BIOTECHNOLOGICAL PRODUCTS AND PROCESS ENGINEERING

Autodisplay of an archaeal γ-lactamase on the cell surfaceof Escherichia coli using Xcc_Est as an anchoring scaffoldand its application for preparation of the enantiopure antiviraldrug intermediate (−) vince lactam

Jianjun Wang & Guogang Zhao & Zhiwei Zhang &

Qiulin Liang & Cong Min & Sheng Wu

Received: 18 November 2013 /Revised: 30 January 2014 /Accepted: 17 March 2014# Springer-Verlag Berlin Heidelberg 2014

Abstract At present, autotransporter protein mediated sur-face display has opened a new dimension in the developmentof whole-cell biocatalysts. Here, we report the identification ofa novel autotransporter Xcc_Est from Xanthomonascampestris pv campestris 8004 by bioinformatic analysisand application of Xcc_Est as an anchoring motif for surfacedisplay of γ-lactamase (Gla) from thermophilic archaeonSulfolobus solfataricus P2 in Escherichia coli. The localiza-tion of γ-lactamase in the cell envelope was monitored byWestern blot, activity assay and flow cytometry analysis.Either the full-length or truncated Xcc_Est could efficientlytransport γ-lactamase to the cell surface. Compared with thefree enzyme, the displayed γ-lactamase exhibited optimumtemperature of 30 °C other than 90 °C, with a substantialdecrease of 60 °C. Under the preparation system, theengineered E. coli with autodisplayed γ-lactamase converted100 g racemic vince lactam to produce 49.2 g (−) vince lactamat 30 °C within 4 h. By using chiral HPLC, the ee value of the

produced (−) vince lactam was determined to be 99.5 %. Thewhole-cell biocatalyst exhibited excellent stability under theoperational conditions. Our results indicate that the E. coliwith surface displayed γ-lactamase is an efficient and eco-nomical whole cell biocatalyst for preparing the antiviral drugintermediate (−) vince lactam at mild temperature, eliminatingexpensive energy cost performed at high temperature.

Keywords Autotransporter . Surface display . γ-Lactamase

Introduction

The synthesis of chiral compounds is increasingly in demand inthe industries of fine chemical, pharmaceutical, and agrochem-ical (Brooks et al. 2011; Dunn 2012). Featured by its powerfulcatalytic activity and usually high chemo-, regio- and stereo-selectivity without protecting and deprotecting steps as neces-sary in conventional organic synthesis, enzyme-based biocatal-ysis has received much more attention with regard to thesynthesis of optically pure building blocks as well as biochem-ically active compounds, offering the development of moreenvironmentally and economically attractive processes(Savile et al. 2010; Desai 2011; Farina et al. 2006).

Escherichia coli is, by far, the most widely used host forproduction of enzymes in biotechnology. Usually, the recom-binant enzymes are produced intracellularly or extracellularlyand recovered by tedious multi-step purification procedures.The use of enzymes displayed on the living cell surface pro-vides several advantages in biotechnological applications (Joseet al. 2012; van Bloois et al. 2011; Wilhelm et al. 2011; Kimet al. 2009).The surface-displayed enzyme can be more conve-niently used and recovered in the practice than that as a free

J. Wang and G. Zhao contributed equally to this paper.

Electronic supplementary material The online version of this article(doi:10.1007/s00253-014-5704-9) contains supplementary material,which is available to authorized users.

J. Wang : Z. Zhang :Q. Liang :C. Min : S. Wu (*)State Key Laboratory of Microbial Resources, Institute ofMicrobiology, Chinese Academy of Sciences, Beijing 100101, Chinae-mail: shengwu@im.ac.cn

J. Wange-mail: wangjj@im.ac.cn

G. ZhaoDepartment of Internal Medicine University of Kentucky School ofMedicine, Lexington, KY 40536, USA

Z. Zhang :Q. LiangUniversity of Chinese Academy of Sciences, Beijing 100049, China

Appl Microbiol BiotechnolDOI 10.1007/s00253-014-5704-9

form and the substrates can freely access the surface displayedenzyme without the need to cross a membrane barrier.

Among the reported surface display systems includingphage (Li and Caberoy 2010), yeast (Chen et al. 2011),gram-positive and gram-negative bacteria (Knobloch et al.2012; Lum et al. 2012), the autodisplay system is the mostelegant and simplest one. This system utilizes autotransporterproteins, usually outer membrane protein like AIDA-I, IcsA,and EstA, as anchor scaffold protein (Jose et al. 2012). TAtypical autotransporter is a multi-domain protein composed ofan N-terminal signal peptide (SP), a passenger domain, alinker sequence and a C-terminal β barrel domain (Fig. 1a).To display an exogenous protein, the coding sequence for theendogenous passenger domain usually needs to be replaced bythe gene of interest, and then applied for routine expressionwork. he autodisplay system has been successfully used forthe surface display of various recombinant proteins, e.g., β-lactamase (Lattemann et al. 2000), esterase (Schultheiss et al.2002; Schultheiss et al. 2008), sorbitol dehydrogenase (Joseand von Schwichow 2004a,b), nitrilase (Detzel et al. 2011)and human hyaluronidase (Kaessler et al. 2011). Very recently,Jose and his co-workers successfully displayed active en-zymes with prosthetic groups like P450 enzymes on E. colicell surface, and they illustrated that passenger protein, whichexisted in an unfolded form in the cytoplasm, passed throughthe β-barrel structure and folded at the cell surface and incor-porated heme groups which was synthesized in the cytoplasmand exported to the outer of cell membrane by a specific effluxsystem (Schumacher et al. 2012; Schumacher and Jose 2012).Autodisplay of active enzymes with prosthetic group furtherexpanded the applications of this powerful technology.

Chiral bicyclic vince lactam (2-azabicyclo[2.2.1]hept-5-en-3-one) is a vital building block used in the medical andnon-medical research areas (Singh and Vince 2012). Itsunique bicyclic structure furnished high chemical reactivity.

