Consumption of β-casomorphins-7/5 induceinflammatory immune response in mice gutthrough Th2 pathway

Mohammad Raies Ul Haq, Rajeev Kapila *, Vamshi SaligantiAnimal Biochemistry Division, National Dairy Research Institute, Karnal 132001, India

A B S T R A C T

β-Casomorphins are opioid like bioactive peptides released on digestion of β-casein of milk.In the present study in vivo impact of consumption of β-casomorphins (BCM-7/5) was evalu-ated on immune response of murine gut. The peptides were given to mice through oral in-

tubation at a dose of 7.5 × 10−8 mol/day/animal for 15 days. Oral administration of both peptidesindividually increased (p < 0.01) phenotypic expression of inflammation associated mol-ecules (MPO, MCP-1, IL-4 and histamine), humoral immune response (IgE, IgG, IgG1/IgG2a),

infiltration of leucocytes in intestinal villi and mRNA expression of toll like receptors (TLR-2

and TLR-4) in mice gut. However, no changes in sIgA, IgA+ and goblet cell numbers were

recorded. These results clearly indicate that consumption of β-casein derived peptides BCM-7/5 induce inflammatory immune response in gut, most likely through Th2 pathway.

© 2014 Elsevier Ltd. All rights reserved.

A R T I C L E I N F O

Article history:

Received 23 October 2013

Received in revised form 21 March

2014

Accepted 24 March 2014

Available online 13 April 2014

Keywords:

β-CasomorphinsBCM-7

BCM-5

Inflammation

Humoral immune response

Cytokines

1. Introduction

Milk is the main source of biologically active peptides (BAPs)which regulate various physiological functions in humans(Korhonen & Pihlanto, 2006). These BAPs are mostly releasedfrom casein which is the most predominant fraction (80%) ofmilk proteins (Martien, Groenen, & Van der Poel, 1994). Thesebioactivities include ACE inhibition, immunoregulation, mineraltransport, antithrombotic properties, antimicrobial activity, an-tioxidant properties and opioid agonistic or antagonistic ac-tivities (Korhonen, 2009). Among these caseins, β-casein has209 amino acids with at least 12 genetic variants that differat different amino acid positions (Farrell et al., 2004). Thesegenetic variants are screened with various molecular biologytechniques such as PCR-amplification created restriction site

(PCR-ACRS), PCR-RFLP and PCR-SSCP (Raies, Kapila, Shandilya,Dang, & Kapila, 2012). However, the two major alleles exist-ing are A1 or A2 ‘like’ by virtue of the amino acid present atposition 67 (Jinsmaa & Yoshikawa, 1999). A1 β-casein and relatedvariants (B, C, F and G) possessing the amino acid histidine atresidue 67 of the protein are reported to release β-casomorphins.However, the presence of proline at the same position (67th)in A2 ‘like’ variants (A3, D, E, H1 and H2) resists such cleav-age for BCM-7 release with proteolytic digestion (Jinsmaa &Yoshikawa, 1999). BCMs were first isolated from an enzy-matic digest of bovine β-casein (Brantl, Teschemacher,Henschen, & Lottspeich, 1979) and are also reported to be re-leased during gastrointestinal digestion under in vivo condi-tions (Meisel & Frister, 1989).The characteristic features of BCMsare high content of proline, hydrophobic character and the pres-ence of tyrosine on the N-terminus, required for interaction

* Corresponding author. Tel.: +911842252128; fax: +911842252637.E-mail address: rkapila69@rediffmail.com (R. Kapila).

http://dx.doi.org/10.1016/j.jff.2014.03.0181756-4646/© 2014 Elsevier Ltd. All rights reserved.

j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

Available at www.sciencedirect.com

ScienceDirect

journal homepage: www.elsevier.com/ locate / j ff

mailto:rkapila69@rediffmail.comhttp://dx.doi.org/10.1016/j.jff.2014.03.018http://www.sciencedirect.comhttp://www.elsevier.com/locate/JFFhttp://crossmark.dyndns.org/dialog/?doi=10.1016/j.jff.2014.03.018&domain=pdf

with μ-opioid receptor (Teschemacher, 2003). Many reports dem-onstrate binding affinity of these peptides with μ-opioid re-ceptors in isolated organs (Schlimme & Meisel, 1995) andbinding experiments (Chang, Su, Brent, & Chang, 1985). Duringlast decade, some epidemiological data have been generatedthat correlate consumption of A1 β-casein with various adversebiological responses for human ischemic heart disease, ath-erosclerosis, type 1 diabetes and sudden infant death syn-drome (Elliot & Martin, 1984; Laugesen & Elliott, 2003;McLachlan, 2001; Woodford, 2009, 2011). More recently, we havealso found inflammatory response in mice gut on consump-tion of A1 ‘like’ variants of β-casein from cow milk (Raies, Kapila,Sharma, Saliganti, & Kapila, 2013). It is thought that opioid pep-tides BCM-7/5 released from the A1 ‘like’ variants of β-caseinmay play a role in the development of these diseases, and aretherefore, considered hypothetical risk factors. The transportefficiency of BCM-7 was found to increase across intestinal epi-thelial cell lines (Caco-2) in vitro with glucose and calcium ionsthat may have a role in pathogenesis of inflammation and foodallergy in infants (Jarmołowskaa et al., 2013). However, on theother hand, controversial reports are available that link BCM-7with physiological aspects that are beneficial to animals (Raies,Kapila, Shandilya, & Kapila, 2014) such as protective effectsagainst hyperglycaemia and diabetes in rats (Yin, Miao, & Zhang,2010), protective effect against renal oxidative stress (Zhang,Miao, Wang, & Zhang, 2013), attenuation of renal interstitialfibrosis (Zhang, Miao, Ma, Han, & Zhang, 2012), protective effecton cardiomyopathy of rats (Han, Zhang, Wang, & Zhang, 2013)and modulation of intestinal mucus discharge for defenseagainst noxious agents (Trompette et al., 2003). Therefore, thecontroversial data generated through epidemiological and invivo studies about the physiological functions of BCMs furtherwarrant more comprehensive research in this area. BCM-7 andBCM-5 representing the fragments f60–66 and f60–64 of bovineβ-casein, respectively, are the most active BCMs (Brantl,Teschemacher, Blasig, Henschen, & Lottspeich, 1981; Kurek,Przybilla, Hermann, & Ring, 1992) and the intestines being thefirst site where opioid peptides regulate their physiological func-tions through opioid receptors (Elitsur & Luk, 1991) were takenfor observation in the present study.

2. Materials and methods

2.1. Animals

Male Swiss-albino mice (20–25 g) were maintained in the SmallAnimal House of the National Dairy Research Institute (N.D.R.I.),Karnal, India. The animals were kept in plastic propylene cagesand kept at room temperature in a sterilized condition. All pro-cedures were approved by the Institutional Animal Ethics Com-mittee (NDRI, 382/01CPCSEA).

