURNAL OF

ENVIRONMENTAL

SCIENCES

International 2012 3(1) 312-321

24Vibha Gajbe, Alok Mittal, Vijay

Thakur

Evaluation of adsorption characteristics of an

anionic azo dye Brilliant Yellow onto hen

feathers in aqueous solutions

International 2012 19 (6) 2438-2447

ISSN-1219-4956

(print version)

ISSN-1532-2807

25 Sheetal Sonawadekar Bioremediation: A boon to hydrocarbon

degradation

International Journal of

Environmental SciencesInternational 2012 2(4) 2408-2424 0257-8050

Page 6: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

26Rekha Bhagwat, Arpita Gupte

and Yadav K.S.

Diagnostic utility of hs-CRP in coronary heart

disease.

International Journal of

Molecular BiologyInternational 2012 3(1) 36-39 ISSN: 0022-4456

27Manal K., A. M. Gupte and J. S.

Nair

Biosorption of copper using mucilaginous

seeds of Ocimum basilicum .Acta Biologica Indica International 2012 1(1) 113-119

28Arpita Gupte, and Stanislaus F.

D’Souza

Biosorption of Chromium (VI) by

Kluyveromyces fragilis grown on whey.

Proceedings of The fifth

Indonesia Biotechnology

Conference, an International

forum, on Green Industrial

Innovation through

Biotechnology,Indonesia

Biotechnology Consortium,

Mataram, Lombok Island,

Indonesia.

International 2012 624-632 ISSN: 0975-7384

29Pratibha C., Abhay C., Hemant

K.

Molecular characterization of Tylophora

indica regenerated plants in vitro by

RAPD and ISSR analysis

International Journal of

Research in Phytochemistry &

Pharmacology

International 2012 2 (4) 175-179

30 Joshi, N and Sawant, P.

Response of onion (Allium cepa L.) seed

germination and early seedling development

to salt level.

International J. Vegetable

SciencesInternational 2012 13 41707

31 Joshi, N., Purohit, S.D.

Optimization of factors influencing shoot

multiplication during micropropagation of

Chlorophytum borivilianum Sant. Et Fernand

Proc. Natl. Acad. Sci. India,

sect.B Biol. Sci.National 2012 0972-5849

32K V R Reddy, D Sukanya, M S

Patgaonkar, C Selvaakumar

Effect of Rabbit Epididymal Antimicrobial

Peptide, REHbβP, on LPS-Induced

Proinflammatory Cytokine Responses in

Human Vaginal Cells In vitro

International Journal of

PeptidesInternational 2012

DOI:10.1155

/2012/78201

9

1687-9775

33 Tagore S, De, R.K.Structural Grammar-based Automated

Pathway Reconstruction

Interdiscip Sci Comput Life

SciInternational 2012 4(2) 116-27 1913-2751

34 Tagore S, Sarangi, V. Cost Analysis: Its Role in MetabolomicsOpen Access Scientific

ReportsInternational 2012 1 246 0974-7230

35 Tagore S, Varghese, N.J.Community Based Pattern Recognition in

Metabolomics

Open Access Scientific

ReportsInternational 2012 1 247 0974-7230

Page 7: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

36 Tagore S, De, R.K.

Automated Reconstruction of Metabolic

Pathways of Homo Sapiens involved in the

Functioning of GAD1 and GAD2 Genes based

on Structural Grammars

Metabolomics: Open Access International 2012 S1 005 2153-0769

37

Bastikar V, Deb R, Gupta PP,

Gupte A, Shah R P, Desai DM

and Gangawane AK

Prediction and Analysis of 3D Structure of

DNA Gyrase Subunit-A as Potential Target

Protein for Bacterial Infection

International Journal of

Biology, Pharmacy and Allied

Sciences (IJBPAS)

International 2012 1(9) 1281-1292. ISSN: 2277-4998

38

Bastikar V, Anjum AA, Gupta

PP, Gpte A, Shah R P, Desai D

M and Gangawane AK

Structure Prediction and Analysis of G-Protein

Coupled Receptors,

International Journal of

Biology, Pharmacy and Allied

Sciences (IJBPAS)

International 2012 1(9) 1258-1269 ISSN: 2277-4998

39Nilima S. Shivale and Avinash

Kumar

Study of Microbial Degradation of Caffeine

from Different Samples of Coffee

Journal of Pure and Applied

MicrobiologyInternational 2012 6(1) 249-256

1Deepali K. Kothekar, Debjani

Dasgupta

Evaluation of in vitro conditions influencing

phosphotidylinositol-specific phospholipase C

production by Staphylococcus aureus ATTCC

9144

International Journal of

Pharma and Bio SciencesInternational Jan-13

4(1): (B) 59-

690975-6299

2

P Jha, R Jobby, S Kudale, N

Modi, A Dhaneshwar and N

Desai

Biodegradation of phenol using hairy roots of

Helianthus annuus L.

