SIGNALING AND CELL PHYSIOLOGY

B7-H4 downregulation induces mitochondrialdysfunction and enhances doxorubicin sensitivityvia the cAMP/CREB/PGC1-α signaling pathway in HeLa cells

Hyoung Kyu Kim & In-Sung Song & Sun Young Lee & Seung Hun Jeong &

Sung Ryul Lee & Hye Jin Heo & Vu Thi Thu & Nari Kim & Kyung Soo Ko &

Byoung Doo Rhee & Dae Hun Jeong & Young Nam Kim & Jin Han

Received: 7 February 2014 /Revised: 26 February 2014 /Accepted: 26 February 2014# Springer-Verlag Berlin Heidelberg 2014

Abstract B7-H4 is a B7 family coregulatory protein thatinhibits T cell-mediated immunity. B7-H4 is overexpressedin various cancers; however, the functional role of B7-H4 incancer metabolism is poorly understood. Because mitochon-dria play pivotal roles in development, proliferation, and deathof cancer cells, we investigated molecular and functionalalterations of mitochondria in B7-H4-depleted HeLa cells. Ina human study, overexpression of B7-H4was confirmed in thecervices of adenocarcinoma patients (n=3) compared tononcancer patients (n=3). In the cell line model, B7-H4depletion was performed by transfectionwith small interferingRNA (siRNA). B7-H4 depletion suppressed oxygen con-sumption rate, ATP production, and mitochondrial membranepotential and mass and increased reactive oxygen speciesproduction. In particular, electron transport complex III activ-ity was significantly impaired in siB7-H4-treated cells. Coin-cidently, depletion of B7-H4 suppressed major mitochondrialregulators (peroxisome proliferator-activated receptor gammacoactivator 1-alpha [PGC1-α] and mitochondrial transcriptionfactor A), a component of oxidative phosphorylation(ubiquinol-cytochrome c reductase core protein 1), and anantiapoptosis protein (Bcl-XL). Mitochondrial dysfunctionin siRNA-treated cells significantly augmented oxidative

stress, which strongly activated the JNK/P38/caspase axis inthe presence of doxorubicin, resulting in increased apoptoticcell death. Investigating the mechanism of B7-H4-mediatedmitochondrial modulation, we found that B7-H4 depletionsignificantly downregulated the cAMP/cAMP responseelement-binding protein/PGC1-α signaling pathway. Basedon these findings, we conclude that B7-H4 has a role in theregulation of mitochondrial function, which is closely relatedto cancer cell physiology and drug sensitivity.

Keywords B7-H4 .Mitochondria . PGC1-α . cAMP .

CREB . Adenocarcinoma

Introduction

B7 family molecules are important regulators of the antigen-specific immune response. One member of this family, B7-H4, has an inhibitory effect on the proliferation, cytokinesecretion, and immune toxicity of T cells [29]. Increasedexpression of B7-H4 in various cancers, including breast[34], gastric [1], pancreatic [2], ovarian [7], and cervicalcancer [9], and renal cell carcinoma [19] has been reported.These studies clearly demonstrate the immune escape role ofB7-H4 in various cancers [41].

B7-H4 is a transmembrane protein; however, several tumorcell types express B7-H4 intracellularly. Unlike transmem-brane B7-H4, the intracellular protein does not show T cellinhibitory activity in ovarian tumor cells [20]. Moreover, arecent study suggested that nuclear translocation of intracel-lular B7-H4 plays a role in tumor progression and cell prolif-eration [40]. This suggests that intracellular B7-H4 plays animportant role in tumor cell pathophysiology, including pro-gression, cell cycle, and resistance to cell death. Mitochondria

H. K. Kim : I.<S. Song : S. Y. Lee : S. H. Jeong : S. R. Lee :H. J. Heo :V. T. Thu :N. Kim :K. S. Ko : B. D. Rhee : J. Han (*)National Research Laboratory for Mitochondrial Signaling,Department of Physiology, College of Medicine, Department ofHealth Sciences and Technology, Cardiovascular and MetabolicDisease Center, Inje University, Busan, South Koreae-mail: phyhanj@inje.ac.kr

D. H. Jeong :Y. N. KimDepartment of Obstetrics and Gynecology, Busan Paik Hospital, InjeUniversity, Busan, South Korea

Pflugers Arch - Eur J PhysiolDOI 10.1007/s00424-014-1493-3

are key cellular organelles that modulate cell death via tightregulation of the process of programmed cell death or apopto-sis. Dysregulation or disruption of apoptosis in mitochondriahas been suggested as a critical factor in tumorigenesis. There-fore, regulation of mitochondrial function or apoptosis hasbeen suggested as promising anticancer targets [24, 10]. Inspite of accumulating evidence for an important intracellularrole of B7-H4 in cancer cell metabolism, the physiologicalassociation of B7-H4 with mitochondria, underlying molecu-lar mechanisms, and specific target signaling pathway aremainly unknown.

The aims of our study were to find the B7-H4-mediatednovel cellular signaling pathway and to test physiologicalimplications of B7-H4 in mitochondrial energy metabolismor regulation of oxidative stress. We used small interferingRNA (siRNA) to silence the B7-H4 gene in HeLa humancervical cancer cells and analyzed the effects of B7-H4 knock-down onmitochondrial membrane potential and production ofreactive oxygen species (ROS) and ATP. We found that si-lence of B7-H4 altered mitochondrial functions and enhancedcellular toxicity of the major anticancer drug doxorubicin via amitochondria-dependent cell death pathway. Importantly,silence of B7-H4 dysregulated cAMP/CREB/PGC1-α signal-ing pathway modulating mitochondria biogenesis, oxidativephosphorylation, and ROS balance.

Materials and methods

Clinical sample collection

Primary cervical cancer samples were obtained from threepatients (age, 47–67 years; mean, 56 years) who were surgi-cally treated at Busan Paik Hospital, Inje University, Busan,South Korea. Adenocarcinoma had been diagnosed in thepatients histologically. None of the patients received anytreatment before the primary surgical treatment. The clinicalstage of cervical cancer was established according to theInternational Federation of Gynecology and Obstetrics(FIGO) criteria; one case was classified as FIGO stage Ib,and two cases as FIGO stage IIb. Normal cervical samplesobtained from three patients (age, 40–50 years; mean,45 years) who were treated for the benign gynecologicaldisease uterine leiomyoma served as controls. All patientsprovided informed consent before collection of the tissuesamples. The collection and use of the samples was approvedby the Institutional Review Board of Busan Paik Hospital(IRB number 06-14).

Immunohistochemistry

All tissues were fixed in 10 % neutral-buffered formalin andembedded in paraffin. Tissue sections, 5-μm thick, were

blocked in CAS-Block solution (Invitrogen, Carlsbad, CA,USA) for 10 min at room temperature and incubated withrabbit monoclonal antibody to B7-H4 (Abcam, Cambridge,UK) for 3 h at room temperature. Sections were then incubat-ed for 1 h at room temperature with phycoerythrin (PE)-conjugated, species-specific secondary antibody. Nuclei werecounterstained with DAPI (Invitrogen). To confirm the spec-ificity of fluorescence, tissues were incubated with secondaryantibody only and used as negative controls for each sample.Confocal images were obtained with an LSM 700 LaserScanning Microscope (Carl Zeiss, Oberkochen, Germany).