2.2. Experimental design and sample collection

Animals were divided into three groups of six mice each. Allthe groups of mice were kept on semi-synthetic diet (18.4%starch, 65% Bengal gram, 2.55% oil, 2.05% mineral mixture, 1%vitamin mixture and 11% cellulose). Control group mice were

orally intubated with 200 μL phosphate buffer saline (PBS) toavoid variations due to handling stress.Two groups of mice wereorally intubated with chemically synthesized BCM-7 or BCM-5(Technoconcept, New Delhi, India).The peptides (7.5 × 10−8 mol/day/animal) were fed for 15 days suspended in 200 μL PBS. Theamount of peptides fed to mice was calculated from the earlierstudy of Raies et al. (2013) where β-casein was fed accordingto the dose-translation formula (human/mouse) and the releaseof BCM-7 from the A1 ‘like’ variants of β-casein (De Noni, 2008).After 15 days of feeding, mice were sacrificed after overnightfasting and their intestines were collected.

2.3. Collection of intestinal fluid

The tissue (ileum, 2 cm) was flushed with 2 mL of PBS fol-lowed by teasing with sterile needles in the same medium toseparate the cells, and then centrifuged at 2000 g for 20 minat 4 °C. The resultant supernatant i.e., intestinal fluid was re-covered and stored at −80 °C until used of measurement of bio-chemical parameters.

2.4. Inflammatory molecules

2.4.1. Myeloperoxidase (MPO)MPO activity was measured according to Bradley, Priebat,Christensen, and Rothstein (1982) with some modifications.Briefly, the intestinal tissues were homogenized in nine volumesof ice cold potassium phosphate buffer (50 mM, pH 6.0) con-taining 0.5% cetyl trimethyl ammonium bromide (CTAB) fol-lowed by sonication (10 s) and freeze thaw (three times). Thesuspension was centrifuged at 35000 g for 15 min and the su-pernatant analyzed for MPO activity by mixing assay buffer(50 mM potassium phosphate buffer, pH 6.0) containing 0.5 mMo-dianisidine dihydrochloride and 0.0005% H2O2 as sub-strates. The breakdown of H2O2 is directly proportional to oxi-dation of o-dianisidine dihydrochloride which was measuredat 460 nm (UV-visible double beam spectrophotometer, UVD-3500, Labomed Inc., Los Angeles, CA, USA). The concentrationof oxidized o-dianisidine dihydrochloride was calculated fromits molar extinction coefficient (1.13 × 104/cm M). One unit ofMPO activity was defined as amount of enzyme which pro-duces 1 nannomoles of oxidized o-dianisidine dihydrochloridein the presence H2O2 per minute at 25 °C and expressed as units/mg protein.

2.4.2. Monocyte chemotactic protein (MCP-1) andinterleukin-4 (IL-4)MCP-1 and IL-4 in the intestinal fluid of mice weredetermined by using quantitative sandwich ELISA kits(eBioscience, San Diego, CA, USA). The procedures were strictlyadopted according to the manufacturer’s instructions. In brief,plates were coated with 100 μL of 1× capture antibody (goatanti-mouse MCP-1/goat anti-mouse IL-4). The sampleswere diluted 16 times for MCP-1 while undiluted samples wereadded in the experimental wells for detection of IL-4, respec-tively, followed by the addition of detection antibody and100 μL of avidin horseradish peroxidase (HRP). Plates wereallowed to develop with the TMB substrate (3,3,5,5-tetramethyldiaminebenzidine containing 0.03% H2O2) and

151j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

reaction was finally stopped with 50 μL of 2 M H2SO4. Plateswere read at 450 nm.

2.4.3. Histamine estimationHistamine was estimated in the intestinal fluid by the methodof Faridah and Shahrom (2011). Briefly, the samples (1.7 mL)were mixed with 0.8 mL 5 M sodium hydroxide and 0.1 mL ofo-pthaldialdehyde (1% OPT in methanol). After 2 min of incu-bation at room temperature the florescent condensation productof histamine and OPT was stabilized with 0.3 mL of 2 M citricacid. Detection of histamine was carried out on florescencespectrophotometer (Varian, Cary Eclipse,Victoria, Australia) withan excitation wavelength of 350 nm and a florescent of 440 nm.

2.5. Humoral response

2.5.1. Total IgE, IgG and IgATotal IgE, IgG and IgA in intestinal fluid were determined byusing quantitative sandwich ELISA kits (Koma Biotech, Seoul,Korea).To detect these antibodies, plates were coated with 1 μg/mL of goat anti-mouse IgE, IgG and IgA.The sample was diluted8 (IgE), 300 (IgG) and 1000 (IgA) times respectively before addingin experimental wells followed by the addition of 100 μL of horse-radish peroxidase (HRP)-conjugated goat anti-mouse IgE, IgGand IgA respectively. Plates were allowed to develop with theTMB substrate (3,3,5,5-tetramethyldiaminebenzidine contain-ing 0.03% H2O2) and reaction was finally stopped with 100 μLof 2 M H2SO4. Plates were read at 450 nm.

2.5.2. IgG subtypes (IgG1 and IgG2a)IgG1 and IgG2a in intestinal fluid were determined by usingquantitative sandwich ELISA kits (eBioscience, San Diego, CA,USA). In brief, plates were coated with 100 μL of 1× capture an-tibodies (goat anti-mouse IgG1 and IgG2a). Samples were diluted40 times (IgG1) and 16 times (IgG2a) respectively, before addingin the experimental wells followed by the addition of 50 μLhorseradish peroxidase (HRP) conjugated antibodies (detec-tion antibodies). After 3 h of incubation at room temperature,plates were allowed to develop with the TMB substrate and re-action was finally stopped with 50 μL of 2 M H2SO4. Plates wereread at 450 nm.

2.6. Histological parameters

2.6.1. Goblet cells and total leucocytesTwo centimeters of tissues from murine small intestine (ileum)was used for histological slides for determination of goblet cellsand total leucocytes by the method of Kiernan (2008). The 3 μmsections of tissues were cut with Senior Rotary Microtome(Radical, RMT-30, Ambala, India). The slides were stained withhematoxylin and eosin stain. The numbers of goblet cells andtotal leucocytes were counted in 7 fields (200×) and 10 fields(400×) respectively, on inverted light microscope (Olympus,CKX41,Tokyo, Japan).The results were expressed as the numberof goblet cells per five intestinal villi and total leucocytes perfive fields of vision respectively.

2.6.2. IgA+ cellsThe unstained histological slides were prepared for direct im-munofluorescence assay of IgA+ cells as described earlier. After

deparaffinization using xylene and rehydration in a decreas-ing gradient of ethanol, sections were blocked in 2% bovineserum albumin (BSA) for 1 h. The slides were washed two tothree times with PBS, sections were incubated with a 1:100 di-lution of α-chain mono-specific antibody conjugated with fluo-rescein isothiocyanate (FITC) (Cayman Chemical, MI, USA) for1 h and observed with a fluorescent light microscope (Olympus,CKX41, Tokyo, Japan). The number of fluorescent cells wascounted in 30 fields at 200× magnification. The results were ex-pressed as the number of positive fluorescent cells per five fieldsof vision.