International Biodeterioration

and Biodegradation.International 2013 77 106-113

3Jayesh S Anerao, Neetin Desai

and Manjushri A. Deodhar

Karyomorphology of Garcinia Indica

(Thomas-Dupettite) Choisy

Journal of Tropical

AgricultureInternational 2013

51(1-2):140-

1432249-555X

4Jayesh S Anerao, Neetin Desai

and Manjushri A. Deodhar

A comparative study of karyomorphology

among three populations of Garcinia indica

Pakistan Journal of Biological

SciencesInternational 2013 16 (1) 530-535 2249-555X

5 Bandre Anurag and Neetin DeasiOmega3: An Effective Nutritional Dietary

SupplementD Y Patil J of Health Sciences National 2013 1(1) 16-18 1774-0746

6Nishtha K. Singh, Umesh Luthra

and Neetin S Desai

Evaluation of Vitamin B12 Synthesis by

isolated Rhizobium sp. from Sesbania sesban

found in Mumbai and its suburban areas

Indian journal of Applied

ResearchInternational 2013 3(7) 68-72 1094-2912

YEAR 2013

Page 8: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

7Nishtha K. Singh, Umesh Luthra

and Neetin S Desai

Phenotypic and Genotypic Characterization of

Rhizobium species isolated from the root

nodules of Sesbania sesban found in Mumbai

and its suburban areas

Indian journal of Applied

ResearchNational 2013 3(7) 60-67 0974-7230

8

Vinayak H. Lokhande, Bhoomi

K. Gor, Neetin S. Desai,

Tukaram D. Nikam & Penna

Suprasanna

Sesuvium portulacastrum , a plant for drought,

salt stress, sand fixation, food and

phytoremediation: A review

Agronomy for sustainable

developmentInternational 2013 33,(2) 329-348 0974-0678

9Arindam A. Ghatak, Palak A.

Chaturvedi and Neetin S. Desai

Indian Grapes Wines: A tential Source of

phenols, polyphenols and antioxidants.

International Journal of Food

PropertiesInternational 2013 17(4) 818–828 0972-1525

10

Tapasya V. Pai, Siddhi Y.

Sawant, Arindam A. Ghatak,

Palak A. Chaturvedi, Arpita M.

Gupte and Neetin S. Desai

Characterisation of Indian Beers : Chemical

composition and antioxidant potential

Journal of Food Science and

TechnologyInternational 2013

DOI

10.1007/s13

197-013-

1152-2

ISSN: 2278-7844

11Deepa Garg*, Ayesha S, Nishtha

K, Thankamani M.

Comparitive evaluation of various total

antioxidant capacity assays applied to

phytochemical compounds of Indian culinary

spices.

International Food Reasearch

JournalInternational 2013 20(4) 1711-1716

12

Kanchanlata Singh, Varsha

Mhatre, Mustansir Bhori and

Thankamani Marar.

Vitamins E and C reduce oxidative stress and

mitochondrial permeability transition caused

by camptothecin – an in vitro study

Toxicological &

Environmental ChemistryInternational 2013 95(4) 646–657

13 Parvathi J. R. and Sunita S Epigenetic and Non-epigenetic Switch

Mechanisms in Escherichia coli

Journal of Pure and Applied

Microbiology International 2013 7 (1) 533-541 ISSN: 0973-7510

14 Parvathi J.R., Sunita S Singh

Probe|31781046|PRIMERF Forward PCR

primer (outermost) 23SP2_F_682 (20b):

CCGACCTGCACGAATGGCGT and

Probe|31781046|PRIMERR Reverse PCR

primer (outermost) 23SP2_R_682 (20b):

CAGTTCTCCAGCGCCCACGG

Genebank International 2013

Page 9: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

15 Parvathi J.R., Sunita S Singh

Probe|31778738|PRIMERF Forward PCR

primer (outermost) 23SP1_880

(20b)GGCGAAAAGAACCCCGGCGA and

Probe|31778738|PRIMERR Reverse PCR

primer (outermost) 23SP1 RP (20b):

AGGGGTCGACTCACCCTGCC

Genebank International 2013

16 Parvathi JR and S SinghEscherichia coli strain ATCC 15223 23S

ribosomal RNA gene, partial sequence GenBank: JX869172.1 International 2013

17 Parvathi J.R. and Singh S.D.

Citrobacter freundii ATCC 8090 = MTCC

1658 23S ribosomal RNA gene, partial

sequence. Broad range PCR analysis of 23S

rrn

GenBank: JX869173.1 International 2013

18 Parvathi J.R. and Singh S.D.

Citrobacter koseri strain ATCC 27028 23S

ribosomal RNA gene, partial sequence, ,

Broad range PCR analysis of 23S rrn.

GenBank: JX869174.1 International 2013

19 Parvathi J.R. and Singh S.D.

Klebsiella pneumoniae strain ATCC 33495

23S ribosomal RNA gene, partial

sequence, Broad range PCR analysis of

23S rrn.