Breaking the amide bond could open the heterocyclic frame-work and provide a cyclopentane ring template. The olefinicbond in the second five-member ring, allowed the molecule toundergo various chemical reactions such as epoxidation, hy-droxylation, halogenation, aziridation, and selenylation(Singh and Vince 2012). Chiral (−) vince lactam was used asa key building block to synthesize the commercial drugabacavir and peramivir, which was the inexorable componentsof chemotherapy in treatment of the fatal disease AIDS andinfluenza (Ison 2011; Shetty and Peek 2012). Chiral vincelactam was also used to synthesize other clinical drug candi-dates and develop new organic synthesis methodology (Singhand Vince 2012). Compared to complicated chemical synthe-sis, kinetic resolution of racemic vince lactam byenantioselective γ-lactamase is a more efficient biocatalyticprocess. Up to date, only several γ-lactamases have beencloned and characterized (Taylor et al. 1999; Line et al. 2004;d’Abusco et al. 2001; Zhu et al. 2012). Recently, the esterasefrom Pseudomonas fluorescens was found to have promis-cuous γ-lactamase catalytic activity (Torres et al. 2012).Among all the known γ-lactamases, the (+) γ-lactamase fromthe archaeon S. sofataricus P2 attracts special interest due to itshigh enantioselectivity and thermostability as well as widesubstrate acceptance (d’Abusco et al. 2001;TTaylor et al.1993; Toogood et al. 2004; Wang et al. 2011). The enzymewas also immobilized within a capillary column micro-reactorfor substrate screening experiments (Hickey et al. 2009).

In this study, we reported a novel autotransporter proteinXcc_Est from the plant model pathogen Xanthomonascampestris pv campestris 8004, which was identified by bio-informatic analysis and applied to construct a heterogeneousprotein autodisplay system. Using this system, we de-veloped a whole cell biocatalyst for kinetic resolution ofracemic vince lactam to prepare chiral (−) vince lactamefficiently and economically.

Fig. 1 Schematic representationsof the construction of Xcc_Estautotransporter (a) and γ-lactamase autodisplay vectorpDxcc_estgla andpDxcc_est285gla (b). SpXcc_Estsignal peptide, His6 six-histidine-tag, Gla γ-lactamase fromS. sulfolobus P2. Point mutation ismarked in grey, and insertionmutation is marked in black; MMet, A Ala, D Asp,H His, I Ile, LLeu, P Pro

Appl Microbiol Biotechnol

Materials and methods

Bacterial strains, plasmids and culture conditions

X. campestris pv campestris 8004 was provided by Prof QianWei (China General Microbiological Culture Collection[CGMCC]; collection number 1.1781). E. coliDH5αwas usedas gene cloning host. E. coli rosetta (DE3) was utilized as usualprotein expression and surface display studies. Plasmid pET30a(+) carrying both N-terminal and C-terminal His-tag was usedas the parent vector for construction and expression of therecombinant proteins. Sulfolobus solfataricus P2 genomicDNAwas obtained from the American Type Culture Collection(ATCC; Manasas, VA, USA; catalog number 35092).

X. campestris pv campestris 8004 was grown under aero-bic conditions with shaking (200 rpm) at 30 °C in Luria–Bertani (LB) media. After cultivation for 24 h, cells wereharvested by centrifugation for the preparation of genomicDNA according to the procedure described by themanufacturer(Tiangen, Beijing, China). The recombinant E. coli was culti-vated in LB media supplemented with 50 mg/ml kanamycin at37 °C. For protein expression, overnight culture (5 ml) wastransferred into 500 ml fresh LBmedia and grown to an opticaldensity (OD580) of 0.8. The recombinant protein was inducedby addition of isopropyl- β-D-thiogalactopyranoside (IPTG) ata final concentration of 0.1 mM to the culture broth, and thecells were incubated for an additional 5 h at 37 °C and collectedby centrifugation at 4,000×g for 10 min at 4 °C.

Recombinant DNA techniques

PCR, restriction digestion, ligation, and agarose geleletrophoresis were performed following standard procedures ifnot specifically mentioned. Site-directed mutagenesis was car-ried out following the Quick-Change protocol. DNA sequencingwas used to verify the correctness of gene modification. All thePCR primers used in this study were listed in Table 1.

Gene xcc_est (see Online resource 1) encoding the GDSLesterase Xcc_Est was amplified from genomic DNA ofX. campestris pv. campestris 8004 using the primer P1 andP2 with NdeI and SacI sites, respectively. The PCR protocolwas consisted of an initial denaturation step of 5 min at 95 °C,followed by 30 cycles of 1 min at 95 °C, 1 min at 53 °C, 2 minat 72 °C and ending with a final elongation step for 10 min at72 °C. The PCR product was digested withNdeI and SacI andthen inserted into the corresponding sites of pET30a (+) andthe recombinant plasmid was named as pETxcc_est. Gene gla(GenBank Accession No: AF290611) encoding the γ-lactamasewas amplified fromgenomicDNAof S. solfataricusP2 using the primers P6 and P7 with NdeI and SacI sites,respectively. The PCR protocol and cloning procedures werethe same as described above in the xcc_est gene operation, andthe final plasmid was named as pETgla. The construction of

autotransporter vector pDxcc_est285gla and pDxcc_estglawas described in details in the text.

Cell fractionation preparation and Western blot analysis

For cell memebrane preparation, E. coli rosetta (DE3) cellsharboring pDxcc_estgla and pDxcc_est285gla were culturedas described above and harvested by centrifugation (4,000×g,10 min, 4 °C). The pellets were resuspended in 50 mM Tris–HCl (pH 8.0). Different cell fractionations were preparedbased on the method of Hantke (Hantke 1981). Briefly,1.5 ml cell suspensions were added with 0.1 ml of 1 Msaccharose, 0.1 ml of 10 mM EDTA, 0.1 ml of lysozyme(2 mg ml−1) and 3.2 ml of ddH2O sequentially. The cellsuspension was incubated at room temperature untilspheroblasts could be detected by microscopy. Then, finalconcentration of 0.5 nM phenylmethanesulfonylfluoride and1 μg ml−1 aprotinin were added. After the addition of 5 ml ofextraction buffer (50 mM Tris–HCl, pH 8.0, 2 % TritonX-100 , 10 mM MgCl2 ) and 100 μ l o f DNase(100 mg ml−1), the suspension was incubated in ice for atleast 20 min, until a remarkable reduction in viscosity wasdetectable. After centrifugation at 1,500×g at 4 °C for 5 min,the supernatant was whole cell lysate. To obtain the membranefractions, the supernatant was centrifuged at 25,000×g at 4 °Cfor 120 min. The resulting supernatant contained the cyto-plasm proteins, and the membranes precipitate. The pelletedmembranes were separated into a cytoplasm membrane frac-tion and an outer membrane fraction by washing with 1 %N-laurylsarcosine in PBS then centrifugation (Filip et al. 1973).After centrifugation at 25,000×g at 4 °C for 120 min, thecytoplasm membrane proteins were in the supernatant, andthe outer membrane proteins were in the sediment. The