2.7. Expression of toll like receptors (TLRs) by real timeRT-PCR

2.7.1. RNA isolation and cDNA preparationThe tissues from murine intestine were teased with needle inPBS and centrifuged at 2000 g for 20 min at 4 °C. The sedi-ment (cells) was washed three times with PBS before being usedfor RNA extraction.

Total RNA content was extracted by Tri Reagent (Sigma, StLouis, MO, USA) according to the manufacturer’s instruc-tions. RNA concentration was quantified by NanoQuant (Tecan,Germany) and RNA integrity was checked on 1.4% agarose. RNAconcentrations were adjusted to 500 ng/μL for the synthesisof cDNA. Two micrograms of total RNA was reverse tran-scribed by initiation at 65 °C for 5 min followed by incubationat 42 °C for 1 h in a 25 μL mixture consisting 200 U RevertAidM-MuLV reverse transcriptase, 20 U RiboLock RNase inhibi-tor, 0.5 μg oligo (dT)18, 4 μL 5× reaction buffer, 0.8 mM dNTPmixture. The reaction was terminated at 70 °C for 5 min.

2.7.2. Amplification of TLR-2 and TLR-4 fragmentsPCR was performed to amplify target gene TLR-2, TLR-4 andreference gene GAPDH of 199, 201 and 200 bp length frag-ments, respectively, on Real Time Thermocycler (Biorad CFX96TM,C1000TM, Hercules, CA, USA) with Maxima SYBER Green/Fluorescein qPCR master mix (Thermo Scientific,Vilnius, Lithu-ania) using forward and reverse primers specific for GAPDH,5′ TCAAGAAGGTGGTGAAGCAG3′ and 5′AAAGATGGAAGCTAAGACCC3′; TLR-2, 5′ AAGAGGAAGCCCAAGAAAGC3′ and5′CGATGGAATCGATGATGTTG3′; TLR4,5′ACCTGGCTGGTTTACACGTC3′ and 5′CTGCCAGAGACATTGCAGAA3′. One microliterof cDNA was used for PCR in a final volume of 20 μL, contain-ing 10 μL 2× SYBER Green master mixes 0.2 μM of each forwardand reverse primers and 8 μL nuclease free water. The PCR am-plification was carried out using 1 cycle of initial denatur-ation at 94 °C for 5 min, 35 cycles of denaturation (94 °C for 30 s),annealing (53 °C for 30 s) and extension (72 °C for 45 s) and afinal extension cycle at 72 °C for 4 min. After amplification,threshold (Ct) values of both control and experimental groupswith reference genes were taken for calculating fold changein target gene expression.

2.8. Statistical analysis

Data were analyzed using the GraphPad Prism (Version 5.01).Experimental results are means ± S.E.M (standard error mean).Data were subjected to analysis of variance (ANOVA) and the

152 j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

Tukey’s test was used to separate the means (p < 0.05) whichwere considered statistically significant.

3. Results

3.1. Inflammatory molecules

Myeloperoxidase is released from stimulated polymorpho-nuclear neutrophils (PMNs) that produce the powerful oxidanthypochlorous acid which has microbicidal activity in addi-tion to tissue damage like acute or chronic inflammation.There-fore, it serves as a marker of inflammation. Results indicatedthat feeding of BCM-7 and BCM-5 increased MPO activity con-siderably (p < 0.001) by 129.76 and 117.55%, respectively, com-pared to control group mice (Fig. 1A).

MCP-1 is a potent chemoattractant released from mono-cytes that regulates migration and infiltration of basophils,monocytes and macrophages in response to inflammation.Thepresent study revealed a significant increase (p < 0.05) in MCP-1levels on consumption of BCM-7 and BCM-5 by 33.38 and31.73%, respectively, compared to control group mice (Fig. 1B).

CD4 T cells secrete IL-4 that differentiates Th0 to Th2 cellsand induces class switching recombination to IgG1 and IgE iso-topes. It was found that IL-4 levels increased remarkably(p < 0.001) in BCM-7 and BCM-5 groups by 175.54 and 164%, re-spectively, compared to control group mice. (Fig. 1C).

Histamine is a decarboxylation product of histidine, whichis released from activated granulocytes and mast cells whichis considered one of the most imortant mediators of inflam-mation (Previatia et al., 2002). Results indicated that the levelsof histamine increased considerably (p < 0.001) in mice intes-tine by 167.59 and 189.21% on feeding BCM-7 and BCM-5, re-spectively. However, nonsignificant changes (p > 0.05) wereobserved between β-casomorphin (BCM-7/5) fed groups (Fig. 1D).

3.2. Humoral immune response

IgE production occurs in type I hypersensitivity which mani-fests various allergic diseases including food allergy, there-fore, plays a critical role in allergic reactions.The effect of BCM-7and BCM-5 on IgE levels in murine gut is shown in Fig. 2A. Itis evident that consumption of BCM-7 and BCM-5 remark-ably increased (p < 0.001) total IgE levels by 77.09 and 52.37%,

Control BCM-7 BCM-50

2

4

6

8

10

a

b b

units

/mg

prot

ein

Control BCM-7 BCM-50

2

4

6

8

10

a

b b

pg/m

g pr

otei

n

Control BCM-7 BCM-50

2

4

6

8

a

b b

pg/m

g pr

otei

n

(A) (B)

(C) (D)

Control BCM-7 BCM-50

50

100

150

200

250

a

bb

ng/m

l int

estin

al fl

uid

Fig. 1 – Effects of feeding BCM-7 and BCM-5 on inflammatory molecules in mice gut (A) intestinal myeloperoxidase,(B) monocyte chemotactic protein-1, (C) interleukin-4 and (D) histamine. The values are expressed as mean ± SEM (n = 6animals). Different letters indicate significant differences (p < 0.05).

153j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

Control BCM-7 BCM-50

10

20

30

a

bc

ng/m

g pr

otei

n

Control BCM-7 BCM-50

2

4

6

8

a

b b

ug/m

g pr

otei

n

Control BCM-7 BCM-50

2

4

6

a

bb

ug/m

g pr

otei

n

Control BCM-7 BCM-50

200

400

600

800

a

bb

ng/m

g pr

otei

n

Control BCM-7 BCM-50

2

4

6

8

10

ab b

Rat

io o

f IgG

1/Ig

G2a

Control BCM-7 BCM-50

2

4

6

8a

aa

ug/m

g pr

otei

n

(A) (B)

(C)(D)

(E) (F)

Fig. 2 – Effect of feeding of BCM-7 and BCM-5 on humoral immune response of mice gut (A) total IgE, (B) total IgG, (C) IgG1,(D) IgG2a, (E) ratio of IgG1/IgG2a and (F) total IgA levels in intestinal fluid of mice. The values are expressed as means ± SEM(n = 6 animals). Different letters indicate significant differences (p < 0.05).