GenBank: JX869175.1 International 2013

20 Parvathi J.R. and Singh S.D.

Enterobacter aerogenes strain ATCC 13048

23S ribosomal RNA gene, partial sequence,

Broad range PCR analysis of 23S

GenBank: JX869176.1 International 2013

21 Parvathi J.R. and Singh S.D.

Escherichia coli strain ATCC 15223 23S

ribosomal RNA gene, partial sequence,

Barcoding and Genetic diversity in microbes.

GenBank: KF034790.1 International 2013

22 Parvathi J.R. and Singh S.D. Escherichia coli strain ATCC 25922 23S

ribosomal RNA gene, partial sequence, GenBank: KF034791.1 International 2013

23 Parvathi J. R. and Sunita S Pitfalls of bacterial identification methods

International Journal of

Chemical, Ecological and

Biological Sciences

International 2013 1(1) 169-172 ISSN: 2320-4087

24 Parvathi J.R. and Singh S.D.

Escherichia coli DSM 30083 = JCM 1649

strain ATCC 11775 23S ribosomal RNA gene,

partial sequence, Barcoding and Genetic

diversity in microbes.

GenBank: KF034792.1, International

Page 10: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

25 Bhat M.R, Shewade Leena

Isolation and characterization of

microorganisms from mangrove soil of CBD

Belapur creek , Navi Mumbai , MS India

INTERNATIONAL

JOURNAL OF

ENVIRONMENTAL

SCIENCES

International 2013 3(5) 2304-2312 ISSN: 0944-1344

26Vibha Gajbe, Alok Mittal, Vijay

Thakur

Adsorptive removal of toxic azo dye Amido

Black 10B by hen feather

Environmental Science &

Pollution ResearchInternational 2013 20 (1) 260-269

Print: ISSN 0974-

0678 Online:

ISSN 2320-9593

27 J M Patki (J R Tope), S S Pawar Hsp90: Chaperone-me-notPathology and Oncology

ResearchInternational 2013 19 631-640 0976 – 4402

28 Roma Yadav Bhakti MhatreEffect of Diesel Hydrocarbon on growth and

Degration of diesel by Algae Ectocarpus SpPollution Research International 2013 32(3) 583-587

ISSN : 0974-

0678

29 Aditya Kaul Bhakti MhatreIsolation of Diesel degrading microorganisms

from mangroves of Navi Mumbai region.Journal of Ecobiology International 2013 32(2) 105-111 ISSN: 0973-7510

30 Kamble R.B. and Gupte A. M.Isolation and screening of cyclodextrinase

producer from soilGenBank International 2013

Accession

Number :

KF415293

31 A. M. Gupte and J. S. NairBiosorption of copper by the yeast

Kluyveromyces marxianus grown on whey

D Y Patil Journal of Health

sciencesNational 2013 1(1) 35-38 ISSN: 0976-0482

32Vidhate D. A., Thomas J., Gupte

A. M.

Association of IL-6 with Diabetes Mellitus in

Indian population from Navi Mumbai.

International Journal of Recent

Trends in Science and

Technology

National 2013 8(2) 100-102 ISSN: 2319-1244

33Vidhate D. A., Thomas J., Gupte

A. M.

IL-6, an important mediator of obesity based

inflammation.

International Journal of

advanced and innovative

research

International 2013 2 283-286 ISSN: 2301-8216

34S Parte, K Rokade, G Mali and

S Kudale

Biodegradation of sulfonated aromatic amines

by Pseudomonas desmolyticum NCIM 2112

Journal of Chemical and

Pharmaceutical ResearchInternational 2013 5(4) 335-339 ISSN: 1996-0700

35 Joshi, N., Arya, K.and Jain A.Alleviation of salt stress in cucumis sativus L.

through seed priming with calcium chlorideIndian J. Applied Research National 2013 3(11) 22-25 1749-4753

36 Sagar Nagare

Homology modeling ofinternatio GPCR

kinase and its role in genetic oriented

Hypertension

International journal of

multidiciplinary researchNational 2013 1(ii) 49-51 ISSN:2277-9302

Page 11: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

37

Faiza Hanif Waghu, Lijin Gopi,

Ram Shankar Barai, Pranay

Ramteke, Bilal Nizami and

Susan Idicula-Thomas

CAMP: Collection of sequences and structures

of antimicrobial peptidesNucleic Acids Research International 2013 42

D1154-

D11580305-1048

38Selvaa kumar c, Sudheer M. M.

Mohammed

An In silico Based Comparison of Drug

Interactions in Wild and Mutant Human β-

tubulin through Docking Studies

Research Journal of

BiotechnologyNational 2013 8 20-29 22278-4535

39Selvaa kumar c, Sudheer M. M.