Table 1 Primers used in this study

Name Sequence (5′–3′)a

P1 fw GGAATTCCATATGGCTTCAACCCTTCGCCCGATCCG

P2 rv CGAGCTCTTAGAAGTTGCCGCTGAAGTTC

P3 fw CGAGCTCCACCCCACCACGGCCACCC

P4 rv CCGCTCGAGTTAGAAGTTGCCGCTGAAGTTC

P5 fw CGAGCTCATGGCTTCAACCCTTCGCCCGATCCG

P6 fw GGGAATTCCATATGGAATTAAGTTACCCACATT

P7 rv CGAGCTCTTTTTTGATTCTCTCAAATACATT

P8 fw CATGCCATGGCACACCACCACCACCACCACGGAATTAAGTTACCCACATTG

P9 fw GCCAGCCCGGCCATGGCCATGGGAATT

P10 rv AATTCCCATGGCCATGGCCGGGCTGGC

P11fw

CGGCCAGCCCGGCCATGGCCATGGG

P12 rv CCCATGGCCATGGCCGGGCTGGCCG

aRestriction sites are underlined

Appl Microbiol Biotechnol

periplasmic proteins (PP), the cytoplasm proteins (CP), andthe outer membrane proteins (OM) were dissolved in Tris–HCl buffer (50 mM, pH 8.0). E. coli OmpA protein waschosed as the outer membrane marker in cell fractionation.

Protein concentration was determined using the BCA Pro-tein Assay Kit (Pierce, Rockford, IL, USA) with bovine serumalbumin (BSA) as a standard. SDS-PAGEwas performedwitha 6 % polyacrylamide stacking gel and a 12% polyacrylamideseparating gel and the proteins were visualized withCoomassie Brilliant Blue staining. For use of Western blotanalysis, the separated proteins on unstained gel after SDS-PA G E w e r e e l e c t r o - t r a n s f e r r e d o n t o apolyvinylidenedifluoride (PVDF) membrane (Millipore, Bil-lerica, MA, USA) with a tank transfer system(Tanon, Shang-hai, China). The blotted membranes were blocked over-night in PBST blocking buffer (60 mM Na2HPO4,10 mM NaH2PO4, 100 mM NaCl, 0.2 % Tween 80,and 5 % milk powder). Immunodetection was performedby incubating the membranes with anti-His-tag mouseantibody (Tiangen, Beijing, China) or anti-OmpA mouseantibody (Antibody Research, St. Charles, MO, USA)diluted 1:1,000 in PBST blocking buffer at 4 °C for16 h. The immunoblots were rinsed three times withPBST, and the secondary antibody (rabbit anti-mouseIgG coupled with alkaline phosphatase (Promega, Wis-consin, USA) diluted 1:1,000 in PBST blocking buffer)was added for 1 h. After three washes with PBST, themembrane was incubated with the Western Blue Stabi-lized Substrate Solution (Promega) for visualizing thetarget proteins.

Flow cytometric analysis

Recombinant E. coli cells were grown as described above.The cells were washed three times with phosphate-bufferedsaline (PBS, 50 mM, pH 7.0), and resuspended with 1 ml of50 mM PBS to a final OD580 of 0.5 for further experiments.Subsequently, the cells were incubated with mouse anti-His-tag antibody (diluted 1:5,000 in PBS) for 1 h at room temper-ature. After centrifugation the pellets were washed three timeswith PBS, and were incubated with anti-mouse IgG secondaryantibody conjugated to FITC (Sigma, Milwaukee, WI, USA)for 1 h at room temperature. After washing three times withPBS, the cell pellets were finally resuspended in 1.5 ml PBS toa final concentration of 0.05 at OD580. The samples weresubjected to flow cytometric analysis with a FACSCaliburCytometer (Becton Dickinson, Heidelberg, Germany) using488 nm as the excitation wavelength and FACS-FLOW(Becton Dickinson, Heidelberg, Germany) as sheath fluid.The emission wavelength was 525 nm. The threshold triggerwas set on side scatter to eliminate background noise and onlyanalyze the intact cells.

Enzyme assay

The relationship between OD580 and dry cell weight of theE. coli cells was determined as follows. First, 1 ml of culturebroth (OD580=1) was centrifuged to harvest cells. The super-natant was discarded, and the cell pellet was washed twice in1 ml PBS buffer (50 mM, pH 7). Then, the sample wascentrfiuged and the supernatant was discarded again. The cellpellet was dried at 80 °C for 2 days to constant weight. As aresult, an OD580 of 1.0 was equivalent to 0.31±0.03 g l

−1 cells(dry cell weight) based on five independent experiments.

The standard hydrolysis reactions of vince lactam catalyz-ing by whole cells were performed in the PBS buffer (50 mM,pH 7.0) in a total volume of 0.5 ml. After growth of the cells asdescribed above, the cells were harvested by centrifugationand washed twice in the PBS buffer. Afterwards the OD580

was adjusted to 4. The reactions were initiated by addition ofracemic vince lactam to a final concentration of 4.6 mM. Thereaction tubes were incubated at 30 °C in a thermomixer(Eppendorf, Hamburg, Germany) for 30 min at 600 rpm andstopped by centrifugation of the whole cell biocatalyst for2 min at 12,000 rpm. Ethyl acetate containing 1 mMbenzamide as the internal standard was added into the super-natant to extract the unreacted substrate. The organic layerwas directly analyzed by using Chiral HPLC. One unit ofenzyme activity was defined as the amount of intact cells(mg, dry weight) hydrolyzing 1 μmol of vince lactam permin under the reaction conditions. Glucose-6-phosphate de-hydrogenase (GDH) was used as a cytoplasmic marker en-zyme (Smet et al.1978). GDH assays of the cell fractions wereperformed as described (Wilhelm et al. 1999). One unit ofGDH activity was defined as the amount of enzyme requiredto catalyze the reduction of 1 μmol of NADP+ per min at37 °C under the experimental conditions. Three repllicantsof each measurement were conducted for all the exper-iments and the data was analyzed with GraphPad Prism5 (La Jolla, CA, USA).