154 j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

respectively, compared to control. Also it was found that BCM-7consumption increased (p < 0.05) the total IgE levels in intes-tinal fluid by 16.22% compared to BCM-5 group mice.

IgG antibodies are found in all body fluids and consideredthe most important antibodies for fighting various infectionsand this class of antibodies against food antigens are sug-gested to cause low grade inflammation in gut mucosa.Figure 2B depicts the effect of feeding of BCM-7 and BCM-5 onIgG levels of murine gut. It is evident that IgG levels in-creased significantly (p < 0.05) in BCM-7 and BCM-5 groups by42.13 and 45.17%, respectively, compared to control.

Further analysis of IgG subtypes (IgG1 and IgG2a) has alsoshown similar results to total IgG. Feeding of BCM-7 and BCM-5increased (p < 0.01) IgG1 levels (126.63 and 159.78%) and IgG2alevels (77.39 and 90.27%), respectively, as compared to controlgroup mice (Figs. 2C and D). Moreover, the ratios of IgG1/IgG2a were found to increase significantly (p < 0.05) by 26.87and 27.32% after BCM-7 and BCM-5 consumption, respec-tively, compared to control (Fig. 2E).

On the other hand, IgA is the most abundant antibody pro-duced in gut mucosal system. It has a pivotal role in gutmucosal immunity against ingested pathogens and causes aninhibitory effect on inflammatory reactions due to other im-munoglobulins.The present study revealed no change (p > 0.05)in IgA levels in murine intestine on consumption of BCM-7/5compared to control group mice (Fig. 2F).

3.3. Histological parameters

The gastrointestinal tract (GIT) is shielded with mucus gelformed predominantly of mucins that are secreted by gobletcells. Alterations in goblet cell functions and mucin release arerelated to various GIT dysfunctions with change in normalmicrobiota as well as food allergy. The present study revealedthe effect of feeding on goblet cell number, total leucocytenumber and IgA+ cells. It was found that feeding of BCM-7/5did not alter (p > 0.05) the number of goblet cells in the intes-tinal villi of mice compared to control group mice. (Figs. 3Aand B).

On the other hand, consumption of BCM-7 and BCM-5 re-markably increased (p < 0.001) the number of total leucocytesby 154.99 and 118.04%, respectively, compared to control groupmice (Fig. 3C and D).

In murine gut, IgA+ plasma cells have repertoire protectivefunctions, largely being the secretion of IgA antibodies as wellas synthesis of antimicrobial mediators. Under present inves-tigation, it was found that consumption of BCM-7/5 showedno changes (p > 0.05) on IgA+ cells (Figs. 3E and F).

3.4. Toll like receptor mRNA expression

Under present investigation, it was observed that consump-tion of BCM-7 and BCM-5 increased (p < 0.01) expression ofTLR-4 by 381 and 290%, respectively, compared to control(Fig. 4A). Similarly, results depicted an increase (p < 0.05)in mRNA expression of TLR-2 after BCM-7 and BCM-5 con-sumption by 160 and 63%, respectively, compared to control(Fig. 4B).

4. Discussion

In recent years, nutrition and food sciences are focusing moreon milk derived bioactive peptides (BAPs) with growing com-mercial interest in the context of health-promoting func-tional foods (Korhonen & Pihlanto, 2006). These BAPs act asregulatory compounds with hormone-like activity in the humanbody (Svedberg, de Haas, Leimenstoll, Paul, & Teschemacher,1985). Many of the physiological functions are regulated by thesepeptides (agonists or antagonists) through interaction of opioidreceptors in the gastrointestinal tract (Clare & Swaisgood, 2000).One such class of peptides is β-casomorphins (BCMs) withμ-opioid agonistic activity (Teschemacher, 2003) and releasedfrom β-casein of bovine milk, milk products and infant for-mulas (De Noni & Cattaneo, 2010). Despite the health ben-efits exploited by milk proteins, the consumption of cow’s milkhas been under scrutiny for its reported links to the risk ofchronic diseases. Many of these health implications are linkedwith the milk protein derived bioactive peptides such as BCMswhich have been established through various epidemiologi-cal and in vivo animal trials (Laugesen & Elliott, 2003; McLachlan,2001; Tailford, Berry, Thomas, & Campbell, 2003). Initially, cowmilk proteins were thought to be diabetogenic agents (Elliot& Martin, 1984) but, later, it was thought that a peptide i.e.,BCM-7 is released from β-casein of milk protein which couldbe a risk factor for induction of type 1 diabetes (Elliott,Wasmuth, & Hill, 1997).

In the present investigation, an increase (p < 0.05) in MPOactivity, MCP-1 and histamine levels in intestinal cells/fluidalong with leucocyte infiltration in villi on feeding BCM-7/5 wasobserved. These results are supported with our earlier find-ings where consumption of A1 ‘like’ variants of β-casein of cowmilk increased the phenotypic expression of these inflamma-tory molecules (MPO and MCP-1) in addition to leucocyte in-filtration in murine intestine. It was assumed that such effectswere due to these peptides (BCM-7/5) which are released fromA1 ‘like’ variants of β-casein during gastrointestinal diges-tion (Raies et al., 2013). It was established that BCM-7 in nano-and picomolar concentrations resulted in secretion ofinterleukin-8 from peripheral blood mononuclear cells (PBMCs)(Fiedorowicz et al., 2011). IL-8 is a strong chemoattractant forneutrophils that stimulates the activation of G-proteins andseveral downstream serine or threonine kinases, responsiblefor chemotaxis, degranulation and production of superoxideanions during phagocytosis (Waugh & Wilson, 2008).These pre-vious observations clearly support our present results.

Tailford et al. (2003) were the first to establish a relation-ship between β-casein genetic variant (A1/A2) consumptionbased on release of BCMs from A1 ‘like’ variants with initia-tion of atherosclerosis in rabbits. Their study provided strongevidences that in the absence of dietary cholesterol, A1 β-caseinconsumption produced significantly higher serum choles-terol, LDL, HDL, triacylglycerol, percent surface area of aortacovered by fatty streaks and the thickness of the fatty streaklesions in the aortic arch than those fed with A2 variant ofβ-casein. Therefore, it was postulated that BCMs released fromA1 variants may be responsible for such effects. A positive cor-relation was thus observed between consumption of A1/A2β-casein based on release of BCMs and progression of

155j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

arterial lesions suggesting clinically important implications ofA1 β-casein consumption on cardiovascular disorders. Earlierit has been established that incubation of PBMCs with BCM-7at higher concentrations (above femtomolar) reducesinterferon-γ (IFN-γ) secretion but induces IL-4 expression(Fiedorowicz et al., 2011). The remarkable increase (p < 0.001)in IL-4 levels on feeding BCM-7/5 compared to control groupmice observed in the current study also confirms the previ-ous findings of Raies et al. (2013) who have found increasedlevels of IL-4 on consumption of A1 ‘like’ variants of β-casein

of cow milk. The increased IL-4 levels suggest a mechanismthat may lead to differentiation of naive helper T cells to Th2cells for induction of humoral immune response toward in-creased production of immunoglobulins with class switchingactivity (Kashiwadaa et al., 2010). Indeed, a significant in-crease (p < 0.05) in IgE, IgG, IgG1 and IgG2a levels was ob-served in intestinal fluid on feeding BCM-7/5. The inductionin humoral immune response on consumption of these pep-tides is in agreement with our earlier data where a signifi-cant increase in these antibodies was observed on feeding A1