Mohammed

Identification of Leads from Marine seaweeds

against Human beta tubulin

Letters in Drug design and

DiscoveryInternational 2013 10 67-64 1570-1808

40 P. Padwal & S. KulkarniSurface Morphology of Polyaniline Thin

Films Prepared by RF Plasma Polymerization

International Journal of

Physics and ResearchInternational 2013

3

Issue 129-32 ISSN 2250-0030

41 P. Padwal & S. Kulkarni

Preparation of Aluminium Oxide Film by

Anodic Oxidation and Effect of Plasma

Etching on Its Surface

International Journal of

Applied Engineering and

Technology

International 2013 3 (1) 69-72ISSN: 2277-

212X (Online)

42Padwal P, Kulkarni S and Patil

A

Comparative and Morphological Study of

Anodized Aluminium Oxide Thin Films

Formed at Different Current Densities

International Journal of

Physics and Mathematical

Sciences

International 2013 3 (2) 21-24ISSN: 2277-2111

(Online)

43Padwal P , Kulkarni S and Patil

A

Modification and Morphological Study of

Plasma Etched Aluminium Oxide Thin Film

International Journal of

Physics and Mathematical

Sciences

International 2013 3 (2) 25-28ISSN: 2277-2111

(Online)

44 P.Padwal,

S.V.Madhuskar,S.Kulkarni

Study of Electrical Properties of Polyaniline

Films Prepared by RF Plasma Polymerization

Journal of Applied Physics

(IOSR-JAP)International 2013

3

Issue 359-61 ISSN: 2278-4861

45 Tagore S, De, R.K.

Simulating an infection growth model in

certain healthy metabolic pathways of Homo

sapiens for highlighting their role in Type I

Diabetes Mellitus using re-spread strategy,

feedbacks and sensitivities

PLoS ONE International 2013 8(9) e69724 ISSN: 1932-6203

46 Tagore S, Vijayaraghavan, T.

Carnitine translocase in cardiac cell:

structural, functional and flux balance analysis

in pre-β-oxidation pathway of Homo sapiens

International Journal of

Systems, Algorithms &

Applications

International 2013 3(2) 26-29 ISSN: 2250-3749

47 Tagore S, Chatterjee, A.Implementing Cellular Neural Networks to

Identify Abnormalities in Brain MRI Images

UACEE International Journal

of Artificial Intelligence and

Neural Networks – IJAINN

National 20133

(ICRASE13)60-63 ISSN: 2277-2677

Page 12: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

48 Tagore S, Chatterjee, A.

Using Run Length Encoding in Cellular

Neural Networks for detecting abnormalities

in biomedical images in real time

In Proceedings: IEEE - 2nd

Students' Conference on

Engineering and Systems

(SCES 2013)

International 2013 171-174 ISSN: 2277-2679

49Nidhi Sharma, Vivek Gupta,

Vinay Shetty and Ashish RanjanVARYSTIM

International Journal of

Computer Applications International 2013 1 1-3 0975-8887

50

Pramodkumar P. Gupta,

Vishakha Nanavaty and Pranav

Shah

Homology Modeling of MTNR1B and

Insilico Structure Activity Relationship study

of Melatonin analogs for therapeutic

application in Insomnia and Insomnia related

diabetes.

Int Journal of Pharma and

Biological SciencesInternational 2013 4(1): (B) 494 - 506

ISSN: 0975 –

6299

51Parvathi.J.R and Mrinal Sanjog

Gokhale

Collation of data for barcoding and restriction

profiling of ribosomal segments of bacterial

genome

Copyright L-55194/2013 National 2013

52 Bhat MR,Nair JS,Marar T,Extracellur L-asparaginase from Salinicoccus

speciesBionano Frontier National 2013 6(3) 137-139 0974 - 0678

53 Kamble R. B., and Gupte, A. M.

Antimicrobial, Anticholesterol and

Antioxidant activity studies of Ganoderma

lucium mycelia

Proceedings of “Prospects and

Challenges in Biotechnology

and Printing & Packaging

Industry”

International 2013

54 Kamble R. B., and Gupte, A. M. NCBI (Bacterial Sequence - B. oshimensis ) GenBank International 2013

1Manali M. Kocharekar, Sougat

S. Sarkar, Debjani Dasgupta

Comparative Study of Modified Quantitative

Buffy Coat and Two Rapid Tests in

Comparision with Peripheral Blood Smear in

Malaria Diagnosis in Mumbai, India

Journal of Parasitology

ResearchInternational 2014 Pg 1-7

2Priyanka Pushkaraj Vartak and

Debjani Dasgupta

Optimization of culture conditions and media

components for laccase production using

wood rotting fungal isolate

International Journal of

Pharma and Bio SciencesInternational 2014 5(1) (B) 801-809 0975-6299

3

Sandip P, Shreewardhan R,

Sandeepan M, Abhay C, Debjani

D

Phytochemical evaluation and free radical

scavenging potential of Hugonia mystax (L.)

leaf extract

Bionano Frontier National 2014 Vol. 7(2) 3-6 0974-0678

4 Manan D, Debjani D Structural insights of FtsA Bionano Frontier National 2014 Vol.7(2) 42-46 0974-0678

YEAR 2014

Page 13: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

5

Arindam A Ghataka, Nishita D

Bhembre , Anisha A Kamath ,

Sneha S Mehta , Michelle R

Mendoncaa, Azriel W D'souza,

Papalk Chaturvedi and Neetin S

Desai

Antiproliferative, antioxidant activity and total

phenolic content of Mitragyna parvifolia

(Roxb.) Korth.