Chiral HPLC analytic method

The conversion rate, yield and enantiomeric excess (ee) of thevince lactam were determined by HPLC (Waters, Massachu-setts, USA) equipped with a Daicel CHIRALPAK AS-Hcolumn (250×4 mm; Daicel Chemical Industries, Tokyo,Japan). A mixture of hexane and isopropyl alcohol with avolume ratio of 90:10 was used as mobile phase at a flow rateof 0.6 ml min−1. The remaining vince lactam was detected bymeasuring absorbance at 230 nm using a UV–VIS detector(486 series; Waters). The retention times of benzamide, (+)vince lactam, and (−) vince lactam were 5.9, 7.9, and 9.7 min,respectively. The ee is defined as 100×(A−B)/(A+B), where Aand B are the amounts of two enantiomers of vince lactam.

Appl Microbiol Biotechnol

Results

Construction of an artificial signal peptide

The plasmid pETxcc_est was cleaved with NcoI and SacI toremove the sequence coding passenger and membrane do-main. The remaining 73-bp signal peptide sequence was fusedwith NcoI/SacI double digested γ-lactamase gene gla, whichwas amplified from pETgla using primer P7 and P8 andresulted in pETsp_gla, where six histidines (His-tag) wasadded at the N terminus of γ-lactamase. Because the signalpeptide sequence was truncated after double digestion withNcoI and SacI, T71C replacement and two cytidines insertionat positions as indicated in Fig. 1b were performed usingpETsp_gla as the template by site-directed mutagenesis meth-od with the primer P11 and P12 as well as P9 and P10,respectively, resulting in Met24Thr mutation and the originalNcoI site elimination as well as a new NcoI site occurrence(Fig. 1b). The plasmid was designated as pETspgla. Thea r t i f i c i a l s i g n a l p e p t i d e s e q u e n c e w a sMASTLRPIRSLMAVAIALAASPATA. Prediction bySignaIP program (Petersen et al. 2011) indicated the artificialsignal peptide could function properly. Furthermore we con-ducted amino (N) terminal sequencing to prove the result (seeOnline resource 2). The pETspgla plasmid was expressed inE. coli rosetta (DE3), and the recombinant protein was puri-fied and applied for N-terminal sequencing. The sequencingresults showed the first two amino acids were methionine andglycine, which indicated the artificial signal peptide was cleftby E. coli signal peptidase between Ala25 and Met26(Fig. 1b). The result also proved that in the first few positionsof the mature protein, the prokaryotes show preferences forAla and negatively charged amino acids but not confined tothose amino acids exclusively (Nielsen et al. 1997).

Construction of cell surface display system

The 966-bp sequence coding a helical linker and β-barreldomain of the Xcc_Est autotransporter was amplified frompETxcc_est using the primer P3 and P4 and inserted into theSacI and XhoI sites of pETspgla. This constructed recombi-nant vector was named as pDxcc_est285gla, which containedall the typical structure needed for autodisplay: an artificialsignal peptide at N terminus, the γ-lactamase passenger, ahelical linker and the β-barrel. In the vector pDxcc_est285gla,the original esterase passenger was replaced by γ-lactamase,which was a common strategy in construction of the surfacedisplay system considering the limitations of protein trans-membrane transport capability of the most autotransportersystems. To determine the transport capacity of the predictedautotransporter Xcc_Est, we constructed an additional γ-lactamase autodisplay vector pDxcc_estgla in a same way asabove, in which the gla gene (amplified by P7 and P8) was

inserted between the artificial signal peptide sequence and theesterase Xcc_Est passenger sequence (amplified by P4 andP5) to form a gla–est fusion passenger. The cell surfacedisplayed mature proteins encoded by pDxcc_est285gla andpDxcc_estgla had the calculated molecular weight of 56 and117 kDa, respectively, without signal peptide.

Surface display γ-lactamase

The two autotransporter vectors pDxcc_est285gla andpDxcc_estgla were transformed into E. coli rosetta (DE3)cells, and the recombinant stains were grown to an opticaldensity of 0.8 and induced by adding 0.1 mM IPTG. E. colirosetta (DE3) was chosen as the expression strain because inthe strain the displayed enzyme showed higher specific activ-ity than in other strains such as E. coli (DE3) (data not shown),because there were many rare codons that existed in the glagene (Novy et al. 2001). The differential cell fractions wereprepared and subjected to Western blot analysis. The E. coliOmpA protein was used as the outer membrane marker (Lang2000) inWestern blot. As shown in Fig. 2a, the majority of theXcc_EstGla fusion protein existed in the outer membrane anda small amount was observed in the cytoplasm. No fusionprotein was found in the periplasm. The degradation of theXcc_EstGla was observed at some level and it could beoccurred during the process of cell fraction preparation. Tofurther determine the location of expressed γ-lactamase, theactivity of the different cell fractions for hydrolyzing vincelactamwas measured at 30 °Cwith the intracellular glucose-6-phosphate dehydrogenase (GPD) as the cytoplasmic marker(Smet et al.1978). Figure 2c showed that the majority ofactive γ-lactamase was located in the outer membrane.According to the autotransporter transport theory thatthe passenger domain passed through the centre of theautotransporter β-barrel in an unfolded (inactive) formand then folded into the mature structure (Jose et al.1995; Pohlner et al. 1987; Schumacher et al. 2012),minor amount of active Xcc_EstGla in the cytoplasmcould be caused by the contamination of outer mem-brane proteins during the cell components fractionation.

Flow cytometry experiments were subsequently performedto confirm that γ-lactamase was located on the cell surface ofthe E. coli rosetta (DE3). Cells without and with the γ-lactamase containing plasmid, pDxcc_estgla andpDxcc_est285gla were incubated with mouse anti-His-tagantibody, which was too large to cross the outer membraneand specifically bound with γ-lactamase on the cell surfacewith a His-tag at its N terminus. As shown in Fig. 3, the meanfluorescence of cells expressing Xcc_EstGal andXcc_Est285Gal fusion proteins were approximately 100 timeshigher than the E. coli rosetta (DE3) control. This indicatedthat the γ-lactamase was accessible at the cell surface andsurface display of the γ-lactamase by either the full-length or

Appl Microbiol Biotechnol

truncated Xcc_Est atuotransporter in E. coli was successful.The number of Gla molecular on each E. coli cell surface wasestimated to be 2.1×105 by activity analysis (see Online re-sources 3 and 4). However, the number was probably muchhigher than its actual value because Gla in cytoplasma wasalso active (Table 2, Fig. 2b). According to the results of thetitration of antibody binding sites experiments (Wentzel et al.2001; see Online resource 5), the number of Gla molecular oneach E. coli cell surface was estimated to be 1.5×105 (seeOnline resource 5).