Cell culture and reagents

The HeLa cell line was purchased from Korea Cell Line Bank(KCLB). Cell lines were cultured according to KCLB instruc-tions. HeLa cells were maintained in Dulbecco’s ModifiedEagle Medium (DMEM; Lonza, Basel, Switzerland) supple-mented with 10 % fetal bovine serum (Lonza) and 1 % pen-icillin and streptomycin (Lonza) in an atmosphere of 5%CO2.The cells were detached with 0.125 % trypsin (Lonza) every3 days and subcultured in 100-mm culture dishes. Doxorubi-cin hydrochloride and N-acetylcysteine (NAC) were pur-chased from Sigma-Aldrich Korea. Doxorubicin and NACwere dissolved in ethanol at concentrations of 100 nM–10 μMand 2 mM, respectively, and stored at −20 °C until use.

siRNA treatment

siRNA duplexes targeting human B7-H4 (5′-GUGAUAGUUGGCAAUGCCU-3′) were obtained from Sigma-Aldrich.HeLa cells cultured in Opti-MEM medium (Gibco, GrandIsland, NY, USA) were transfected with siRNA using Lipo-fectamine RNAiMAX Reagent (Invitrogen). Mock siRNA(siCon) was used as experimental control. After 4 h of trans-fection, transfection medium was replaced with normal medi-um. Cells transfected with siB7-H4 and siCon were used 24 hafter the medium change. Transcriptional effect of mocksiRNA treatment was compared with non-treated HeLa cells(WT).

Cell proliferation assay

Cell proliferation rate was compared in siCon- and siB7-H4-transfected HeLa cells using the Cell Counting Kit-8 (CCK-8)(Dojindo, Kumamoto, Japan). After transfection, cells wereseeded in 48-well plates at a density of 1×104 cells/well. Cellproliferation rate was detected on 1, 3, and 5 days afterseeding. CCK-8 solution (10 μL) was added to each well,followed by incubation for 2 h at 37 °C. Absorbance at450 nm was determined using a multiplate reader (MolecularDevices) [32].

Pflugers Arch - Eur J Physiol

Cellular oxygen consumption rate

Cellular oxygen consumption rate (OCR) was measured byXF24 analysis (Seahorse Bioscience, North Billerica, MA,USA) as previously described [16]. After treatment of trans-fection, cells (1×104) were seeded in the XF24 cell cultureplates and incubated at 37 °C in an atmosphere of 5 %CO2 for16 h. Cells were treated with 0 or 1.5 μMof doxorubicin in 6 hthen OCR was measured using the XF24 analyzer, and theXF24 software normalized the values to the protein concen-tration in each well. OCR is expressed as nmol O2/min/mgprotein.

Intracellular ATP level

ATP concentration in the siCon- and siB7-H4-transfected cellswas analyzed using the ATP bioluminescent somatic cellassay kit (FLASC; Sigma-Aldrich, St. Louis, MO, USA).After treatment of transfection, cells were treated with 0 or1.5 μM of doxorubicin in 6 h then ATP levels were detected.Briefly, 100 μL ATP assay mix working solution, 100 μLsomatic cell ATP-releasing reagent, and 50 μL ultrapure waterwere added to the assay vials and vortex-mixed, followed byaddition of treated cells (1×105) to each vial. Luminescencewas detected using a SpectraMax M2 microplate reader(Molecular Devices, Sunnyvale, CA, USA) [16].

Measurement of mitochondrial inner membrane potential

To evaluate the functional consequence of B7-H4 knock-down in mitochondria, mitochondrial inner membranepotential (ΔΨm) was compared in siCon- and siB7-H4-t r an s f e c t e d ce l l s u s i ng th e f l u o r e s c en t dyetetramethylrhodamine, ethyl ester (TMRE; excitation/emission=549 nm/574 nm; Invitrogen) which is seques-tered by active mitochondria [17]. Cells (1×106) werestained with 200 nM TMRE for 30 min at 37 °C.TMRE-loaded cells were analyzed using a FACSCaliburflow cytometer (BD Biosciences, San Jose, CA, USA) andLSM 700 confocal microscope (Carl Zeiss). Acquiredimages were analyzed using ZEN 2009 (Carl Zeiss). Thespecificity of TMRE staining was confirmed by depolari-zation induced by 1 μM carbonyl cyanide m-chlorophenylhydrazine (CCCP) [32].

Detection of mitochondrial superoxide

Levels of mitochondrial ROS were measured in both siCon-and siB7-H4-transfected cells using MitoSOX Red (excita-tion/emission=510nm/580nm; Invitrogen), a specific mito-chondrial superoxide indicator, to evaluate the effect of B7-H4 knockdown on cellular oxidative stress. Cells (1×105)were incubated with 1 μM MitoSOX for 20 min at 37 °C.

Intensity of MitoSOX staining was analyzed using aFACSCalibur flow cytometer (BD Biosciences) and LSM700 confocal microscopy (Carl-Zeiss). Furthermore, mito-chondria complex I (rotenone) and III (antimycin A)inhibitors-induced ROS generation was analyzed by flowcytometer.

Mitochondrial mass analysis

To measure mitochondrial mass, siCon- and siB7-H4-transfected cells were stained with acridine orange 10-nonylbromide (NAO; Invitrogen), which binds the mitochondrialmembrane phospholipid cardiolipin, at a final concentration of1 μM in phosphate-buffered saline (PBS). Importantly, bind-ing is independent of mitochondrial inner membrane potentialover the physiologically relevant range [39]. The cells wereincubated in the dark at 37 °C for 15 min and then washedtwice with PBS. NAO fluorescence was measured using anLSM 700 laser confocal microscope (Carl Zeiss). Fluores-cence excitation was at 488 nm and emission was measuredbeyond 585 nm. Mean intensity of the region of interest wasmeasured in each cell and analyzed using ZEN 2009 software(Carl Zeiss). Nuclei were counterstained with Hoechst 33342.The NAO fluorescence signal was also analyzed using aFACSCalibur flow cytometer (BD Biosciences) for moreaccurate quantification.

Mitochondrial complex assay

Complex I, III, and V activities were measured in siCon- andsiB7-H4-transfected cells using 96-well plate-based micro-plate assay kits for measurement of the three enzyme activities(MS141, MTOX3, and MTOX5; MitoSciences, Eugene, OR,USA) using the protocol and settings recommended by themanufacturer. Data are presented as percentage of siConvalue. Two hundred micrograms of cell extract were used inthe assay of complex I activity (NADH dehydrogenase). Theenzyme is immunocaptured in the wells of the microplate, andactivity is determined following the oxidation of NADH toNAD+ and simultaneous reduction of a dye, which leads toincreased absorbance at 450 nm. For the complex III activityassay, 300 μg of mitochondria from siCon and siB7-H4 cellswere used. Enzyme activity is measured by monitoring theconversion of oxidized cytochrome c to its reduced form as alinear increase in absorbance at 550 nm. Rotenone and KCNare used to inhibit complex I and IVactivity, respectively. Forcomplex V activity assay, 15 μg of solubilized mitochondriafrom siCon- and siB7-H4-treated cells were used. The enzymeactivity in samples was measured by monitoring the oxidationof NADH to NAD+ as a linear decrease in absorbance at340 nm.

Pflugers Arch - Eur J Physiol

Western analysis

Harvested cells were lysed in lysis buffer (20 mM HEPES[pH 7.5], 150 mM NaCl, 1 mM EDTA, 2 mM EGTA, 1 %Triton X-100, and 10 % glycerol) containing protease andphosphatase inhibitor cocktail. Cell lysates were centrifugedat 10,000g for 10 min at 4 °C. Protein concentrations ofcell lysates were determined using a BCA Protein AssayKit (Pierce, Rockford, IL, USA), and 10–50 μg protein wasloaded per lane of 8–12 % SDS-polyacrylamide gradientgels. Proteins were transferred onto Amersham Pharmacianitrocellulose membranes (GE Healthcare, Chalfont St.Giles, UK). Western analysis was carried out using primaryantibodies against B7-H4 (50 kD; Abcam), ubiquinol-cytochrome c reductase core protein 1 (UQCRC1, 53 kD;Abcam), mitochondrial transcription factor A (mtTFA,25 kD; Santa Cruz Biotechnology, Santa Cruz, CA,USA), peroxisome proliferator-activated receptor γ coacti-vator 1 alpha (PGC1-α, 92 kD; Abcam), poly(ADP-ribose)polymerase (PARP, 89 and 116 kD; Cell Signaling Tech-nology, Danvers, MA, USA), procaspase-3 (35 kD; CellSignaling Technology), cleaved caspase-3 (17 and 19 kD;Cell Signaling Technology), ERK (42 kD; Cell SignalingTechnology), phospho-ERK (44 kD; Cell Signaling Tech-nology), JNK (46 and 54 kD; Cell Signaling Technology),p38 (43 kD; Cell Signaling Technology), AMP-activatedprotein kinase-α (AMPK-α, 62 kD; Abcam), phospho-AMPK-α (62 kD; Abcam), cAMP response element-binding protein (CREB, 43 kD; Abcam), phospho-CREB(43 kD; Abcam), and α-tubulin (55 kD; Santa CruzBiotechnology).