Inter J. of Pharmacy and

Pharmaceutical Sci International 2014 6(4) 632-637 0971-636X

6

Mahajan P.V., Bandre A. , Patil

C., Wagh V., More A . and

Desai N.S

Study of cell therapy assisted regeneration of

cartilage in avascular bone necrosis.

D Y Patil J. of Health

Sciences National 2014 2(1) 41-45 1028-8880

7Amita Jain,Prakurti Sinha and

Neetin Desai

Estimation of flavonoid, phenol content and

antioxidant potential of Indian screw tree

(Helicteres isora  l.)

Int. Jr. of Pharm Sci Res International 2014 5( 4) 1320-30

8

Nihal S. Jay S. Priyanka K.

Shilpa N. Thankmani M. Rekha

B,

Comparative studies on anti-diabetic effect of

three medicinal plant leaves extract in alloxan

induced diabetic albino wistar rats:

histological and biochemical analysis.

Bionano Frontier National 2014 7(2) 114-117 0974-0678

9V Jindal, M Bhori, K Singh and

T Marar

A preliminary study on the effect of vitamin E

supplementation towards camptothecin

induced in MCF cell line.

Bionano Frontier National 2014 7(2) 82-85 0974-0678

10Neha S, Bhakti M, Rekha B,

Marar.T

Hepatoprotective effect of Bacopa Monneri

extract on imatinib induced toxicity in chick

embryo.

Bionano Frontier National 2014 7(1) 101-103 0974-0678

11 Bhat MR,Nair JS,Marar T

Optimization of media components and

cultural conditions for extracellular production

of L asparaginase from Salinicoccus species.

Bionano Frontier National 2014 7(1) 5-8 0974-0678

12 Mala P. Arpita G and Sunita SCoccinia grandis (L.) voigt: A chemo profile

study.Bionano Frontier National 2014 7 (2) 108-113 ISSN: 0974-0678

13Mala P. Parvathi JR, Payel D

and Sunita S

mCTAB: A Rapid Plant Genomic DNA

Extraction. 7 (12): 19-24. ISSN: 0974-0678 Bionano Frontier National 2014 7 (12) 19-24 ISSN: 0974-0678

14 Rekha B, Selvaakumar C, Liji T.

Interaction of lignan from Phyllanthus niruri

and their metabolites with estrogen receptors:

an in silico study

Bionano Frontiers National 2014 7(2) 74-76ISSN 0976 –

4402

15 Anuj H C and Madhavi R VIsolation and Characterization of a novel ε-

poly L-lysine producing strain: Bacillus cereusBIONANO FRONTIER National 2014 7(2) 86-89 ISSN: 2277-9396

Page 14: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

16Anuj H C , Mugdha, N H.,

Madhavi R V

Optimization of xylanase production by

Aceinetobacter sp. Isolated from garbage

dump

BIONANO FRONTIER National 2014 7(2) 77-81 ISSN: 0973-6808

17Lipika Mishra, Madhavi

Vernekar, Mugdha Harmalkar

Effect of UV and nitrous acid treatment on

production of xylanase enzyme by

Acinetobacter sp

Int. J. Curr. Microbiol. Appl.

SciInternational 2014 3(1) 45-53 ISSN: 0973-0028

18Chande Ashish and Bhat

Manish*

Isolation and Characterization of L-

asparginase producing isolate from

Lonar Lake, Buldhana District, MS, India

Research Journal of Recent

SciencesInternational 2014 3 38-41 ISSN: 0944-1344

19 Jyoti R T, Priyanka S

Crude purification and characterization of

bacteriocins produced by lactic acid bacteria

isolated from vegetables and Indian fermented

food samples.

Bionano Frontier National 2014 7(2) 90-94ISBN 978-9-

3804-2806-2

20 Bhakti Mhatre, Roma KundeBiodegradation of diesel using microbes from

clams(Mertrix Meritrix) shell

ndian Journal of Geo Marine

SciencesNational 2014 43(5) 877-881 0970-9037

21 Reshma K and Arpita GStudies on Ganoderma lucidum mycelia

cultivated on agro based waste.Bionano Frontier National 2014 7(2) 66-68 0974 - 0678

22 Vidhi U and Priti UAntibacterial activity of Origanum vulgare

(Oregano) oilBionano Frontier National 2014 7(2) 47-49 ISSN: 0974-0678

23 Joshi, N. and Srivastav, A.

Salinity induced modulations in growth and

biochemcial traits in callus cultures of Allium

cepa L.