Control BCM-7 BCM-50

10

20

30

40

50a

a a

No.

of g

oble

t cel

lspe

r fiv

e in

test

inal

vill

i

Control BCM-7 BCM-50

100

200

300a

a a

No.

of I

gA+

cells

per

five

field

s

Control BCM-7 BCM50

200

400

600

800

1000

a

bb

No.

of L

euco

cyte

s p

er fi

ve fi

elds

(A)

(B)

(C)

(D)

(E)(F)

Fig. 3 – Histology of mice intestine after feeding BCM-7 and BCM-5 (A) Optical microscopy (200×) of intestinal villi from(a) control, (b) BCM-7, (c) BCM-5. (B) Number of goblet cells in intestinal villi (C) Optical microscopy (400×) intestinal villidepicting total leucocytes. (D) Number of total leucocytes in intestine. (E) Florescent microscopy (200×) of intestinal villi withFITC labeled rabbit antimouse IgA for IgA+ cells. (F) Number of IgA+ cells in intestine. The values are expressed asmeans ± SEM (n = 6 animals). Different letters indicate significant differences (p < 0.05).

156 j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

‘like’ variants of β-casein (Raies et al., 2013).The increased ratioof IgG1/IgG2a on consumption of these peptides as revealedin the present study in addition to the similar results ob-served in our earlier findings on consumption of A1 ‘like’ vari-ants of β-casein (Raies et al., 2013) further strengthen the Th2biased immune response on consumption of BCM-7/5 that vali-dates the elevated levels of IgE, as the latter is also involvedin induction of Th2 immune response mediated food allergicreactions (Dupont & Heyman, 2000). However, we could notdetect any significant changes in intestinal sIgA levels whichwere further corroborated by lack of variation in IgA+ cells inthe intestine. These nonsignificant changes observed in intes-tinal sIgA levels and IgA+ cells on consumption of BCM-7/5 werefurther validated with our earlier data, where similar effect wasobserved on consumption of all the three variants of β-casein(Raies et al., 2013). This could be attributed to the fact that themajority of class switching taking place toward IgG, IgG1, IgG2aand IgE that are directly associated with non-desirous inflam-matory responses. Together, these findings clearly demon-strate an enhanced Th2 response mediated by increased levelsof IL-4 and immunoglobulin production. Activation of the Th2pathway on feeding BCM-7/5 can be corroborated with Kureket al. (1992) who observed a concentration-dependent hista-mine release from peripheral blood leucocytes with BCM-7which was later confirmed by wheal and flare reactions in theskin of healthy children (Kurek et al., 1992). Also, in our labo-ratory it was established that incubation of BCM-5 with bonemarrow derived mast cells caused histamine release (Reddi,Kapila, Dang, & Kapila, 2011) that has been confirmed againin present investigation on feeding BCM-7/5 to mice with itsremarkable increase (p < 0.001) in intestine establishing his-tamine mediated Th2 skewness.

In various inflammatory diseases such as atherosclerosis,diabetes and cancer, MCP-1 has a vital role to play as achemokine secreted from monocytes, T cells and endothelialcells that causes initiation of inflammation through recruit-ment of monocytes (Conti & DiGioacchino, 2001; Hayre, Salanga,Handel, & Allens, 2008; Yadav, Saini, & Arora, 2010). Epidemio-logically, these diseases have also been correlated with therelease of BCMs from A1 ‘like’ variants of β-casein that further

verify our data. As already reported, MCP-1 is induced in avariety of cell types in vitro by cytokines, TNF-α, IL-1and IL-4(Proost, Wuyts, & Damme, 1996; Rollins & Pobert, 1991; Rollins& Sunday, 1991; Thornhill, Kyan-Aung, & Haskard, 1990). Theincrease in IL-4 and MCP-1 levels in the present study pointstoward the Th2 pathway mediated gut inflammation on con-sumption of BCM-7/5 in addition to that observed with con-sumption of A1 ‘like’ variants of β-casein (Raies et al., 2013).

The gastrointestinal tract contains goblet cells that producesecretory and membrane bound mucins with different physi-ological or pathological implications (Corfield, Carroll,Myerscough, & Probert, 2001). In most intestinal infections, theacute phase of inflammation results in induction of goblet cellswhereas the chronic phase causes depletion of goblet cells(Dharmani, Srivastava, Kissoon-Singh, & Chadee, 2009). However,the present investigation showed that none of the two pep-tides resulted in major changes in goblet cell numbers. Thesefindings are in consistent with our previous observations, wherethe same effect was found on consumption of all the three vari-ants of β-casein (Raies et al., 2013). Studies demonstrating se-cretion of rMuc2 and rMuc3 in rat DHE, MUC5AC in humanHT29-MTX cell lines and mucus discharge from isolated per-fused rat jejunum with BCM-7 do exist (Trompette et al., 2003;Zoghbi et al., 2006). However, there are no reports establish-ing a correlation between goblet cell numbers, different geneticvariants of β-casein and chemically synthesized BCMs. There-fore, initiation of the inflammatory response has been pro-posed with A1 ‘like’ variants of β-casein through mucusdischarge but independently of goblet cell number.

On the other hand, weak expression of TLR-4 and TLR-2 wasreported in healthy intestinal epithelial cells (IECs) and laminapropria mononuclear cells (LPMNCs) in vivo but in inflamma-tory responses, these receptors are unregulated (Hausmannet al., 2002). Both in vivo and in vitro studies have demon-strated that histamine is released from peritoneal mastocytes,mast cells and peripheral blood leucocytes after incubation withBCM-7/5 (Kurek, Czerwionka-Szaflarska, & Doroszewska, 1995;Kurek et al., 1992; Rungkat-Zakaria, Belleville, Nabet, & Linden,1992; Schneider, Rolli-Derkinderen, Arock, & Dy, 2002). Previ-ous studies established that in vitro culture of human gingi-

Control BCM-7 BCM-50

2

4

6

a

bb

Fold

cha

nge

in T

LR-4

gene

exp

ress

ion

Control BCM-7 BCM-50

1

2

3

4

a

b

b

Fold

cha

nge

in T

LR-2

gene

exp

ress

ion

(A) (B)

Fig. 4 – Effect of feeding of BCM-7 and BCM-5 on mRNA expression of toll like receptors: (A) TLR-4 and (B) TLR-2. The valuesare expressed as mean ± SEM (n = 6 animals). Different letters indicate significant differences (p < 0.05).