Real-time PCR

To evaluate the effect of B7-H4 silencing on expression ofmajor mitochondrial genes, relative levels of PGC1-α,mtTFA, NADH dehydrogenase (ubiquinone) Fe-S protein 1(NDUFS1 [NADH-coenzyme Q reductase]), voltage-dependent anion channel 1 (VDAC1), UQCRC1, BcL-XL(BCL2-like 1), and superoxide dismutase (SOD) 1 and 2mRNAs were assessed by real-time PCR (Table 1). TotalRNA was extracted from cultured cells using the RNeasyPlus Mini Kit (Qiagen, Hilden, Germany) following themanufacturer’s instructions. Reverse transcription (RT)-PCR was performed with the SuperScript III Reverse Tran-scriptase Kit (Invitrogen) using 2 μg purified RNA as tem-plate. Real-time PCR was carried out using SYBR PremixEx Taq (Takara, Shiga, Japan) according to the manufac-turer’s protocol. All reactions were carried out in triplicate.Quantitation of relative gene expression was analyzed usingthe 2−ΔΔCT method. β2-Microgrobulin (B2M) was used asan endogenous control.

Analysis of cell death

The effect of B7-H4 knockdown on cell susceptibility to theanticancer drug doxorubicin was compared in siCon- andsiB7-H4-transfected HeLa cells using the Cell Counting Kit-8 (CCK-8) (Dojindo, Kumamoto, Japan). Cells were seeded in48-well plates at a density of 1×104 cells/well and treated withdoxorubicin at concentrations ranging from 100 nM to 10 μMfor periods ranging from 6 to 24 h. CCK-8 solution (10 μL)was added to each well, followed by incubation for 2 h at37 °C. Absorbance at 450 nm was determined using amultiplate reader (Molecular Devices) [32]. To determinewhether ROS generation is a main cause of doxorubicin-induced cell death, some cells were pretreated with the anti-oxidant NAC (2 mM) for 1 h. All cells were treated with1.5μMdoxorubicin for 24 h, followed by harvest and assay ofcell viability [33].

cAMP production assay

The effect of decreased B7-H4 expression on forskolin-stimulated cAMP accumulation was assessed using thecAMP-GloTM assay kit (Promega, Madison, WI, USA)following the manufacturer’s protocol. Briefly, siCon- andsiB7-H4-treated cells were seeded at a density of 1×104

cells/well in 96-well plates. After 24 h, cells were incu-bated in induction buffer (PBS containing 500 μMisobutyl-1-methylxanthine [IBMX]; 100 μM 4-(3-butoxy-4-methoxy-benzyl) imidazolidone [Ro 20-1724]) and 0, 5,

Table 1 Primers for real-time PCR

PGC1-α peroxisomeproliferator-activated re-ceptor γ coactivator 1alpha, mtTFA mitochon-drial transcription factorA, NDUFS1 NADH de-hydrogenase (ubiqui-none) Fe-S protein 1,VDAC1 voltage-depen-dent anion channel 1,UQCRC1 ubiquinol-cy-tochrome c reductasecore protein 1, SOD su-peroxide dismutase,BcL-XL BCL2-like 1,B2M β2-microglobulinI Primers appear in orderforward/reverse

Gene Primer sequenceI

PGC1-α acctgacacaacacggacagaact

tcttggtggaagcagggtcaaagt

mtTFA ccgaggtggttttcatctgt

tccgccctataagcatcttg

NDUFS1 cagggaaggtgtgatggagt

caaacctgatgcagcgagta

VDAC1 cgacatggatttcgacattg

ccaaactctgtcccgtcatt

UQCRC1 gggcaaaaacatcctcagaa

acggatccggttgtagtctg

SOD1 agggcatcatcaatttcgag

acattgcccaagtctccaac

SOD2 ggaagccatcaaacgtgact

acacatcaatccccagcagt

Bcl-XL ctgaatcggagatggagacc

tgggatgtcaggtcactgaa

B2M ctcgctccgtggccttag

caaatgcggcatcttcaa

Pflugers Arch - Eur J Physiol

or 10 μM of the cAMP agonist forskolin for 1 h at roomtemperature. After induction, cells were lysed to releasecAMP, and luminescence was measured using a microplateluminometer (Molecular Devices) [25]. The level offorskolin-stimulated cAMP accumulation was normalizedto baseline level of luminescence (F1/F0) in siCon- andsiB7-H4-treated cells.

CRE-luciferase reporter assay

The effect of decreased B7-H4 on the forskolin-stimulatedcAMP/protein kinase A (PKA)/CREB pathway was assessedby CRE-luciferase reporter assay [11]. B7-H4 and controlsiRNAs were transfected at a final concentration of50 nmole/L for 48 h with Lipofectamine RNAiMAX

Fig. 1 B7-H4 expression upregulated in cervical cancer tissue. Sectionsof paraffin-embedded cervical tissue from three noncancer patients (top,normal) and three cervical cancer patients (bottom, cancer) were immu-nostained with anti-B7-H4 antibody (red), counterstained with DAPI

(blue), and visualized by confocal microscopy. Negative control (NegCon) sections for each sample were incubated with secondary antibodyalone. (scale bar=50 μm)

Pflugers Arch - Eur J Physiol

(Invitrogen) following the manufacturer's protocol. Cellswere then seeded in six-well plates and transfected withCRE-driven luciferase and Renilla luciferase reporter plas-mids. After 24 h, the cells were treated with 0, 10, or 50 μMforskolin for 4 h and then harvested and lysed according tothe Dual-Luciferase Assay System (Promega) protocol.Standard firefly and Renilla luciferase activities weresequentially measured using a luminometer. Relativeluciferase activities were calculated after normalization tothe transfection efficiency of the Renilla luciferase reporterplasmid [31].

Statistical analysis

Data were analyzed using Student’s t test and ANOVA withTukey’s post hoc comparison of means using Origin 8.0software (OriginLab, Northampton, MA, USA). P<0.05 wasconsidered statistically significant. All data represent mean±standard error of the mean (SEM) of three independentexperiments.

Results

Upregulation of B7-H4 expression in cervical cancer

Immunohistochemical analysis showed that expression levelsof B7-H4 were markedly increased in cervical cancer. B7-H4-positive cells were not detected in normal cervical tissues(Fig. 1, upper), whereas B7-H4 was highly expressed in alltissue samples from cervical cancer patients. The specificity ofstaining was confirmed by negative-control staining of tissueof each patient. This result suggests that expression of B7-H4is coincidently increased in cervical adenocarcinoma as hasbeen shown for ovarian and breast cancers [27]. In the clinic,B7-H4 might be a useful biomarker in diagnosis of cervicaladenocarcinoma.

B7-H4 knockdown modulated mitochondrial functionand mass

Successful knockdown of B7-H4 inHeLa cells was confirmedby semiquantitative RT-PCR (Fig. 2a) and Western blot

Fig. 2 Successful knockdown ofB7-H4 gene in HeLa cells andeffect of B7-H4 depletion on cellproliferation. a RT-PCR analysis(top) and quantitation (bottom) ofB7-H4 mRNA in siCon- andsiB7-H4-treated cells. b Westernanalysis (top) and quantitation(bottom) of B7-H4 in wild-type(WT) and siCon- and siB7-H4-treated cells. cWestern analysis ofB7-H4 in membrane and cytosol-ic fractions of siCon- and siB7-H4-treated cells. Na+/K+ ATPaseand α-tubulin served as markersof membrane and cytosol, re-spectively. d Cell proliferationrate comparison between siConand siB7-H4 cells. *p<0.05 vs.siCon, siCon, control siRNA;siB7-H4; siRNA targeting B7-H4; ns, nonspecific band; A.U.,arbitrary units

Pflugers Arch - Eur J Physiol

(Fig. 2b) analyses. Because two cellular locations, transmem-brane and intracellular, have been reported for B7-H4, weperformed western analysis of membrane and cytosolic frac-tions of siCon- and siB7-H4-treated cells to determine whichform of B7-H4 was suppressed by siRNA treatment. The siB7-H4 treatment reduced the expression level of B7-H4 in bothmembrane and cytosolic fractions (Fig. 2c). After silencing ofB7-H4 gene, the cell proliferation rate was compared to

control. Depletion of B7-H4 significantly suppressed prolifer-ation of HeLa cell after 3 and 5 days of treatment (Fig. 2d).