Research J. Pharmaceutical

and Biological Sci.National 2014 5(3) 291-299 2249-555X

24 Matkar,S.Joshi, N. NaCl priming mediated alleviation of salinity

stress in onion (Allium cepa L.)Bionano Frontiers National 2014 7(2) 60-65 1931-5260

25 Ranade R.,Joshi, N.

Effects of ascorbic acid, activated charcoal

and low temperature on oxidative browning in

tissue culture of medicinal plant Barleria

prionitis L

Bionano Frontiers National 2014 7(2) 103-107 1811-9700

26Selvaa kumar c, Sudheer M. M.

Mohammed

An In silico Based Comparison of Drug

Interactions in Wild and Mutant Human β-

tubulin through Docking Studies

Avicenna Journal of Medical

BiotechnologyInternational 2014 6(2) 81-93 2008-2835

27 Deepa Garg*, P.VaidyaEffect of Alcohol on serum lipids,lipoproteins

and lipid peroxidation in AlcoholicsBionano Frontier National 2014 (7) 57-59 2230-9593

28Shine Devarajan, Jeya Sundara

Sharmila

Molecular dynamics study of GM1

ganglioside complex with amyloid β

peptide (Aβ42) in lipid membrane

Journal of Molecular Liquids International 2014 195 59-64 0167-7322

Page 15: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

29Tagore S, Chowdhury, N., De,

R.K.

Analyzing methods for Path Mining with

application in MetabolomicsGene International 2014 534 (2014) 125-138 ISSN: 0378-1119

30 Tagore S, Bendre, S.

Stability and fitness analysis of β-catenin Wnt

pathway for exploring roles of certain

potential genes in Alzheimer’s disease

Bionano Frontier National 2014 7 (2) 1-2 ISSN: 0974-0678

31 Tagore S, Sheikh, F.

Analysis of differential gene expressions of

insulin signaling pathway in Type – II

Diabetes mellitus

Bionano Frontier National 2014 7 (2) 69-71 0974-0678

32 Tagore S, Anande, G.

Contact pair-based evolutionary interaction

analysis of carbohydrate metabolism in Homo

sapiens

Bionano Frontier National 2014 7 (2) 72-73 0974-0678

33

Pramodkumar P. Gupta,

Vishakha Nanavaty and Pranav

Shah

Insilico modeling and screening of Daidzein

an isoflavonoid from soya to increase the

binding effect against apoptosis regulator Bcl-

2 protein in breast cancer

Indo American Journal of

Pharmaceutical ResearchInternational 2014 4(04) 1889-1894 ISSN 2231-6876

34 Nilima S and Swati J.Antioxidant and anticancer study of the extract

of neem leaves Bionano Frontier National 2014 7(2) 29 - 31 0974-0678

35

Nilima Shivale, Shernik Shah,

Komal Sampat, Krutika

Deshpande

Broad range activity of sulforaphane extracted

from broccoliBionano Frontier National 2014 7 82 - 85 0974-0678

36

Kritika Braroo, Amit Kumar

Sharma, Mukeshchand Thakur,

Yasar Arfat Kasu, Kanchanlata

Singh and Mustansir Bhori

Colloidal Silver Nanoparticles from Ocimum

sanctum: Synthesis, Separation and Their

Implications on Pathogenic Microorganisms,

Human Keratinocyte Cells, and Allium cepa

Root Tips

Journal of Colloid Science and

Biotechnology International 2014 3 (3) 1 - 8

37Jasnaik Danish I., L. Hariharan,

Pramodkumar Gupta P.

In silico 3D Structure Modeling and Analysis

of Galactoside 2-alpha-L-fucosyltransferase 1

Research & Reviews: A

Journal of Bioinformatics National 2014 1 (3) 2393 - 8722

38Shine Devarajan and Jeya

Sundara Sharmila

Computational Studies of Beta Amyloid

(Aβ42) with p75NTR Receptor: A Novel

Therapeutic Target in Alzheimer's Disease

Advances in Bioinformatics National 2014 2014Article ID

736378

39Bijal Shah, Pramodkumar P.

Gupta

Fragment based homology modeling and

simulation based study of endoglin (CD-105)

from Homo sapiens

International Journal of

Biosciences International 2014 5 (12) 374 - 389

P - 2220 - 6655

E - 2222 - 5234

Page 16: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

40Dr. Sunita Singh, Rutuja G. and

Mala P.

Fingerprinting Antioxidant Activities in Stress

Induced Coccinia Grandis L. Voigt

International Journal of

Pharmaceutical Research and

Development

International 2014 6 (8) 52 - 59 0974 - 9446

41 Pramodkumar P. Gupta

Computer Aided Drug Design and Discovery

Economical Approach to Drug Discovery

Industry

Austin Journal of

Biotechnology and

Bioengineering

International 2014 1 (4) 2

42Shine Devarajan and Sharmila

Jeya Sundara

A Conformational Study of GM1 headgroup

with amyloid β (1-42) protein to identify the

molecular specificity and interactions in

Alzheimer's disease

Research Jouornal of

Biotechnology National 2014 9 (12) 36 - 43

43

Pritam kumar Panda, Dinesh

Ibrahim and Pramodkumar P.