Enzymatic activity of surface displayed γ-lactamase

The γ-lactamase from the archaeon S. solfataricus P2 showedexcellent thermostability and enatioselectivity. The catalyticproperties of this purified enzyme had been well characterizedand its optimum temperature was 90 °C. To determine theactivity of surface displayed γ-lactamase, harvested cells after

IPTG induction was used to react with (±) vince lactam andwas subjected to chiral HPLC analysis. Unfortunately, thereduction of the substrate catalyzed bywhatever E. coli rosetta(DE3) pDxcc_es tg l a o r E. co l i r o se t t a (DE3)pDxcc_est285gla, could only been detected at very low level.When the reaction time extended to 24 h, the conversion ratewas less than 3 %. On the contrary, the conversion ratereached nearly 50%when E. coli rosetta (DE3) pETgal wholecells were used at 90 °C for 4 h, in which the γ-lactamase wasexpressed in cytoplasm. To check whether the enzyme’spH–activity profile or temperature–activity profile waschanged after it was displayed on the cell surface, weperformed some relevant experiments under the standardreaction conditions. As showed in Fig. 4, the optimumtemperature of the E. coli rosetta (DE3) pDxcc_estglacells was 30 °C, shifted dramatically compared to 90 °Cof the cells harboring pETgla, while the optimum pHshift was not observed. E. coli rosetta (DE3)

Fig. 3 Flow cytometry analysis of the displayed γ-lactamase on theE. coli cell surface mediated by full-length (a) and truncated (b) Xcc_Est.The IPTG induced cells were successively incubated with anti-His-tagantibody, FITC-linked goat anti-mouse IgG secondary antibody and then

subjected to flow cytometry analysis. The negative control in blank isE. coli BL21 rosetta (DE3) without plasmid. E. coli cells harboringpDxcc_estgla (a) and pDxcc_est285gla (b) are shown in grey

Fig. 2 Expression of γ-lactamase fusion protein and subcellular localiza-tion in E. coli cells. Immunoblotting of cellullar fractions with anti-His-tag(a) and anti-OmpA antibodies (b). Lane M protein marker, lane 1 periplas-mic (PP) fraction, lane 2 cytoplasm (CP) fraction, lane 3 outer membrane(OM) fraction. c Activities of γ-lactamase and glucose-6-phosphate dehy-drogenase (GDH) in cellular compartments of E. coli rosetta (DE3)

pDxcc_estgla. The relative activities present in the fractions of CP, PPand OM are given. The GDH-specific activity (1.1±0.1 U/mg) in the CPfraction is taken as 100 % relative activity. The specific activity of the OMfraction (15±0.2 U/mg) is taken as 100 % relative activity of (+) γ-lactamase

Appl Microbiol Biotechnol

pDxcc_est285gla cells also exhibited a similar tempera-ture profile with 60 °C decrease in optimum temperature(data not shown). When (±) vince lactam was incubatedwith autodisplayed γ-lactamase at 30 °C for 30 min, thehydrolysis activities of E. coli rosetta (DE3) Xcc_EstGlaand E. coli rosetta (DE3) Xcc_Est258Gla were 185±11and 105±6.5 U/mg dry cell weight, respectively, whilethe control of E. coli rosetta (DE3) pETgal, in whichthe enzyme was expressed in free form in the cyto-plasm, only showed 92±7.2 U/mg dry weight cells at30 °C.

Enzymatic kinetics

To determine the suitable whole cell biocatalyst amountin the kinetic study, hydrolysis of racemic vince lactamwas studied in 0.5 ml volume and at 30 °C for 10 minby varying the whole cell concentrations in the range of1.0≤OD≤25. The whole cell suspension of OD580=17.7, which was equivalent to 5.3 g/l dry cell weight,was chosen as the biocatalyst amount, ensuring theconversion rate was less than 10 % for accurately cal-culating the initial velocity. To further estimate thekinetic parameters of the reaction system, (±) vincelactam substrate concentration ranging from 4.6 to32.2 mM was used to perform the reaction. The appar-ent maximal hydrolysis rate (Vmax) and apparentMichaelis constant (Km) were calculated by nonlinear

regression analysis with GraphPad Prism 5 (La Jolla,CA, USA). As showed in Table 2, three types of wholecell biocatalysts exhibited the similar affinity towardsvince lactam, but the maximal hydrolysis rate greatlyvaried. The whole cell with γ-lactamase autodisplayedby full-length Xcc_Est showed the highest hydrolysisactivity. It was higher than the whole cell harboringplasmid pETgla and pDxxc_est285gla, respectively,which the γ-lactamase was expressed in the cytoplasmand on the cell surface by the truncated Xcc_Est. There-fore, the E. coli rosetta (DE3) pDxcc_estgla was select-ed for further work.

Enantioselectivity of autodisplayed γ-lactamase

To check whether Xcc_Est also change the coupled γ-lactamase other catalytic properties like enantioselectivity,the residual vince lactam was extracted from the reac-tion solution with organic solvent ethylacetate and sub-sequently subjected to HPLC analysis using a chiralcolumn. As shown in Fig. 5, the ee value of (−) vincelactam was determined to be 99.5 % when E. colirosetta (DE3) pDxcc_estgla reacted with (±) vince lac-tam at 30 °C for 1 h. Autodisplayed γ-lactamase on cellsurface did not affect its enantioselectivity.