After confirmation of decreased B7-H4 protein level andcell proliferation rate, we compared various mitochondrialfunctions, including oxygen consumption, intracellular ATPlevel, mitochondrial complex activity, mitochondrial innermembrane potential (ΔΨm), and ROS generation, in siCon-and siB7-H4-treated cells to determine the fundamental role of

AT

P (

%)

a b

0

2

4

6

8

10

12

nm

ol O

2/m

in/m

g p

rote

in

siCon siB7-H4

*

0

50

100*

siCon siB7-H4

NAOsiCon

siB7-H4

Hoechst Merge

0

50

100 *

0

50

100

cou

nt

*

Rel

ativ

e N

AO

(%

)

d

e siCon siB7-H4

siCon siB7-H4

Rel

ativ

e N

AO

(%

)

NAO0

250siCon

siB7-H4

0

50

100

150

Co

mp

lex

III a

ctiv

ity

(%)

*

0

50

100

150

*

0

50

100

150

Co

mp

lex

I act

ivit

y (%

)

Co

mp

lex

V a

ctiv

ity

(%)

c siConsiB7-H4

Fig. 3 siB7-H4 treatmentreduced mitochondrial OXPHOSand mass. aOxygen consumptionrate of siCon- and siB7-H4-treated cells. b Intracellular ATPlevels in siCon- and siB7-H4-treated cells. c Relative activitiesof mitochondrial complexes I, III,and V in siCon- and siB7-H4-treated cells. d FACS analysis ofNAO-stained cells (10,000 cells/sample) (left) and comparison ofstatistical means (right) in siCon-and siB7-H4-treated cells.e Confocal laser microscopicimages of NAO (green) andHoechst (blue) staining of siCon-and siB7-H4-treated cells (left)and quantitation (right). n>60cells/sample; NAO, acridineorange 10-nonyl bromide

Pflugers Arch - Eur J Physiol

B7-H4 in mitochondrial functions. siB7-H4 treatment sup-pressed OCR by approximately 23.3 % compared with siContreatment (Fig. 3a). The intracellular ATP level was 17 %lower in siB7-H4-treated cells than siCon-treated cells(Fig. 3b). We found significant suppression of electron trans-port chain complex III activity with siB7-H4 treatment, to alevel approximately 43 % of that seen in siCon-treated cells.Complex Vactivity in siB7-H4-treated cells was decreased by16 % compared to siCon-treated cells (Fig. 3c). However,activities of complex I (Fig. 3c) and other complexes (datanot shown) were not changed by siB7-H4 treatment. Todetermine whether reductions in ATP production and OCRwere caused by quantitative alteration of mitochondria in thetreated cells, we compared mitochondrial mass in the twogroups of cells using the mitochondrial cardiolipin-specificfluorescent probe, NAO. Interestingly, NAO signal-based mi-tochondrial mass decreased by 10–14 % in siB7-H4-treatedcompared to siCon-treated cells (Fig. 3d, e).

B7-H4 knockdown induced ΔΨm depolarizationand overproduction of ROS

Alterations in mitochondrial inner membrane potential(ΔΨm) and ROS level were detrimental factors leading toapoptotic cell death. To determine whether the suppression of

B7-H4 may have mitochondria-mediated cytotoxic potential,we comparedΔΨm and ROS generation in siCon- and siB7-H4-treated cells.

FACS and confocal microscopic analyses showed thatΔΨm was reduced by 18–23 % in siB7-H4-treated comparedto siCon-treated cells (Fig. 4a, b). Treatment with the mito-chondrial uncoupler CCCP (1 μM) successfully reducedΔΨm in both groups to the same level in 20 min as indicatedby TMRE staining (Fig. 4a). Basal mitochondrial superoxideproduction, based on MitoSox Red staining intensity, wassignificantly higher (123 %) in the siB7-H4-treated group(Fig. 5a). Moreover, ROS generation induced by the mito-chondrial complex I inhibitor rotenone or complex III inhib-itor antimycin A increased more rapidly in this group(Fig. 5b–e). Basal mitochondrial superoxide production was76.54 relative fluorescence units (RFU) in siCon- vs.100.93 RFU in siB7-H4-treated cells, and rotenone-inducedproduction was 142.22 vs. 206.81 RFU at 30 min in therespective groups of cells (Fig. 5b, c). Additional experimentshowed that antimycin A-induced superoxide production was138.61 RFU in siCon- vs. 180.84 RFU in siB7-H4-treatedcells at 30 min. The increased ratio was 139 % in siCon- vs.142 % in siB7-H4-treated cells compared to each basal level(Fig. 5d, e). These results demonstrate that suppression of B7-H4 increased apoptotic stimuli, including depolarization of

0

50

100

150

1 5 10 15 20

CCCP 1µM a

TM

RE

inte

nsi

ty (

RF

U)

Time (min)

Rel

ativ

e m

(%

)

*

bCon

siB7-H4

TMRE MergeHoechst

Rel

ativ

e m

(%)

0

50

100

*

*

siCon siB7-H4

*

siCon siB7-H40

50

100

cccp

cccp

bas

al

bas

al

siCon

siB7-H4

Fig. 4 B7-H4 knockdown induced ΔΨm depolarization. a FACS anal-ysis of mitochondrial inner membrane potential (ΔΨm) in siCon- andsiB7-H4-treated cells (10,000 cells/sample). Basal ΔΨm was measuredandΔΨmdepolarization was induced by treatment with 1μMCCCP andmonitored to confirm probe specificity. In the presence of CCCP, theminimal ΔΨm values were similar in both groups. b Confocal laser

microscopic images of Hoechst (blue) and TMRE (red) staining ofsiCon- and siB7-H4-treated cells (left) and comparison of statistical meanΔΨm in siCon- and siB7-H4-treated cells (right) (n>60 cells/sample).Confocal images were taken at ×40 magnification; scale bar=10 μm;*p<0.05 vs. siCon; RFU, relative fluorescence units; TMRE,tetramethylrhodamine, ethyl ester

Pflugers Arch - Eur J Physiol

ΔΨm and overproduction of ROS, under normal conditionsand conditions of stress in cancer cells.

B7-H4 knockdown modulated the level of majormitochondrial proteins

We compared the gene and protein expression levels ofmajor mitochondrial biogenesis and electron transfer chaincomplex components in the siB7-H4-treated cells to deter-mine whether the knockdown of B7-H4 modulated expres-sion of major mitochondrial genes and proteins and causedmitochondrial dysfunction. Real-time PCR analysis showedthat the relative levels of PGC1-α, UQCRC1, mtTFA,SOD2, and Bcl-XL mRNA were significantly decreasedin siB7-H4-treated cells (Fig. 6a). Relative protein levelsof UQCRC1, mtTFA, PGC1-α, and Bcl-XL were alsosignificantly decreased in these cells (Fig. 6b). Because

PGC1-α and mtTFA are major regulatory proteins inmitochondrial biogenesis and oxidative phosphorylation(OXPHOS), reduction of their mRNA and protein levelsmight have reduced mitochondrial mass and OXPHOSactivity in siB7-H4-treated cells.