Gupta

Computational Modeling and Analysis of

Theoretical Structure of Corneodesmosin

Receptor Protein with Existing

Phytochemicals in Psoriasis

Indian Journal of Fundamental

and Applied Life Sciences International 2014 4 (4) 346 - 355 2231 - 6345

44 K Singh, M Bhori, T Marar

α-Tocopherol mediated amelioration of

camptothecin-induced free radical damage to

avert cardiotoxicities

Human & Experimental

ToxicologyInternational 2014 1-10

45 R. Kamble and A. Gupte

Cyclodextrin Glycosyltransferase production

by alkaliphilic Bacillus SP. Isolated from

Rice Cultivated Soil and Media Optimization

using Taguchi Method

International Journal of

Pharmaceutical Sciences and

Research

International 2014 5 (7) 2754 - 2762 0975 - 8232

46 Mohini Gore & N. S. Desai

Characterization of phytochemicals and

evaluation of anti-cancer potential of Blumea

eriantha DC.

Physiology and Molecular

Biology of Plants International 2014 0971 - 5894

47

S.M. Mallakmir, G.R. Kane,

S.S. Mallakmir, D.A. Vidhate, S.

Deshpande, J. Nadkarni, M.

David, G. Ravindranathan, J.

Shah

A study of Apo lipoprotein 'E' polymorphism

and lipid profile in coronary artery disease

International Journal of Recent

Trends in Science and

Technology

International 2014 11 (2) 234 - 237 2277 - 2812

48Anuj H. Chheda, Madhavi R.

Vernekar

Omproved production of natural food

preservative ε - poly-L-lysine using a novel

producer Bacillus cereus

Food Bioscience International 2014 7 56 - 63 2212 - 4292

49

Sunil Kumar Singh, Ankita

Singh, Ved Prakash & Selvaa

Kumar C

Structure modeling and dynamics driven

mutation and phosphorylation analysis of Beta-

amyloid peptides

Bioinformation International 2014 10 (9) 569 - 574 0973 - 8894

Page 17: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

1Chheda A. H. and Vernekar M.

R.

A natural preservative ε - poly-L-lysine:

fermentative production and applications in

food industry

International Food Research

Journal International 2015 22 (1) 23 - 30

2A. H. Chheda and Madhavi

Vernekar

Optimization of Medium Components and

Feeding Strategies for Epsilon Poly-L-Lysine

Production by Streptomyces Noursei NRRL

5126

International Journal of

Pharmaceutical Sciences and

Research

International 2015 6 (5) 1000 - 10E - 09755 - 8232

P - 2320 - 5148

3Amita Jain and Pramodkumar P.

Gupta

In silico Comparative Molecular Docking

Study and Analysis of Glycyrrhizin from

Abrus precatorius (L.) against Antidiabetic

Activity

European Journal of Medicinal

Plants International 2015 6 (4) 212 - 222 2231 - 0894

4 Sunita Singh and Mala ParabFingerprinting Intra - Specific Diversity

Among Coccinia Grandis Landraces

International Journal of Recent

Scientific Research International 2015 6 (3) 3025 - 3032 0976 - 3031

5Dudwadkar S., Parab M. and

Singh S.

Diversity Analysis among few Cucurbitaceae

Using Seed Protein Profile

International Journal of Plant,

Animal and Environmental

Sciences

International 2015 5 (1) 146 - 151 2231 - 4490

6

Dhanashree D. Jagtap,

Divyambari S. Gupte, Madhuri

R. Thakar, Hari Om Singh,

Sudhanshu Pandey, Selvaa

Kumar C., Ramesh S. Paranjape.

Molecular characterization of tetherin/BST-2

gene promoter in Indian HIV infected long

term non progressors

Indian Journal of Human

Genetics International 2015 20 1 - 33

7

Jaykumar J. Chavan, Dhanaji M.

Ghadage, Parthraj R. Kshirsagar

and Shubahs S. Kudale

Optimization of Extraction Techniques and

RP-HPLC Analysis of Antidiabetic and

Anticancer Drug Mangiferin from Roots of

'Saptarangi' (Salacia chinensis L.)