157j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

val fibroblasts (HGFs) and human umbilical vein endothelialcells (HUVEC) with 100 and 10 μM histamine, respectively, re-sulted in the increase of TLR-2 and TLR-4 expression and furtherstimulation of HGFs with lipoteichoic acid or lipopolysaccha-ride showed an increased expression of cyclo-oxygenase-2 andprostaglandin E2 (Gutiérrez-Venegas, Cruz-Arrieta,Villeda-Navarro, & Méndez-Mejía, 2011; Talreja, Kabir, Filla,Stechschulte, & Dileepan, 2004). Moreover, morphine (an agonistof BCM) has been reported to have a role in glial cell (majorimmune inflammatory cells of central nervous system) acti-vation and inflammation through TLR-2 and TLR-4 (Hutchinsonet al., 2010; Zhang, Li, & Zhang, 2011). The earlier observa-tions further support the present findings where consump-tion of BCM-7/5 increased (p < 0.05) the mRNA expression ofTLR-2 and TLR-4. These results are validated with our earlierfindings where the mRNA expression of these receptors wasupregulated on consumption of A1 ‘like’ variants of β-casein(Raies et al., 2013). It was postulated that this increased mRNAexpression of TLR-4 and TLR-2 in murine intestine is due tothe release of these peptides (BCM-7/5) from A1 ‘like’ vari-ants of β-casein during gastrointestinal digestion.

5. Conclusion

In conclusion, the data presented in this paper clearly dem-onstrate that feeding of peptides (BCM-7/5) induce inflamma-tory immune response in murine gut, most likely through Th2pathway. This was confirmed by up-regulation of inflamma-tion associated molecules (MPO, MCP-1, IL-4 and histamine),humoral immune response (IgE, IgG, IgG1, IgG2a, IgG1/IgG2a),infiltration of leucocytes in intestinal villi and mRNA expres-sion of toll like receptors (TLR-2 and TLR-4). However, furtherstudies are required to delineate the molecular mechanismsinvolved in interactions between intestinal opioid receptors andβ-casein peptides which generate signaling cascade of inflam-matory responses. If the cellular data of the future support arole of these peptides in inducing inflammatory disorders thenit will be imperative to minimize their risk globally by reduc-ing the production of ‘A1 like’ milk (which is the source of thesepeptides) through sound breeding policies.

Acknowledgments

The authors are grateful to Director National Dairy ResearchInstitute (ICAR), Karnal for providing funding and laboratoryfacilities to carry out this piece of work.

R E F E R E N C E S

Bradley, P. P., Priebat, D. A., Christensen, R. D., & Rothstein, G.(1982). Measurement of cutaneous inflammation: Estimationof neutrophil content with an enzyme marker. Journal ofInvestigative Dermatology, 78(3), 206–209.

Brantl, V., Teschemacher, H., Blasig, J., Henschen, A., & Lottspeich,F. (1981). Opioid activities of β-casomorphins. Life Sciences,28(17), 1903–1909.

Brantl, V., Teschemacher, H., Henschen, A., & Lottspeich, F. (1979).Novel opioid peptides derived from casein (β-casomorphins).I. Isolation from bovine casein peptone. Hoppe-Seyler’sZeitschrift fur Physiologische Chemie, 360(9), 1211–1216.

Chang, K. J., Su, Y. F., Brent, D. A., & Chang, J. K. (1985). Isolation ofa specific mu-opiate receptor peptide, morphiceptin, from anenzymatic digest of milk proteins. Journal of Biology andChemistry, 260(17), 9706–9712.

Clare, D. A. & Swaisgood, H. E. (2000). Bioactive milk peptides: Aprospectus. Journal of Dairy Science, 83(6), 1187–1195.

Conti, P. & DiGioacchino, M. (2001). MCP-1 and RANTES aremediators of acute and chronic inflammation. Allergy andAsthma Proceedings, 22(3), 133–137.

Corfield, A. P., Carroll, D., Myerscough, N., & Probert, C. S. (2001).Mucins in the gastrointestinal tract in health and disease.Frontiers in Bioscience, 6, 1321–1357.

De Noni, I. (2008). Release of β-casomorphins -5 and -7 duringsimulated gastro-intestinal digestion of bovine β-caseinvariants and milk-based infant formulas. Food Chemistry, 110,897–903.

De Noni, I. & Cattaneo, S. (2010). Occurrence of β-casomorphins-5and -7 in commercial dairy products and in their digestsfollowing in vitro simulated gastro-intestinal digestion. FoodChemistry, 119(2), 560–566.

Dharmani, P., Srivastava, V., Kissoon-Singh, V., & Chadee, K.(2009). Role of intestinal mucins in innate host defensemechanisms against pathogens. Journal of Innate Immunity,1(2), 123–135.

Dupont, C. & Heyman, M. (2000). Food protein-inducedenterocolitis syndrome: Laboratory perspectives. Journal ofPediatric Gastroenterology and Nutrition, 30S, 50–57.

Elitsur, Y. & Luk, D. A. (1991). Β-Casomorphin (BCM) and humancolonic lamina propria lymphocyte proliferation. ClinicalExperimental Immunology, 85(3), 493–497.

Elliot, R. T. & Martin, J. M. (1984). Dietary protein: A trigger ofinsulin dependent diabetes in BB rat? Diabetologia, 26(4), 297–299.

Elliott, R. B., Wasmuth, H., & Hill, J. (1997). Immunosuppressingeffects of cow milk β-casomorphins in prediabetic mice andhumans. 16th IDF Congress, Helsinki.

Faridah, M. N. & Shahrom, A. W. (2011). Comparative histaminelevels in antemortem and postmortem wounds in the humanskin by fluorescence spectrophotometry. Malaysian Journal ofPathology, 23(2), 111–114.

Farrell, H. M., Jr., Jimenez-Flores, R., Bleck, G. T., Brown, E. M.,Butler, J. E., Creamer, L. K., Hicks, C. L., Hollar, C. M., Ng-Kwai-Hang, K. F., & Swaisgood, H. E. (2004). Nomenclature of theproteins of cow’s milk. Journal of Dairy Science, 87(6), 1641–1674.

Fiedorowicz, E., Jarmołowska, B., Iwan, M., Kostyra, E.,Obuchowicz, R., & Obuchowicz, M. (2011). The influence ofµ-opioid receptor agonist and antagonist peptides on periph-eral blood mononuclear cells (PBMCs). Peptides, 32(4), 707–712.

Gutiérrez-Venegas, G., Cruz-Arrieta, S., Villeda-Navarro, M., &Méndez-Mejía, J. A. (2011). Histamine promotes theexpression of receptors TLR-2 and TLR-4 and amplifiessensitivity to lipopolysaccharide and lipoteichoic acidtreatment in human gingival fibroblasts. Cell BiologyInternational, 35(10), 1009–1017.