B7-H4 knockdown activates JNK and p38 and leads to celldeath

Activation of mitogen-activated protein kinases, includingJNK, ERK, and p38, is commonly observed in oxidativestress-induced cell death. We examined whether mitochondri-al dysfunction induces ROS-mediated activation of thesekinases in siB7-H4-treated cells. Activation of JNK, ERK,and p38 was assessed by western analysis of the relative levelsof total and phosphorylated forms of the proteins. As shown inFig. 7a, siB7-H4 treatment alone increased levels of the active,

a Hoechst MitoSOX MergeCon

siB7-H4

*

Rel

ativ

e M

ito

sox

(% s

iCo

n)

0

50

100

150

siCon siB7-H4

0

50

100

150

200

250

0 10 20 30

Rot (1 µM)M

ito

sox

(RF

U)

b

Mit

oso

x(R

FU

)

c

0

50

100

150

200

250

Ro

t Ro

t

bas

al

bas

al

*

*

siCon siB7-H4Time (min)

0

50

100

150

200

*

bas

al

bas

al

AA

AA

*

siCon siB7-H4

Mit

oso

x(R

FU

)

e

0

50

100

150

200

0 10 20 30

Mit

oso

x(R

FU

)

dAA (1 µM)

Time (min)

siCon siB7-H4

siCon siB7-H4

Fig. 5 B7-H4 knockdownincreased generation of ROS. aConfocal laser microscopicimages of MitoSox (red) andHoechst (blue) staining of siCon-and siB7-H4-treated cells (left)and quantitation (right) (n>60cells/sample) b Basal and rote-none (complex I inhibitor)-in-duced mitochondrial superoxideproduction in siCon- and siB7-H4-treated cells. c Comparison ofstatistical mean MitoSox stainingintensities showed that both basaland rotenone-induced ROS pro-duction were significantly higherin the siB7-H4-treated group. dBasal and antimycin A (complexIII inhibitor)-induced mitochon-drial superoxide production insiCon- and siB7-H4-treated cells.e Comparison of statistical meanMitoSox staining intensitiesshowed that both basal andantimycin A-induced ROS pro-duction were significantly higherin the siB7-H4-treated group.Confocal images were taken at×40 magnification; scale bar=10 μm; *p<0.05 vs. siCon; RFU,relative fluorescence units; Rot,rotenone; AA, antimycin A

Pflugers Arch - Eur J Physiol

phosphorylated form of JNK and p38, but ERK activa-tion level was unchanged. Furthermore, doxorubicin en-hanced the phosphorylation of all three proteins in siB7-H4-treated cells in a dose-dependent manner. Becausethe final consequence of JNK and p38 activation iscaspase-dependent apoptotic cell death, we investigatedthe cell death signaling pathway. The increase in JNK/p38 phosphorylation was associated with an increase insequentially cleaved caspase-3 and PARP in siB7-H4-treated cells (Fig. 7a). Also, we tested whether depletionof B7-H4 actually increased doxorubicin-induced mito-chondrial toxicity by monitoring the alteration of oxy-gen consumption rate and ATP production in siCon andsiB7-H4 group in the presence of 0 or 1.5 μM ofdoxorubicin. As a result, doxorubicin-induced decreaseof oxygen consumption rate and ATP production wasseverer in siB7-H4 than siCon cell. The result demon-strated that depletion of B7-H4 increases mitochondrialtoxicity of doxorubicin.

B7-H4 knockdown-induced ROS production is a primarycause of JNK/p38 signaling-mediated cell death

To explore whether increased mitochondrial ROS produc-tion is an essential factor in the enhanced toxicity of doxo-rubicin in B7-H4 knockdown cells, we assessed the levels ofJNK and p38 phosphorylation and cell death in the presenceof 1.5 μM doxorubicin in the absence or presence of theantioxidant agent NAC (2 mM). NAC treatment successfullyprevented phosphorylation of JNK/p38 (Fig. 8a) and sequen-tial cleavage of caspase-3 and PARP (Fig. 8b) in siB7-H4-treated cells. In particular, NAC treatment abrogated theenhanced toxicity of doxorubicin in siB7-H4-treated cells(Fig. 8c). These results suggest that the mechanism of en-hanced cell death in B7-H4 knockdown cells involves in-creased ROS production by the functionally impairedmitochondria.

Mechanism of B7-H4-mediated mitochondrial modulation

We found that phosphorylation of AMPK and CREB andpost-translational modifications upstream of PGC1-α tran-scription, were significantly suppressed in the siB7-H4-treated cells (Fig. 9a). cAMP is a major modulator of CREBvia PKA activity. It also enhances AMPK phosphorylation[15]. Thus, the level of cAMP and the forskolin-inducedincrease in cAMP level were measured to determine whetherthe cAMP/PKA signaling pathway was involved in B7-H4modulation of CREB and AMPK phosphorylation. Althoughthe basal level of cAMP in the absence of stimulation was notsignificantly different in siCon- and siB7-H4-treated cells,both forskolin-induced cAMP accumulation (Fig. 9b) andCRE-luciferase activity (Fig. 9c) were significantly sup-pressed in siB7-H4-treated compared to siCon-treated cells.In addition, forskolin-induced phosphorylation of AMPK-αand CREB was significantly lower in B7-H4 knockdowncells (Fig. 9d). Surprisingly, forskolin treatment alsoincreased protein level of B7-H4 in siCon cell. Theseresults suggest that impairment of mitochondrial functionin siB7-H4-treated cells was mediated by the cAMP/CREB/PGC1-α pathway.

Discussion

In this study, we demonstrated that suppression of B7-H4-modulated mitochondrial mass and function promoted drugsusceptibility. We found that the phosphorylation of AMPKand CREB, the two major upstream transcriptional regulatorsof PGC1-α, were significantly suppressed, consequently re-ducing PGC1-α expression in B7-H4-depleted HeLa cells.Therefore, we propose this as the underlying mechanism to

a

siCon siB7-H4

b

UQCRC1

α-tubulin

PGC1-α

mtTFA

Bcl-XL

0

50

100

UQCRC mtTFA PGC1-α Bcl-XL

*

*

* *

siCon

siB7-H4

Pro

tein

exp

ress

ion

(% s

iCo

n)B7-H4

- ns

siCon

siB7-H4

0

20

40

60

80

100

120

*

* *

*

*

*

Rel

ativ

e m

RN

A e

xpre

ssio

n (%

siC

on

)

Fig. 6 B7-H4 knockdown downregulated expression ofmajormitochon-drial proteins. a Semi-quantitative real-time PCR analysis of expressionof indicated genes in siCon- and siB7-H4-treated cells were normalizedβ2-microgrobulin expression. bWestern analysis (left) and quantification(right) of indicated proteins in siCon- and siB7-H4-treated cells. *p<0.05vs. siCon; n=3; ns, nonspecific band; PGC1-α, peroxisome proliferator-activated receptor γ coactivator 1 alpha; mtTFA, mitochondrial transcrip-tion factor A; VDAC1, voltage-dependent anion channel 1; NDUFS1,NADH dehydrogenase (ubiquinone) Fe-S protein 1; UQCRC1,ubiquinol-cytochrome c reductase core protein 1; SOD, superoxide dis-mutase; BcL-XL, BCL2-like 1

Pflugers Arch - Eur J Physiol

the observed increase in mitochondrial dysfunction in B7-H4-depleted HeLa cells.

B7-H4, a recently identified member of the B7 family, is aninhibitor of T cell proliferation through an unidentified receptor,which suppresses antitumor immunity. It is considered a cancerbiomarker because of its wide expression in cancers, includingrenal cell carcinoma, melanoma, and gastric, ovarian, and breastcancer [13]. In a previous study, western analysis and tissuestaining showed that B7-H4 was detectable in ovarian cancersamples but not in normal ovarian tissues [27]. Coincidently,B7-H4 was highly expressed in the cervices of cervical cancerpatients but not in noncancerous cervices (Fig. 1). This suggeststhat B7-H4 might have a cancer-specific role and may be usefulas a biomarker of cervical adenocarcinoma.