Journal of Liquid

Chromatography and Related

Technologies

International 2015 38 963 - 969

8Subhash Kudale, Swaroopa

Ghatge and Neetin Desai

Quantification of Phytochemicals in hary root

cultures of Rubia cordifolia Linn

International Journal of

Advanced Research (2015)International 2015 3 (3) 903 - 913 2320 - 5407

9

Selvaa Kumar C, Nikhil

Gadewal, Sudheer MM

Mohammed

Seminal role of deletion of amino acid

residues in H1-S2 and S-loop regions in

eukaryotic β-tubulin investigate from docking and

dynamics perspective

Journal of Theoretical Biology International 2015 378 79 - 88

10Manish Bhat and Thankamani

Marar

Cytotoxic Effect of Purified L-asparaginase

from Salinicoccus sp. M KJ997975

International Journal of

Current Microbilogy and

Applied Sciences

International 2015 4 (4) 701 - 712 2319 - 7706

YEAR 2015

Page 18: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

11Pritam Kumar Panda, Sneha

Patil, Priyam Patel

In silico Stabolity Analysis and

Phosphorylation Induced Structural

Simulation of Alpha-synuclein in Parkinson's

disease

Research and Reviews : A

Journal of Bioinformatics International 2015 2 (1) 15 - 21 2393 - 8722

12

Tahir Bashir, Mandar

Patgaonkar, Selvaa Kumar C,

Achhelal Pasi, Kudumula

Venkata Rami Reddy

HbAHP-25, an In-Silico Designed Peptide,

Inhibits HIV-1 Entry by Bblocking gp120

Binding to CD4 Receptor

PLOS ONE International 2015 10 (4) 1 - 25

13Anuj H. Chheda, Madhavi R.

Vernekar

Enhancement of ε-poly-L-lysine (ε-PL)

production by a novel producer Bacillus

cereus using metabolic precursors and

glucose feeding

3 Biotech International 2015DOI

10.1007/s

13205-015-

0291-8

14De Payel, Parab Mala, Singh

Sunita

Inter-genus variation analysis in few members

of Cucurbitaceae based on ISSR markers

Biotechnology and

Biotechnical EquipmentInternational 2015

DOI

10.1080/131

02818.2015

1 - 5

15Kinjal Shah, Priyanka Burange,

Sunita Singh

Phytochemical, Antimicrobial and Anti-

Adherence Analysis of Plant and Ayurvedic

Extracts

International Journal of

Applied Biology and

Pharmaceutical Technology

International 2015 6(3) 72 - 79 0976-4550

16Padmadas N, Chellasamy S,

Durairaj S

Identification of Distant Structural Prtholog

and A Possible Evolutionary Linkage of

HSP60 - A Fold Based Approach

International Journal of

Bbioinformatics Research International 2015 7 (1) 313 - 320

0975-3087

E-ISSN:

0975-9115

17 M. R. Bhat, J. S. Nair, T. Marar

Isolation and identification of L-asparaginase

producing salinicoccus SP. M KJ997975

from soil microbial flora

Internation Joournal of

Pharmaceutical Sciences and

Research

International 2015 6 (8) 3599-3605

2320-5148

EISSN:

0975-8232

18

Manasvee Dhanesha,

Kanchanlata Singh, Mustansir

Bhori, Thankamani Marar

Impact of antioxidant supplementation on

toxicity of methotrexate: an in vitro study on

erythrocytes using vitamin E

Asian Journal of

Pharmaceutical and Clinical

Resaerch

International 2015 8 (3) 339-343 0974-2441

19 Garg Deepa, Sheth U, Marar T.

Inhibitory Effect of Allium sativum on Low-

Density Lipoprotein (LDL) Oxidatoin

Induceed by CuSO4In-Vitro

Research Journal of

Pharmaceutical, Biological

and Chemical Sciences

International 2015 6 (3) 1123-1129 0975-8585

20Manish Bhat and Thankamani

Marar

Media Optimization, Extraction and Partial

Characterization of an Orange Pigment from

Salinicoccus sp. MKJ997975

Internation Joournal of Life

Sciences Biotechnology and

Pharma Research

International 2015 4 (2) 85 - 89

Page 19: D. Y. Patil University, Navi Mumbai School of … H Kudale and T.Marar Histopathological and serum enzymes alterations n rats treated with camptothecin and prophylactic effect of α

Sr.

No.

Name of the authors/ co-

authorsTittle of the paper Name of the Journal

Natio/

InternationalYear Volume

Page

Number

Whether

journal is

indexed? ISSN

D. Y. Patil University, Navi Mumbai

School of Biotechnology and Bioinformatics Plot - 50, Sector - 15, CBD Belapur, Navi Mumbai - 400614

21J.M. Patki, S. Singh and S.

Mehta

Partial Purification and Characterization of

Phytase from Bacteria Inhabiting the

Mangroves of the Western Coast of India

International Journal of

Current Microbilogy and

Applied Sciences

International 2015 4 (9) 156 - 169 2319-7706

22Deepali K. Kothekar, Debjani

Dasgupta

Differential Action of Bacterial

Phosphatidylinositol-Specific Phospholipases

C on Bovine Erythrocyte Membrane Ghost

Indian Journal of Applied

Research International 2015 5 (7) 42 - 44 2249 - 555X

23Bhakti Mhatre and Thankamani

Marar

Vetting and Comparative Analysis of

Antioxidants and Phytochemicals from

Methanolic, Aqueous and a Popular

Commercial Fruit Juice (Noni) Morinda

Citrifolia L.

Research Journal of

Pharmaceutical, Biological

and Chemical Sciences

International 2015 6 (6) 884 - 890 0975 - 8585

24 J. R. Parvathi and S. Singh

Facile Approaches for Microbial DNA

Extraction: Comparative Study with Colonies

"Picked" from three Different Bacteriological

Mediums

Journal of Pure and Applied

MicrobiologyInternational 2015 9 (3) 1373 - 2378