Stability of the whole cell biocatalyst E. coli rosetta (DE3)pDxcc_estgla

To investigate the stability of the whole cell at theopera t iona l condi t ions , E. col i rose t ta (DE3)pDxcc_estgla was incubated in PBS buffer (50 mM,pH 7.0) at 30 °C for 6 days and the hydrolysis activityto vince lactam was measured at a different time inter-val. The residue vince lactam was determined by chiralHPLC. After incubation of 6 days, the whole cells still

Table 2 Apparent kinetic parameters of the whole cell biocatlysts

Cell sample Vmax (μM/min) Km (mM)

E. coli rosetta (DE3) pETgla 409±46 54.0±8.6

E. coli rosetta (DE3) pDxcc_est285gla 657±35 39.0±3.3

E. coli rosetta (DE3) pDxcc_estgla 1,384±96 54.0±5.4

Fig. 4 The effect of temperature (a) and pH (b) on the hydrolytic activityof E. coli cells harboring plasmid pDxcc_estgla (filled circle) and pETgla(empty circle), in which the γ-lactamase was expressed on the cell surfaceand in the cytoplasm, respectively. The activity was assayed at varioustemperatures and buffers with different pH value under the standard

conditions. pH range 4–8: 100mMNa2HPO4–citric acid buffer, pH range9–10: 100 mM glycine–NaOH, pH 11: 100 mM Na2HPO3–NaOH. Theactivity of 185±11 U/mg dry cell weight of E. coli rosetta (DE3)pETxcc_estgla was used as the 100 % relative activity

Appl Microbiol Biotechnol

remained 90 % of their initial activity (Fig. 6a). Todetermine the stability of autodisplayed γ-lactamase atvarious pH values, the same amount of whole cells in1 ml of various pH-value buffers were incubated at30°C for 1 h. After centrifugation and washing twicein PBS (50 mM, pH 7.0), the residual activity of wholecells was measured under standard conditions. Asshown in Fig. 6b, the whole cell biocatalyst was stableat pH value ranging from 5.8 to 7.8.

Gram-scale preparation of (−) vince lactam by whole cellbiocatalyst

The potential application of the surface displayed γ-lactamase whole-cell biocatalyst in kinetic resolution ofracemic vince lactam was investigated in gram-scalepreparation experiment. For this purpose whole cellswith 40 g of dry weight (from 20-l batch cultures,OD580 is around 130) were used to react with 100 g

racemic vince lactams in 1 l phosphate buffer (50 mM,pH 7.0). The reaction mixture was incubated with ashaking speed of 150 rpm and at 30 °C. The sampleswere taken out at the different time interval and extract-ed with ethyl acetate containing 1 mM benzamide as theinternal standard and then subjected to chiral HPLCanalysis. The enantiomer of (+) vince lactam in theracemate was completely converted into the correspond-ing γ-amino acid after 4 h reaction, while the (−) vincelactam enantiomer was not hydrolyzed by the whole cellbiocatalyst even extended the reaction time (Fig. 7a).The autodisplayed γ-lactamase exhibited absoluteenantioselectivity, which was of great value for practicalkinetic resolution. After the reaction, the mixture wasextracted with 500 ml dichloromethane for three times.The combined organic layers were dried with anhydrousNa2SO4. After the evaporation of the solvent, 49.2 g (−)vince lactam was recovered with 98.4 % yield and99.5 % ee value (Fig. 7b). The specific production rate

Fig. 5 Chiral HPLC analysis of vince lactam. a The negative control of racemic vince lactam hydrolyzed by E. coli rosetta (DE3) pETxcc_est. bRacemic vince lactam hydrolyzed by E. coli rosetta (DE3) pDxcc_estgla

Fig. 6 Stability of the whole cellbiocatalyst E. coli rosetta (DE3)pDxcc_estgla. a Operationalstability. b pH stability. The bufferwith different pH value was usedas described in Fig. 4. The activityof 185±11 U/mg dry cell weightof E. coli rosetta (DE3)pETxcc_estgla was used as the100 % relative activity

Appl Microbiol Biotechnol

was 307 mg/h g dry cell weight. The molecular struc-ture of the product was confirmed by 1H NMR, LC/MS,melting point and optical rotation data (see Online re-source 6).

Discussion

Biocatalysis plays a vital role in the modern synthetic organicchemistry and is estimated to be the important industry meth-od of synthesizing 20 % of the global production of non-natural chemical substances by 2020. Compared with theexpensive and nearly one-time use free enzyme, the wholecell biocatalyst can be easily prepared by cultivation andharvesting of the recombinant cells, without requirement ofadditional purification. Display of active enzyme has beenpursued for its potential to be used as a whole cell biocatalystwith some specific advantages mentioned earlier in the field ofpharmaceutical, agrochemical and fine chemical production.To date, a number of proteins have been used as an-choring motifs for presenting exogenous proteins to thecell surface. With the aim of developing a novel systemfor the autodisplay of enzymes, bioinformatic analysiswas used to identify an autotransporter Xcc_Est fromthe plant pathogen X. campestris pv campestris 8004,Subsequently, we verified that Xcc_Est, whatever infull-length or truncated form, could successfully displayof γ-lactamase (Gla) from thermophilic archaeaS. solfataricus P2 to E. coli cell surface by Westernblot, activity assay and flow cytometry analysis. Sur-prisingly, Xcc_Est in the cellular outer membrane wasfound to shift the optimum temperature of the fused γ-lactamase from 90 °C to 30 °C with a substantialdecrease of 60 °C, which made the whole cell a veryattractive biocatalyst used at mild temperature, eliminat-ing the high energy cost at high temperature. In thisnovel autodisplay system, Xcc_Est could be used as anefficient anchoring motif for display the relatively largeprotein (up to about 120 kDa), which might be very

useful for presenting the antibody for immunologicalstudy (Tan et al. 2012; Walker et al. 2008).

The γ-lactamase from S. solfataricus P2 was de-scribed as a homodimer or homooctamer depending onthe pH value of solution. At pH 7.0, the free enzymeexisted in a mixture of dimeric and octameric forms(D’Abusco et al. 2001). Previous experiments verifiedthat the autotransporter β-barrel domain located in theouter membrane could motion in some way and resultedin aggregation of the exogenous passenger domain toform the active oligomer (Jose and Schwichow 2004a).Assuming that the monomeric form of the γ-lactamaseis not active, the successful activity of the enzyme inthe Xcc_Est autodisplay system implies a passengerdriven self association of the subunits. The huge differ-ence of the optimum temperatures of γ-lactamase inf ree and sur face-d isplay ing form impl ies theautodisplayed γ-lactamase might form new oligomericstate other than homodimer or homooctamer, whichremains to be explored in the future.

Current lines of accumulating evidence have suggested thatthe thermal stability of protein is related to the conformationalrigidity (Závodszky et al. 1998; Gershenson et al. 2000).Xcc_Est is a mesophilic protein, and the rigidity of the fusionprotein Xcc_EstGla could be decreased compare with the γ-lactamase from S. solfataricus P2. The drop in rigidity ofthe thermophilic–mesophilic fusion protein may be an-other possibility to the shift of optimum temperature asreported in the tag fusion endonuclease fromS. solfataricus P2 (Han and Grauss 2009).