In contrast to the investigated role of B7-H4 in T cells andthe immune response, relatively little is known about the role ofsoluble intracellular B7-H4 in cancer cells. In the various

cancers, B7-H4 protects the cells against apoptotic cell death,which promotes progression and proliferation of tumor cells[40, 41, 6, 7, 19]. The mechanism underlying this antiapoptoticfunction appears to involve prevention of Fas/FasL-mediatedapoptosis by intracellular B7-H4 [6, 30]. These data suggestthat B7-H4 may be involved in mitochondrial ROS generationand cell death. However, there have been no reports on the roleof B7-H4 in mitochondrial function. In the present study, wedemonstrated the involvement of B7-H4 in mitochondrial en-ergy metabolism and ROS generation, which are involved indrug susceptibility.

Mitochondria use substrates and oxygen to produce ATPthrough the highly efficient process of OXPHOS. IntracellularATP and mitochondria are known to play pivotal roles inprogression and chemoresistance in various cancers [42].

In our experiments, suppression of B7-H4 decreasedΔΨmand OCR, which consequently led to reduced ATP level

Fig. 7 B7-H4 knockdownactivates the JNK/p38 pathwayand caspase-mediated mitochon-drial cell death. a siCon (−)- andsiB7-H4 (+)-treated cells wereexposed to the indicated doses ofdoxorubicin for 24 h and analyzedby western with the indicated an-tibodies. In the absence of doxo-rubicin, B7-H4 knockdown in-creased JNK/p38 phosphoryla-tion and cleavage of caspase-3and PARP. The doxorubicin-induced JNK/p38 activation andcaspase-3 and PARP cleavagewere more pronounced in siB7-H4- than in siCon-treated cells. bOxygen consumption rate wasmeasured in siCon and siB7-H4in the presence of 0 or 1.5 μM ofdoxorubicin. c Cellular ATP levelwas analyzed in siCon and siB7-H4 in the presence of 0 or 1.5 μMof doxorubicin. *p<0.05 vs.siCon

Pflugers Arch - Eur J Physiol

(Figs. 3 and 4). Interestingly, a decrease in B7-H4 also re-duced mitochondrial mass (Fig. 3). Together with suppressedOXPHOS, siB7-H4 treatment made mitochondrial electrontransport complexes produce more ROS (Fig. 5). The decrease(10–14 %) in mitochondrial mass was relatively small incomparison to the decrease in ATP production and OCR(17–23 %), indicating that there is not only quantitative mod-ulation but also qualitative suppression of function in mito-chondria by B7-H4 knockdown. Significantly decreased com-plex III activity with the same amount of mitochondria clearlyexplained the decreased ΔΨm and OXPHOS activity andincreased ROS generation. Complex III, also known as cyto-chrome c oxidoreductase, catalyzes electron transfer fromubiquinol to cytochrome c and generates an electron gradient(ΔΨm) [18]. It is also a major ROS generation and target siteat the same time [5]. Among the 11 subunits of complex III,UQCRC1 is the most sensitive to alteration by various oxida-tive stresses, including ischemia/reperfusion injury [18]. Con-sistent with this, B7-H4 knockdown significantly decreasedUQCRC1 expression (Fig. 6). These results clearly demon-strate that siB7-H4 treatment led to impairment of mitochon-drial energy balance and oxidative stress regulation throughalteration of complex III.

Results of real time-PCR and western analyses also re-vealed reduced expression of mtTFA and PGC1-α in siB7-H4-treated cells (Fig. 6) as strong causative candidates ofmitochondrial dysfunction. PGC1-α and mtTFA are centralmodulators that regulate biogenesis, fatty acid utilization,antioxidant response, and activities of OXPHOS I, III, IV,and V complexes in mitochondria [36]. Therefore, reducedexpression of PGC1-α and mtTFA might lead to mitochon-drial dysfunction, including suppression of OXPHOS activityand increased oxidative stress. Recent studies emphasized therole of PGC1-α in cancer metabolism [35, 3]. PGC1-α pro-motes tumor growth via increased de novo lipogenesis, andloss of PGC1-α reduces tumorigenesis in colon carcinoma[35].

The role of mtTFA in the metabolism of various cancercells has been actively investigated [21, 12, 26]. The survivalof colorectal cancer patients with upregulated mtTFA expres-sion was significantly poorer than that of patients with down-regulated mtTFA expression [26]. The antiapoptotic factorBCL2L1 (Bcl-XL) has been suggested as a target gene ofmtTFA in ovarian cancer [21]. Another transcription factorof Bcl-XL is activation of CREB [22]. Likewise, the expres-sion of Bcl-XL was decreased with reduction of mtTFA and

Fig. 8 ROS inhibitor suppressedsiB7-H4-induced activation ofJNK and p38 and enhanceddoxorubicin-induced cell death. a,b Western analysis of siB7-H4-treated cells treated with the indi-cated doses of doxorubicin (Dox)and N-acetylcysteine (NAC),using the indicated antibodies. cSurvival rates of siCon- and siB7-H4-treated cells treated with theindicated doses of doxorubicinand NAC. *p<0.05 vs. siCon;n=3

Pflugers Arch - Eur J Physiol

CREB in the siB7-H4 knockdown cells. Taken together, ourresults suggest that reduced PGC1-α and mtTFA expressionprimarily caused a reduction in mitochondrial biogenesis andalso modulated the antioxidant mechanism and programmedcell death in siB7-H4 knockdown cells.

Mitochondrial ROS level was maintained by balance of ROSgeneration and removal mechanism. The manganese superoxidedismutase 2 (SOD2) is a major mitochondrial antioxidant whichcatalyzes the dismutation of superoxide to hydroperoxide(H2O2). Although SOD2 mRNA level was decreased in siB7-

H4, the protein level of SOD2 was not altered. Also, transcrip-tional level of SOD1was sustained in siB7-H4 cell. Thus, highermitochondrial superoxide level in siB7-H4 was mainly causedby increased superoxide generation in damaged complex IIIrather than impairment of scavenging mechanism.

An abundance of evidence has demonstrated thatmitochondria-derived ROS are major activators of ERK,JNK, and p38 MAPKs [23]. MAPKs, including these sub-families, modulate cancer cell survival, proliferation, andapoptosis. Molecular signaling and phosphorylation of

siCon siB7-H4a

Ph

osp

ho

: to

tal (

% s

iCo

n)

a-tubulin

P-CREB

P-AMPKαα

AMPKα

CREB

b

B7-H4

cAM

P a

ccu

mu

lati

on

Fsk (μM)

c

CR

E-L

uci

fera

se a

ctiv

ity

(%)

0 10 50 0 10 500

50

100

150

200

0

100

200

300

400

500

600

Fsk (μM) 0 10 50 0 10 50

pAMPK-α

pCREB

Fsk (μM)

AMPK-α

CREB

B7H4

0 50 0 50siCon siB7-H4

- ns

d

0

50

100

pAMPK pCREB

*

*

siCon

siB7-H4

*

**

*

pA

MP

K-α

:AM

PK

-α

0

1

2

3

Fsk (μM) 0 500 50

**

pC

RE

B:C

RE

B

Fsk (μM) 0 500

1

2

3

0 50

**

Fig. 9 siB7-H4 treatmentsuppressed phosphorylation ofAMPK-α and CREB via cAMPmodulation. a Western analysis(left) and quantitation (right) ofrelative levels of phosphorylationof AMPK-α and CREB in siCon-and siB7-H4-treated cell. b Anal-ysis of cAMP accumulation in-duced by the indicated concen-trations of forskolin (Fsk) insiCon- and siB7-H4-treated cells.c Analysis of level of CRE-luciferase gene expression in-duced by the indicated concen-trations of forskolin in siCon- andsiB7-H4-treated cells. d Westernanalysis (left) and quantitation(right) of forskolin-induced phos-phorylation of AMPK-α (top)and CREB (bottom). *p<0.05 vs.siCon; n=3; ns, nonspecific band