Han, D. N., Zhang, D. H., Wang, L. P., & Zhang, Y. S. (2013).Protective effect of β-casomorphin-7 on cardiomyopathy ofstreptozotocin-induced diabetic rats via inhibition ofhyperglycemia and oxidative stress. Peptides, 44, 120–126.

Hausmann, M., Kiessling, S., Mestermann, S., Webb, G., Spöttl, T.,Andus, T., Schölmerich, J., Herfarth, H., Ray, K., Falk, W., &Rogler, G. (2002). Toll-like receptors 2 and 4 are up-regulatedduring intestinal inflammation. Gastroenterology, 122(7), 1987–2000.

158 j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0010http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0010http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0010http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0010http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0015http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0015http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0015http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0020http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0020http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0020http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0020http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0025http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0025http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0025http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0025http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0030http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0030http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0035http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0035http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0035http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0040http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0040http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0040http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0045http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0045http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0045http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0045http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0050http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0050http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0050http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0050http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0055http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0055http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0055http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0055http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0060http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0060http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0060http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0065http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0065http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0065http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0070http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0070http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0070http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0075http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0075http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0075http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0080http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0080http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0080http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0080http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0085http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0085http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0085http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0085http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0085http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0090http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0090http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0090http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0090http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0095http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0095http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0095http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0095http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0095http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0095http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0100http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0100http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0100http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0100http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0105http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0105http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0105http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0105http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0105

Hayre, M. O., Salanga, C. L., Handel, T. M., & Allens, S. J. (2008).Chemokines and cancer: Migration, intracellular signaling,and intercellular communication in the microenvironment.Biochemical Journal, 409(3), 635–649.

Hutchinson, M. R., Zhang, Y., Shridhar, M., Evans, J. H., Buchanan,M. M., Zhao, T. X., Slivka, P. F., Coats, B. D., Rezvani, N.,Wieseler, J., Hughes, T. S., Landgraf, K. E., Chan, S., Fong, S.,Phipps, S., Falke, J. J., Leinwand, L. A., Maier, S. F., Yin, H., Rice,K. C., & Watkins, L. R. (2010). Evidence that opioids may havetoll-like receptor 4 and MD-2 effects. Brain, Behavior, andImmunity, 24(1), 83–95.

Jarmołowskaa, B., Teodorowiczb, M., Fiedorowicza, E.,Sienkiewicz-Szłapkaa, E., Matysiewicza, M., & Kostyraa, E.(2013). Glucose and calcium ions may modulate the efficiencyof bovine β-casomorphin-7 permeability through a monolayerof Caco-2 cells. Peptides, 49, 59–67.

Jinsmaa, Y. & Yoshikawa, M. (1999). Enzymatic release ofneocasomorphin and β-casomorphin from bovine β-casein.Peptides, 20(8), 957–962.

Kashiwadaa, M., Levyb, D. M., McKeaga, L., Murraya, K.,Schröderb, A. J., Canfield, S. M., Traver, G., & Rothman, P. B.(2010). IL-4-induced transcription factor NFIL3/E4BP4 controlsIgE class switching. Proceedings of the National Academy ofSciences of the United States of America, 107(2), 821–826.

Kiernan, J. A. (2008). Histological and Histochemical Methods: Theoryand Practice (4th ed.). Bloxham: Scion, UK.

Korhonen, H. (2009). Milk-derived bioactive peptides: Fromscience to applications. Journal of Functional Foods, 1(2), 177–187.

Korhonen, H. & Pihlanto, A. (2006). Bioactive peptides: Productionand functionality. International Dairy Journal, 16(9), 945–960.

Kurek, M., Czerwionka-Szaflarska, M., & Doroszewska, G. (1995).Pseudoallergic skin reactions to opiate sequences of bovinecasein in healthy children. Roczniki Akademii Medycznej WBialymstoku, 40(3), 480–485.

Kurek, M., Przybilla, B., Hermann, K., & Ring, J. (1992). A naturallyoccurring opioid peptide from cow’s milk, β-casomorphin-7,is a direct histamine releaser in man. International Archives ofAllergy and Applied Immunology, 97(2), 115–120.

Laugesen, M. & Elliott, R. (2003). Ischaemic heart disease, type 1diabetes, and cow milk A1 β-casein. Journal of the New ZealandMedical Association, 116(1168), U295.

Martien, A. M., Groenen, J., & Van der Poel, J. (1994). Regulation ofexpression of milk protein genes: A review. Livestock ProductionScience, 38, 61–78.

McLachlan, C. N. S. (2001). Β-casein A1, ischaemic heart diseasemortality, and other illnesses. Medical Hypotheses, 56(2), 262–272.

Meisel, H. & Frister, H. (1989). Chemical characterization ofbioactive peptides from in vivo digests of casein. Journal ofDairy Research, 56(3), 343–349.

Previatia, M., Raspadorib, A., Bertolasoa, L., Parmeggiania, A.,Bindini, D., Vitali, C., Lanzoni, I., Corbacella, E., Saviano, M.,Fagioli, F., Blo, G., & Capitani, S. (2002). Determination ofhistamine in the whole blood of colon cancer patients. Journalof Chromatography B, 780, 331–339.

Proost, P., Wuyts, A., & Damme, V. J. (1996). Human monocytechemotactic proteins-2 and -3: Structural and functionalcomparison with MCP-1. Journal of Leucocyte Biology, 59,67–74.

Raies, M. H., Kapila, R., Shandilya, U. K., Dang, A. K., & Kapila, S.(2012). Detection of A1 and A2 genetic variants of β-casein inIndian crossbred cattle by PCR-ACRS. Milchwissenschaft, 67(4),396–398.

Raies, M. H., Kapila, R., Shandilya, U. K., & Kapila, S. (2014).Impact of milk derived β-casomorphins on physiologicalfunctions and trends in research: A review. InternationalJournal of Food Properties, doi:10.1080/10942912.2012.712077.

Raies, M. H., Kapila, R., Sharma, R., Saliganti, V., & Kapila, S.(2013). Comparative evaluation of cow β-casein variants (A1/A2) consumption on Th2 mediated inflammatory response inmouse gut. European Journal of Nutrition, doi:10.1007/s00394-013-0606-7.

Reddi, S., Kapila, R., Dang, A. K., & Kapila, S. (2011). Evaluation ofallergenic response of milk bioactive peptides using mousemast cell. Milchwessienschaft, 67, 117–121.

Rollins, B. J. & Pobert, J. S. (1991). Interleukin-4 induces thesynthesis and secretion of MCP-1/JE by human endothelialcells. American Journal of Pathology, 138(6), 1315–1319.

Rollins, B. J. & Sunday, M. E. (1991). Suppression of tumorformation in vivo by expression of the JE gene in malignantcells. Molecular Cell Biology, 11(6), 3125–3131.

Rungkat-Zakaria, R. F., Belleville, F., Nabet, F., & Linden, G. (1992).Allergenicity of bovine casein. I: Specific lymphocyteproliferation and histamine accumulation in the mastocytesas a result of casein feeding in mice. Food and AgriculturalImmunology, 4, 41–50.