Optically pure (−) vince lactam is a key intermediate forproduction of antivirus drugs. Using autodisplayed γ-lactamase whole cells as the biocatalyst, 49.2 g (−) vincelactam was been produced within 4 h with an enantiomericexcess of 99.5 %. As shown in Fig. 6, the displayed γ-lactamase showed excellent stability over the timecourse of 6 days with a residual activity of 90 %. Theresult showed that the whole-cell biocatalyst with γ-lactamase autodisplayed on the surface has a great po-tential in practical industrial applications.

Fig. 7 Gram-scale preparation of(−) vince lactam. a Reactionprocess. b Purified (−) vincelactam produced by whole cellcatalysis

Appl Microbiol Biotechnol

Acknowledgements This work was supported by the Youth Fund ofState Key Laboratory of Microbial Resources, Institute of Microbiology,CAS (To J. Wang). We thank Dr. Lihong Dou for the kind help in flowcytometry analysis and Dr. Fuquan Song for providing assistance in theNMR assay.

References

Brooks WH, Guida WC, Daniel KG (2011) The significance of chiralityin drug design and development. Curr TopMedChem 11(7):760–70

Chen I, Dorr BM, Liu DR (2011) A general strategy for the evolution ofbond-forming enzymes using yeast display. Proc Natl Acad Sci U SA 108(28):11399–404. doi:10.1073/pnas.1101046108

D'Abusco AS, Ammendola S, Scandurra R, Politi L (2001) Molecularand biochemical characterization of the recombinant amidase fromhyperthermophilic archaeon Sulfolobus solfataricus. Extremophiles5(3):183–92

Desai AA (2011) Sitagliptin manufacture: a compelling tale of green chem-istry, process intensification, and industrial asymmetric catalysis.AngewChem Int Ed Engl 50(9):1974–6. doi:10.1002/anie.201007051

Detzel C, Maas R, Jose J (2011) Autodisplay of nitrilase fromAlcaligenesfaecalis in E. coli yields a whole cell biocatalyst for the synthesis ofenantiomerically pure (R)-mandelic acid. Chem Cat Chem 3(4):719–725. doi:10.1002/cctc.201000382

Dunn PJ (2012) The importance of green chemistry in process researchand development. Chem Soc Rev 41(4):1452–61. doi:10.1039/c1cs15041c

Farina V, Reeves JT, Senanayake CH, Song JJ (2006) Asymmetricsynthesis of active pharmaceutical ingredients. Chem Rev 106(7):2734–93. doi:10.1021/cr040700c

Filip C, Fletcher G, Wulff JL, Earhart CF (1973) Solubilization of thecytoplasmic membrane of Escherichia coli by the ionic detergentsodium-lauryl sarcosinate. J Bacteriol 115(3):717–22

Gershenson A, Schauerte JA, Giver L, Arnold FH (2000) Tryptophanphosphorescence study of enzyme flexibility and unfolding inlaboratory-evolved thermostable esterases. Biochemistry 39(16):4658–4665. doi:10.1021/bi992473s

Han D, Krauss G (2009) Characterization of the endonuclease SSO2001from Sulfolobus solfataricus P2. FEBS Lett 583(4):771–776. doi:10.1016/j.febslet.2009.01.024

Hantke K (1981) Regulation of ferric iron transport in Escherichia coliK12:isolation of a constitutive mutant. Mol Gen Genet 182(2):288–92

Hickey AM, Ngamsom B, Wiles C, Greenway GM, Watts P, LittlechildJA (2009) A microreactor for the study of biotransformations by across-linked gamma-lactamase enzyme. Biotechnol J 4(4):510–6.doi:10.1002/biot.200800302

Ison MG (2011) Antivirals and resistance: influenza virus. Curr OpinVirol 1(6):563–73. doi:10.1016/j.coviro.2011.09.002

Jose J, von Schwichow S (2004a) Autodisplay of active sorbitol dehydro-genase (SDH) yields a whole cell biocatalyst for the synthesis of raresugars. Chembiochem 5(4):491–9. doi:10.1002/cbic.200300774

Jose J, von Schwichow S (2004b) “Cystope tagging” for labeling anddetection of recombinant protein expression. Anal Biochem 331(2):267–274. doi:10.1016/j.ab.2004.04.010

Jose J, Jahnig F, Meyer TF (1995) Common structural features of IgA1protease-like outer membrane protein autotransporters. MolMicrobiol 18(2):378–80

Jose J, Maas RM, Teese MG (2012) Autodisplay of enzymes—molecularbasis and perspectives. J Biotechnol 161(2):92–103. doi:10.1016/j.jbiotec.2012.04.001

Kaessler A, Olgen S, Jose J (2011) Autodisplay of catalytically activehuman hyaluronidase hPH-20 and testing of enzyme inhibitors. EurJ Pharm Sci 42(1–2):138–47. doi:10.1016/j.ejps.2010.11.004

Kim J, Schumann W (2009) Display of proteins on Bacillus subtilisendospores. Cell Mol Life Sci 66(19):3127–36. doi:10.1007/s00018-009-0067-6

Knobloch D, Ostermann K, Rodel G (2012) Production, secretion, andcell surface display of recombinant Sporosarcina ureae S-layerfusion proteins in Bacillus megaterium. Appl Environ Microbiol78(2):560–7. doi:10.1128/AEM.06127-11

Lang H (2000) Outer membrane proteins as surface display systems. Int JMed Microbiol 290(7):579–585

Lattemann CT, Maurer J, Gerland E, Meyer TF (2000) Autodisplay:functional display of active beta-lactamase on the surface ofEscherichia coli by the AIDA-I autotransporter. J Bacteriol182(13):3726–33

Li W, Caberoy NB (2010) New perspective for phage display asan efficient and versatile technology of functional proteomics.Appl Microbiol Biot 85(4):909–919. doi:10.1007/s00253-009-2277-0

Line K, Isupov MN, Littlechild JA (2004) The crystal structure of a (−)gamma-lactamase from an Aureobacterium species reveals a tetra-hedral intermediate in the active site. J Mol Biol 338(3):519–32. doi:10.1016/j.jmb.2004.03.001S0022283604002633

Lum M, Morona R (2012) IcsA autotransporter passenger promotesincreased fusion protein expression on the cell surface. MicrobCell Fact 11:20. doi:10.1186/1475-2859-11-20

Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) Identificationof prokaryotic and eukaryotic signal peptides and prediction of theircleavage sites. Protein Eng 10(1):1–6. doi:10.1093/protein/10.1.1

Novy R, Drott D, Yaeger K, Mierendorf R (2001) Overcoming the codonbias of E. coli for enhanced protein expression. Innovations 12:1–3

Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0:discriminating signal peptides from transmembrane regions. NatMethods 8(10):785–6. doi:10.1038/nmeth.1701

Pohlner J, Halter R, Beyreuther K, Meyer TF (1987) Gene structure andextracellular secretion of Neisseria gonorrhoeae IgA protease.Nature 325(6103):458–62. doi:10.1038/325458a0

Savile CK, Janey JM, Mundorff EC, Moore JC, Tam S, Jarvis WR,Colbeck JC, Krebber A, Fleitz FJ, Brands J, Devine PN, HuismanGW, Hughes GJ (2010) Biocatalytic asymmetric synthesis of chiralamines from ketones applied to sitagliptin manufacture. Science329(5989):305–9. doi:10.1126/science.1188934

Schultheiss E, Paar C, Schwab H, Jose J (2002) Functional esterasesurface display by the autotransporter pathway inEscherichia coli. J Mol Catal B-Enzym 18(1–3):89–97. doi:10.1016/S1381-1177(02)00063-2

Schultheiss E, Weiss S, Winterer E, Maas R, Heinzle E, Jose J (2008)Esterase autodisplay: enzyme engineering and whole-cell activitydetermination in microplates with pH sensors. Appl EnvironMicrob74(15):4782–4791. doi:10.1128/Aem.01575-07

Schumacher SD, Jose J (2012) Expression of active human P450 3A4 onthe cell surface of Escherichia coli by Autodisplay. J Biotechnol161(2):113–120. doi:10.1016/j.jbiotec.2012.01.031

Schumacher SD, Hannemann F, Teese MG, Bernhardt R, Jose J(2012) Autodisplay of functional CYP106A2 in Escherichiacoli. J Biotechnol 161(2):104–112. doi:10.1016/j.jbiotec.2012.02.018

Shetty AK, Peek LA (2012) Peramivir for the treatment of influenza.Expert Rev Anti Infect Ther 10(2):123–43. doi:10.1586/eri.11.174

Singh R, Vince R (2012) 2-Azabicyclo[2.2.1]hept-5-en-3-one: chemicalprofile of a versatile synthetic building block and its impact on thedevelopment of therapeutics. Chem Rev 112(8):4642–86. doi:10.1021/cr2004822

Tan JL, Ueda N, Heath D, Mercer AA, Fleming SB (2012) Developmentof orf virus as a bifunctional recombinant vaccine: Surface displayof Echinococcus granulosus antigen EG95 by fusion to membranestructural proteins. Vaccine 30(2):398–406. doi:10.1016/j.vaccine.2011.10.079

Appl Microbiol Biotechnol

Taylor SJC, Mccague R, Wisdom R, Lee C, Dickson K, Ruecroft G,Obrien F, Littlechild J, Bevan J, Roberts SM, Evans CT (1993)Deve lopmen t o f t he b i oca t a l y t i c r e so lu t i on o f 2 -azabicyclo[2.2.1]hept-5-en-3-one as an entry to single-enantiomercarbocyclic nucleosides. Tetrahedron Asymmetr 4(6):1117–1128.doi:10.1016/S0957-4166(00)80218-9

Taylor SJC,BrownRC,KeenePA,Taylor IN (1999)Novel screeningmethods— the key to cloning commercially successful biocatalysts. Bioorg MedChem 7(10):2163–2168. doi:10.1016/S0968-0896(99)00146-7

Toogood HS, Brown RC, Line K, Keene PA, Taylor SJC, McCague R,Littlechild JA (2004) The use of a thermostable signature amidase inthe resolution of the bicyclic synthon (rac)-gamma-lactam.Tetrahedron 60(3):711–716. doi:10.1016/j.tet.2003.11.064

Torres LL, Schliessmann A, Schmidt M, Silva-Martin N, Hermoso JA,Berenguer J, Bornscheuer UT, Hidalgo A (2012) Promiscuousenantioselective (−)-gamma-lactamase activity in thePseudomonas fluorescens esterase I. Org Biomol Chem 10(17):3388–92. doi:10.1039/c2ob06887g

van Bloois E, Winter RT, Kolmar H, Fraaije MW (2011) Decoratingmicrobes: surface display of proteins on Escherichia coli. TrendsBiotechnol 29(2):79–86. doi:10.1016/j.tibtech.2010.11.003

Walker A, Skamel C, Vorreiter J, Nassal M (2008) Internal coreprotein cleavage leaves the Hepatitis B virus capsid intactand enhances its capacity for surface display of heterologous

whole chain proteins. J Biol Chem 283(48):33508–33515.doi:10.1074/jbc.M805211200

Wang JJ, Zhang X, Min C, Wu S, Zheng GJ (2011) Single-step purifica-tion and immobilization of gamma-lactamase and on-column trans-formation of 2-azabicyclo [2.2.1] hept-5-en-3-one. Process Biochem46(1):81–87. doi:10.1016/j.procbio.2010.07.018

Wentzel A, Christmann A, Adams T, Kolmar H (2001) Display ofpassenger proteins on the surface of Escherichia coli K-12 by theenterohemorrhagic E. coli intimin EaeA. J Bacteriol 183(24):7273–84. doi:10.1128/JB.183.24.7273-7284.2001

Wilhelm S, Tommassen J, Jaeger KE (1999) A novel lipolytic enzymelocated in the outer membrane of Pseudomonas aeruginosa. JBacteriol 181(22):6977–6986

Wilhelm S, Rosenau F, Kolmar H, Jaeger KE (2011) Autotransporterswith GDSL passenger domains: molecular physiology and biotech-nological applications. ChemBioChem 12(10):1476–1485. doi:10.1002/cbic.201100013

Závodszky P, Kardos J, Svingor Á, Petsko GA (1998) Adjustment ofconformational flexibility is a key event in the thermal adaptation ofproteins. Proc Natl Acad Sci 95(13):7406–7411

Zhu S, Gong C, Song D, Gao S, Zheng G (2012) Discovery of a novel(+)-gamma-lactamase from Bradyrhizobium japonicumUSDA 6 byrational genome mining. Appl Environ Microbiol 78(20):7492–5.doi:10.1128/AEM.01398-12

Appl Microbiol Biotechnol