Pflugers Arch - Eur J Physiol

ERK, JNK, and p38 are major targets of antitumor agents [4,14]. Doxorubicin is a widely used anticancer agent thatinduces caspase-dependent apoptosis via activation ofERK, JNK, and p38 in cancer cells [28, 38]. Interestingly,a previous study demonstrated that B7-H4 treatment sup-presses the activation of ERK, JNK, and p38 MAPKs in Tcells [37]. Thus, we investigated whether increased ROSgeneration enhanced the activation of those MAPKs andthe cytotoxic effect of doxorubicin in siB7-H4-treated HeLacells. The decrease in B7-H4 significantly increased phos-phorylation of JNK and p38 in both the presence andabsence of doxorubicin at doses ranging from 0 to 1.5 μM.Activated JNK and p38 induced cleavage of PARP andcaspase-3, followed by apoptosis (Figs. 5 and 6). Weexplored whether increased oxidative stress was the majormechanism of siB7-H4-induced cell death. Treatment withthe antioxidant NAC significantly reduced sustained activa-tion of JNK and p38 and eliminated the additive effect ofsiB7-H4 treatment on doxorubicin-induced cell death(Fig. 7), suggesting that the increase in ROS plays a majorrole in siB7-H4- and doxorubicin treatment-induced apo-ptosis. To understand the mechanism of B7-H4-mediatedmitochondrial modulation, the upstream signaling pathwayof PGC1-α was validated. Phosphorylation of AMPK andCREB activated transcription of the PGC1-α gene andsubsequently increased mitochondrial biogenesis [8]. cAMPis a major modulator of CREB via PKA activity and alsoenhances AMPK phosphorylation [15]. Our results demon-strated that siB7-H4 treatment significantly reduced phos-phorylation of AMPK and CREB and forskolin-induced

cAMP production (Fig. 9), which suggests that B7-H4has a novel regulatory role in mitochondrial biogenesisvia modulation of AMPK and CREB activities. Interesting-ly, our result showed that forskolin (50 μM) treatmentincreased protein expression of B7-H4 in siCon cell butnot in siB7-H4 which may suggest that there is underlyinginteraction between transcriptional modulation of B7-H4and cAMP-mediated signaling pathway. To the best ofour knowledge, transcriptional modulation of B7-H4 hasbeen unknown to date; therefore, this finding gives usfundamental clue to understand the transcriptional regula-tion of B7-H4.

Conclusion

This study reports, for the first time, the physiological role andnovel signaling pathway of B7-H4 which modulates mito-chondrial function and induces apoptotic cell death throughregulation of ROS production. Suppression of membrane andcytosolic B7-H4 expression reduced PGC1-α and mtTFAexpression via impairment of cAMP/CREB signaling, whichresulted in impairment of mitochondrial energy metabolismand antioxidative response. Enhanced ROS production by theimpaired mitochondria sustained the activation of the JNK/p38-caspase axis and sensitized the cells to doxorubicin-induced cell death (Fig. 10). However, the exact molecularmechanism underlying B7-H4 modulation of thecAMP/CREB pathway must be addressed in a future study.

In conclusion, we revealed that cAMP/CREB/PGC1-αpathway is a novel target signaling pathway of B7-H4. Inthe clinical field, B7-H4-targeted cancer therapy will be use-ful, not only for T cell-mediated immune cytotoxicity but alsofor mitochondria-mediated apoptotic cancer cell death.

Acknowledgments This work was supported by the National ResearchFoundation of Korea (NRF), and funding was granted by the Ministry ofScience, ICT & Future Planning of Korea (R13-2007-023-00000-0,2011-0028925 and 2012R1A2A1A03007595) and by the Ministry ofEducation of Korea (2010-0020224).

Ethical standards All experimental procedures were reviewed andapproved by the Institutional Review Board of Busan Paik Hospital.

Conflict of interest The authors declare that they have no conflict ofinterest.

References

1. Arigami T, Uenosono Y, Ishigami S, Hagihara T, Haraguchi N,Natsugoe S (2011) Clinical significance of the B7-H4 coregulatorymolecule as a novel prognostic marker in gastric cancer.World J Surg35(9):2051–2057

Fig. 10 Proposed mitochondria-mediated functional role of B7-H4 inpromoting apoptosis of cancer cells. Depletion of B7-H4 suppresses thecAMP/PKA/CREB signaling pathway. This impairment reducesPGC1-α expression and downstream mitochondrial biogenesis and ex-pression of OXPHOS-modulating genes. This results in mitochondrialdysfunction, with decreased ATP production and inner membrane poten-tial and increased ROS production. The large amounts of ROS generatedactivate the JNK/P38/caspase cascade, resulting in cancer cell apoptosis

Pflugers Arch - Eur J Physiol

2. Awadallah NS, Shroyer KR, Langer DA, Torkko KC, Chen YK,Bentz JS, Papkoff J, Liu W, Nash SR, Shah RJ (2008) Detection ofB7-H4 and p53 in pancreatic cancer: potential role as a cytologicaldiagnostic adjunct. Pancreas 36(2):200–206

3. Bhalla K, Hwang BJ, Dewi RE, Ou L, Twaddel W, Fang HB, VafaiSB, Vazquez F, Puigserver P, Boros L, Girnun GD (2011) PGC1alphapromotes tumor growth by inducing gene expression programssupporting lipogenesis. Cancer Res 71(21):6888–6898

4. Brantley-Finley C, Lyle C, Du L, Goodwin M, Hall T, Szwedo D,Kaushal G, Chambers T (2003) The JNK, ERK and p53 pathwaysplay distinct roles in apoptosis mediated by the antitumor agentsvinblastine, doxorubicin, and etoposide. Biochem Pharmacol 66(3):459–469

5. Chen Q, Vazquez EJ, Moghaddas S, Hoppel CL, Lesnefsky EJ(2003) Production of reactive oxygen species by mitochondria. JBiol Chem 278(38):36027–36031

6. Chen Y, Guo G, Guo S, Shimoda S, Shroyer KR, Tang Y, Wu Y(2011) Intracellular B7-H4 suppresses bile duct epithelial cell apo-ptosis in human primary biliary cirrhosis. Inflammation 34(6):688–697

7. Cheng L, Jiang J, Gao R, Wei S, Nan F, Li S, Kong B (2009) B7-H4expression promotes tumorigenesis in ovarian cancer. Int J GynecolCancer 19(9):1481–1486

8. Fernandez-Marcos PJ, Auwerx J (2011) Regulation of PGC-1alpha, anodal regulator of mitochondrial biogenesis. Am J Clin Nutr 93(4):884S–890S

9. Galazka K, Oplawski M,WindorbskaW, Skret-Magierlo J, Koper K,Basta P, Mach P, Dutch-Wicherek M, Mazur A, Wicherek L (2012)The immunohistochemical analysis of antigens such as RCAS1 andB7H4 in the cervical cancer nest and within the fibroblasts andmacrophages infiltrating the cancer microenvironment. Am JReprod Immunol 68(1):85–93

10. Galluzzi L, Larochette N, Zamzami N, Kroemer G (2006)Mitochondria as therapeutic targets for cancer chemotherapy.Oncogene 25(34):4812–4830

11. George SE, Bungay PJ, Naylor LH (1997) Evaluation of aCRE-directed luciferase reporter gene assay as an alternativeto measuring cAMP accumulation. J Biomol Screen 2(4):235–240

12. Han B, Izumi H, Yasuniwa Y, Akiyama M, Yamaguchi T, FujimotoN, Matsumoto T, Wu B, Tanimoto A, Sasaguri Y, Kohno K (2011)Human mitochondrial transcription factor A functions in both nucleiand mitochondria and regulates cancer cell growth. BiochemBiophys Res Commun 408(1):45–51

13. He C, Qiao H, Jiang H, Sun X (2011) The inhibitory role of B7-H4 inantitumor immunity: association with cancer progression and surviv-al. Clin Dev Immunol 2011:695834

14. Hu R, Kim B, Chen C, Hebbar V, Kong ANT (2003) The roles ofJNK and apoptotic signaling pathways in PEITC-mediated responsesin human HT-29 colon adenocarcinoma cells. Carcinogenesis 24(8):1361–1367