Schlimme, E. & Meisel, H. (1995). Bioactive peptides derived frommilk-proteins-structural, physiological and analytical aspects.Die Nahrung, 39(1), 1–20.

Schneider, E., Rolli-Derkinderen, M., Arock, M., & Dy, M. (2002).Trends in histamine research: New functions during immuneresponses and hematopoiesis. Trends in Immunology, 23(5),255–263.

Svedberg, J., de Haas, J., Leimenstoll, G., Paul, F., & Teschemacher,H. (1985). Demonstration of β-casomorphin immunoreactivematerials in in vitro digests of bovine milk and in smallintestine contents after bovine milk ingestion in adulthumans. Peptides, 6(5), 825–830.

Tailford, K. A., Berry, C. L., Thomas, A., & Campbell, J. H. (2003).Casein variant in cow’s milk is atherogenic. Atherosclerosis,170(1), 13–19.

Talreja, J., Kabir, M. H., Filla, B. M., Stechschulte, D. J., & Dileepan,K. N. (2004). Histamine induces toll-like receptor 2 and 4expression in endothelial cells and enhances sensitivity togram-positive and gram-negative bacterial cell wallcomponents. Immunology, 113(2), 224–233.

Teschemacher, H. (2003). Opioid receptor ligands derived fromfood proteins. Current Pharmaceutical Design, 9(16), 1331–1344.

Thornhill, M. H., Kyan-Aung, U., & Haskard, D. O. (1990). IL-4increases human endothelial cell adhesiveness for T cells butnot for neutrophils. Journal of Immunology, 144(8), 3060–3065.

Trompette, A., Claustre, J., Caillon, F., Jourdan, G., Chayvialle, J. A.,& Plaisancie, P. (2003). Milk bioactive peptides andβ-casomorphins induce mucus release in rat jejunum. Journalof Nutrition, 133(11), 3499–3503.

Waugh, D. J. J. & Wilson, C. (2008). The interleukin-8 pathway incancer. Clinical Cancer Research, 14(21), 6735–6741.

Woodford, K. (2009). The devil in the Milk A1 or A2? Howβ-caseins are changing the dairy industry.American Council onRural Special Education, 39(12)

Woodford, K. (2011). Milk protein and human health: A1 versusA2 β-casein. An address to the general practitionersconference, Sydney.

Yadav, A., Saini, V., & Arora, S. (2010). MCP-1: Chemoattractantwith a role beyond immunity: A review. Clinical Chimica Acta,411(21–22), 1570–1579.

Yin, H., Miao, J., & Zhang, Y. (2010). Protective effect ofβ-casomorphin-7 on type 1 diabetes rats induced withstreptozotocin. Peptides, 31(9), 1725–1729.

Zhang, L., Li, L., & Zhang, G. (2011). A Crassostrea gigas toll-likereceptor and comparative analysis of TLR pathway ininvertebrates. Fish and Shellfish Immunology, 30(2), 656–660.

Zhang, W., Miao, J., Ma, C., Han, D., & Zhang, Y. (2012).β-casomorphin-7 attenuates the development of nephropathyin type I diabetes via inhibition of epithelial-mesenchymal

159j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0110http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0110http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0110http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0110http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0115http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0115http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0115http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0115http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0115http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0115http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0115http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0120http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0120http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0120http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0120http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0120http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0125http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0125http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0125http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0130http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0130http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0130http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0130http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0130http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0135http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0135http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0140http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0140http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0140http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0145http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0145http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0150http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0150http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0150http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0150http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0155http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0155http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0155http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0155http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0160http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0160http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0160http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0165http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0165http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0165http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0170http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0170http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0170http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0175http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0175http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0175http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0180http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0180http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0180http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0180http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0180http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0185http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0185http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0185http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0185http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0190http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0190http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0190http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0190http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0195http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0195http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0195http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0195http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0200http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0200http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0200http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0200http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0200http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0205http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0205http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0205http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0210http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0210http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0210http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0215http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0215http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0215http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0220http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0220http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0220http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0220http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0220http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0225http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0225http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0225http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0230http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0230http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0230http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0230http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0235http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0235http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0235http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0235http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0235http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0240http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0240http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0240http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0245http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0245http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0245http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0245http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0245http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0250http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0250http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0255http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0255http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0255http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0260http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0260http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0260http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0260http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0265http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0265http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0270http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0270http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0270http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0275http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0275http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0275http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0280http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0280http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0280http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0285http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0285http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0285http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0290http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0290http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0290http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0295http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0295http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0295

transition of renal tubular epithelial cells. Peptides, 36(2), 186–191.

Zhang, W., Miao, J., Wang, S., & Zhang, Y. (2013). The protectiveeffects of β-casomorphin-7 against glucose-inducedrenal oxidative stress in vivo and vitro. PLoS ONE, 8,e63472.

Zoghbi, S., Trompette, A., Claustre, J., El Homsi, M., Garzón, J.,Jourdan, G., Scoazec, J. Y., & Plaisancié, P. (2006).β-Casomorphin-7 regulates the secretion and expression ofgastrointestinal mucins through a µ-opioid pathway. AmericanJournal of Physiology. Gastrointestinal and Liver Physiology, 290(6),G1105–G1113.

160 j o u rna l o f f un c t i ona l f o od s 8 ( 2 0 1 4 ) 1 5 0 – 1 6 0

http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0295http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0300http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0300http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0300http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0300http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0305http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0305http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0305http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0305http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0305http://refhub.elsevier.com/S1756-4646(14)00116-9/sr0305

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具

http://www.xuebalib.com/cloud/http://www.xuebalib.com/http://www.xuebalib.com/cloud/http://www.xuebalib.com/http://www.xuebalib.com/vip.htmlhttp://www.xuebalib.com/db.phphttp://www.xuebalib.com/zixun/2014-08-15/44.htmlhttp://www.xuebalib.com/

Consumption of -casomorphins-7/5 induce inflammatory immune response in mice gut through Th2 pathway1. Introduction2. Materials and methods2.1. Animals2.2. Experimental design and sample collection2.3. Collection of intestinal fluid2.4. Inflammatory molecules2.4.1. Myeloperoxidase (MPO)2.4.2. Monocyte chemotactic protein (MCP-1) and interleukin-4 (IL-4)2.4.3. Histamine estimation2.5. Humoral response2.5.1. Total IgE, IgG and IgA2.5.2. IgG subtypes (IgG1 and IgG2a)2.6. Histological parameters2.6.1. Goblet cells and total leucocytes2.6.2. IgA+ cells2.7. Expression of toll like receptors (TLRs) by real time RT-PCR2.7.1. RNA isolation and cDNA preparation2.7.2. Amplification of TLR-2 and TLR-4 fragments2.8. Statistical analysis3. Results3.1. Inflammatory molecules3.2. Humoral immune response3.3. Histological parameters3.4. Toll like receptor mRNA expression4. Discussion5. Conclusion Acknowledgments References