15. Hutchinson DS, Chernogubova E, Dallner OS, Cannon B, BengtssonT (2005)β-Adrenoceptors, but not α-adrenoceptors, stimulate AMP-activated protein kinase in brown adipocytes independently ofuncoupling protein-1. Diabetologia 48(11):2386–2395

16. Jeong S, Song I, Kim H, Lee S, Song S, Suh H, Yoon Y, Yoo Y, KimN, Rhee B, Ko K, Han J (2012) An analogue of resveratrol HS-1793exhibits anticancer activity against MCF-7 cells via inhibition ofmitochondrial biogenesis gene expression. Mol Cell 34(4):357–365

17. Kang S, Kim N, Joo H, Youm JB, Park W, Warda M, Kim H, CuongD, Kim T, Kim E, Han J (2005) Changes of cytosolic Ca2+ undermetabolic inhibition in isolated rat ventricular myocytes. Korean JPhysiol Pharmacol 9(5):291–298

18. Kim H, Thu VT, Heo HJ, Kim N, Han J (2011) Cardiac proteomicresponses to ischemia-reperfusion injury and ischemic precondition-ing. Expert Rev Proteomics 8(2):241–261

19. Krambeck AE, Thompson RH, Dong H, Lohse CM, Park ES, KuntzSM, Leibovich BC, Blute ML, Cheville JC, Kwon ED (2006) B7-H4expression in renal cell carcinoma and tumor vasculature: associa-tions with cancer progression and survival. Proc Natl Acad Sci U S A103(27):10391–10396

20. Kryczek I, Zou L, Rodriguez P, Zhu G, Wei S, Mottram P, BrumlikM, Cheng P, Curiel T, Myers L, Lackner A, Alvarez X, Ochoa A,Chen L, Zou W (2006) B7-H4 expression identifies a novel suppres-sive macrophage population in human ovarian carcinoma. J ExpMed203(4):871–881

21. Kurita T, Izumi H, Kagami S, Kawagoe T, Toki N, Matsuura Y,Hachisuga T, Kohno K (2012) Mitochondrial transcription factor Aregulates BCL2L1 gene expression and is a prognostic factor inserous ovarian cancer. Cancer Sci 103(2):239–444

22. Lee BS, Kim SH, Jin T, Choi EY, Oh J, Park S, Lee SH, Chung JH,Kang SM (2013) Protective effect of survivin in doxorubicin-inducedcell death in h9c2 cardiac myocytes. Korean Circ J 43(6):400–407

23. McCubrey JA, Lahair MM, Franklin RA (2006) Reactive oxygenspecies-induced activation of the MAP kinase signaling pathways.Antioxid Redox Signal 8(9–10):1775–1789

24. Modica-Napolitano JS, Singh K (2002) Mitochondria as targets fordetection and treatment of cancer. Expert Rev Mol Med 4(09):1–19

25. Morse M, Tran E, Sun H, Levenson R, Fang Y (2011) Ligand-directed functional selectivity at the mu opioid receptor revealed bylabel-free integrative pharmacology on-target. PLoS ONE 6(10):e25643

26. Nakayama Y, Yamauchi M, Minagawa N, Torigoe T, Izumi H,Kohno K, Yamaguchi K (2012) Clinical significance of mitochon-drial transcription factor A expression in patients with colorectalcancer. Oncol Rep 27(5):1325–1330

27. Salceda S, Tang T, Kmet M, Munteanu A, Ghosh M, Macina R, LiuW, Pilkington G, Papkoff J (2005) The immunomodulatory proteinB7-H4 is overexpressed in breast and ovarian cancers and promotesepithelial cell transformation. Exp Cell Res 306(1):128–141

28. Sauter KA, Magun EA, Iordanov MS, Magun BE (2010) ZAK isrequired for doxorubicin, a novel ribotoxic stressor, to induce SAPKactivation and apoptosis in HaCaT cells. Cancer Biol Ther 10(3):258–266

29. Sica GL, Choi IH, ZhuG, TamadaK,Wang SD, Tamura H, ChapovalAI, Flies DB, Bajorath J, Chen L (2003) B7-H4, a molecule of the B7family, negatively regulates T cell immunity. Immunity 18(6):849–861

30. Song H, Park G, Kim YS, Hur I, Kim H, Ryu JW, Lee HK, Cho DH,Choi IH, Lee WJ, Hur DY (2008) B7-H4 reverse signaling inducesthe apoptosis of EBV-transformed B cells through Fas ligand up-regulation. Cancer Lett 266(2):227–237

31. Song IS, Ha GH, Kim JM, Jeong SY, Lee HC, Kim YS, Kim YJ,Kwon TK, Kim NS (2011) Human ZNF312b oncogene is regulatedby Sp1 binding to its promoter region through DNA demethylationand histone acetylation in gastric cancer. Int J Cancer 129(9):2124–2133

32. Song IS, Kim HK, Lee SR, Jeong SH, Kim N, Ko KS, RheeBD, Han J (2013) Mitochondrial modulation decreases thebortezomib-resistance in multiple myeloma cells. Int JCancer 133(6):1357–1367

33. Song IS, Kim SU, Oh NS, Kim J, Yu DY, Huang SM, Kim JM, LeeDS, Kim NS (2009) Peroxiredoxin I contributes to TRAIL resistancethrough suppression of redox-sensitive caspase activation in humanhepatoma cells. Carcinogenesis 30(7):1106–1114

34. Tringler B, Zhuo S, Pilkington G, Torkko KC, Singh M, LuciaMS, Heinz DE, Papkoff J, Shroyer KR (2005) B7-h4 is highly

Pflugers Arch - Eur J Physiol

expressed in ductal and lobular breast cancer. Clin Cancer Res11(5):1842–1848

35. Vazquez F, Lim J-H, Chim H, Bhalla K, Girnun G, Pierce K, ClishClary B, Granter Scott R, Widlund Hans R, Spiegelman Bruce M,Puigserver P (2013) PGC1-alpha expression defines a subset ofhuman melanoma tumors with increased mitochondrial capacityand resistance to oxidative stress. Cancer Cell 23(3):287–301

36. Ventura-Clapier R, Garnier A, Veksler V (2008) Transcriptionalcontrol of mitochondrial biogenesis: the central role of PGC-1α.Cardiovasc Res 79(2):208–217

37. WangX, Hao J,Metzger DL, AoZ, Chen L, OuD, Verchere CB,MuiA, Warnock GL (2012) B7-H4 treatment of T cells inhibits ERK,JNK, p38, and AKT activation. PLoS ONE 7(1):e28232

38. Wang X, Martindale JL, Holbrook NJ (2000) Requirement for ERKactivation in cisplatin-induced apoptosis. J Biol Chem 275(50):39435–39443

39. Widlansky ME, Wang J, Shenouda SM, Hagen TM, Smith AR,Kizhakekuttu TJ, Kluge MA, Weihrauch D, Gutterman DD, VitaJA (2010) Altered mitochondrial membrane potential, mass, andmorphology in the mononuclear cells of humans with type 2diabetes. Transl Res 156(1):15–25

40. ZhangL,WuH, LuD, LiG, SunC, SongH, Li J, Zhai T,HuangL,HouC,WangW, Zhou B, Chen S, Lu B, Zhang X (2013) The costimulatorymolecule B7-H4 promote tumor progression and cell proliferationthrough translocating into nucleus. Oncogene 32(46):5347–5358

41. Zheng X, Li XD, Wu CP, Lu BF, Jiang JT (2012) Expression ofcostimulatory molecule B7-H4 in human malignant tumors.Onkologie 35(11):700–705

42. Zhou Y, Tozzi F, Chen J, Fan F, Xia L,Wang J, Gao G, Zhang A, XiaX, Brasher H, Widger W, Ellis LM, Weihua Z (2012) IntracellularATP levels are a pivotal determinant of chemoresistance in coloncancer cells. Cancer Res 72(1):304–314

Pflugers Arch - Eur J Physiol