1

Berberine down-regulates cellular JNK and NF-κB activation and this may result in an 1

inhibition of HSV replication 2

3

4

Siwei Song a, Min Qiua, Ying Chua, Deyan Chena, Xiaohui Wanga, Airong Sua, Zhiwei 5

Wua,b# 6

7

Center for Public Health Research, School of Medicine, Nanjing University, Nanjing, P.R. 8

Chinaa; State Key Lab of Analytical Chemistry for Life Science, Nanjing University, 9

Nanjing, P.R. Chinab 10

11

Running Title: Berberine Inhibition of HSV Replication 12

13

#Address correspondence to Zhiwei Wu, wzhw@nju.edu.cn. 14

S.S. and M.Q. contributed equally to this work. 15

16

17

AAC Accepts, published online ahead of print on 9 June 2014Antimicrob. Agents Chemother. doi:10.1128/AAC.02427-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

2

Abstract 18

Berberine is a quaternary ammonium salt from the protoberberine group 19

of isoquinoline alkaloids. Some reports show that berberine exhibits anti-inflammatory, 20

anti-tumor and antiviral properties by modulating multiple cellular signaling pathways, 21

including p53, nuclear factor kappaB (NF-κB) and mitogen-activated protein kinase 22

(MAPK). In the current study, we investigated the antiviral effect of berberine against 23

herpes simplex virus (HSV) infection. Current anti-herpes medicines such as acyclovir 24

can lessen the recurring activation when used early at infection but are unable to prevent 25

or cure infections where treatment has selected for resistant mutants. In searching for new 26

antiviral agents against herpesvirus infection, we found that berberine reduced viral RNA 27

transcription, protein synthesis, and virus titers in a dose-dependent manner. To elucidate 28

the mechanism of its antiviral activity, the effect of berberine on the individual steps of 29

viral replication cycle of HSV was investigated via time-of-drug addition assay. We found 30

that berberine acted at the early stage of HSV replication cycle, between viral 31

attachment/entry and genomic DNA replication, probably at the immediate early (IE) 32

gene expression stage. We further demonstrated that berberine significantly reduced 33

HSV-induced NF-κB activation, as well as IκB-α degradation and p65 nuclear 34

translocation. Moreover, we found that berberine also depressed HSV-induced c-Jun 35

N-terminal kinases (JNK) phosphorylation, but had little effect on p38 phosphorylation. 36

Our results suggest that the berbreine inhibition of HSV infection may be mediated 37

through modulating cellular JNK and NF-κB pathways. 38

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

3

Key words: Berberine; Herpes simplex virus (HSV); Antiviral activity; Nuclear factor 39

kappaB (NF-κB); c-Jun N-terminal kinases (JNK). 40

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

4

Introduction 41

Herpes simplex virus (HSV) infection causes several distinct medical disorders. 42

Common infection of the skin or mucosa may affect the face and mouth (orofacial 43

herpes), genitalia (genital herpes), or hands (herpetic whitlow) (1, 2). More serious 44

disorders occur when the virus infects and damages the eye (herpes keratitis), or invades 45

the central nervous system, damaging the brain (herpes encephalitis). HSV infection is 46

highly prevalent worldwide and is shown to facilitate human immunodeficiency virus-1 47

(HIV-1) infection and transmission (3-6). HSV-1 and HSV-2, both large DNA viruses, are 48

the etiological agents for orofacial and genital infections, respectively, although HSV-1 49

infection of genitalia was also reported (1, 7). 50

HSV establishes lifelong infection, and the virus cannot yet be eradicated once the 51

virus establishes latency. Unfortunately, there are no cures or approved vaccines to 52

prevent HSV infection and transmission. Antiviral medication is most effective if it is 53

taken when patients have the prodromal symptoms of a recurrent genital herpes outbreak. 54

Acyclovir, famcyclovir, valacyclovir and penciclovir are the currently available 55

medications which act in similar mechanisms by inhibiting viral DNA polymerase and 56

causing premature chain termination when they compete with guanine triphosphate for 57

incorporation into newly synthesized viral DNA (8-10). Acyclovir is thus an effective 58

inhibitor of HSV and causes only mild side-effects. However, drug resistance occurs 59

especially in immunocompromised individuals (11-13). Due to the limited effectiveness 60

of the current medication and resistant viruses, it is necessary to continue the search for 61

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

5

new potential antiviral agents that act in distinct antiviral mechanisms. 62

Previous studies have shown that berberine (Fig. 1A) possesses in vitro activities in 63

suppressing the growth of colonic carcinoma (14), neuroblastoma (15) and a number of 64

other tumor cells (16). Although the mechanisms of these anti-pathogenic and anti-tumor 65

activities have not been well illustrated, its inhibitory effects on several intracellular 66

signaling pathways, including p53 nuclear factor kappa B (NF-κB) (17) and 67

mitogen-activated protein kinase (MAPK) (18), have been investigated. 68

In this paper, we demonstrated the antiviral activity of berberine against the infection 69

of both HSV-1 and HSV-2 and provided evidence showing that its inhibitory activity was 70

mediated by modulating host cell NF-κB and MAPK pathways activation. The treatment 71

of berberine could result in the inhibition of virus-induced IκB-α degradation and p65 72

nuclear translocation. We also provided evidence that treatment with berberine 73

suppressed c-Jun N-terminal kinase (JNK) activation in the HSV-infected cells. These 74

findings demonstrate that berberine may possess a unique mechanism of antiviral action 75

and may serve as a potential anti-herpes virus agent. 76

77

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

6

Materials and Methods 78

Reagents, cell lines, plasmids and viruses. Berberine and acyclovir were obtained 79

from National Institutes for Food and Drug Control in China (Beijing, China). SB203580, 80

SP600125, BAY11-7082, MG132 and phorbol-12-myristate-13-acetate (PMA) were 81

purchased from Beyotime (Haimen, Jiangsu, China). Alexa Fluor 488 goat 82

anti-mouse IgG (H+L) and DAPI were from Life Technologies (Carlsbad, CA, US). 83

IRDye 680 goat-anti-rabbit and IRDye 800 goat-anti-mouse antibodies were obtained 84

from LI-COR (Lincoln, NE, USA). Antibodies specific for gD-1/2, ICP4-1, ICP-8, 85

ICP27-1, JNK2, p38, GAPDH and β-catenin, and RIPA lysis buffer were purchased from 86

Santa Cruz (Santa Cruz, CA, USA). Antibodies specific for p65, p-p38, p-c-Jun, 87

p-JNK1/2, p-ATF-2 and IκB-α were from Cell Signaling Technology (Beverly, USA). 88

Anti-ICP5-1/2 was obtained from Abcam (Cambridge, UK). Recombinant human TNF-α 89

was obtained from PeproTech (Rocky Hill, NJ, USA). 90

HEK293T, Vero, and HEC-1-A cells were obtained from American Type Culture 91

Collection (ATCC, Manassas, VA, USA). NF-κB-luc and AP-1-luc reporter plasmids 92

were purchased from Clontech (Palo Alto, CA, USA). pGL4-TNF-α-promoter was 93

constructed by inserting TNF-α promoter (-100~+900) into pGL4.17 (Promega, Madison, 94

WI, USA). HSV-1 (HF), HSV-1/blue and HSV-2 (G) were propagated and titrated on 95

Vero cells as described previously (19). 96

97

In vitro antiviral assay. The in vitro antiviral activity of berberine was determined by 98

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

7

titrating the infectious virions in berberine-treated cells as described (20). HEC-1-A cells 99

were seeded into 96-well plates at a density of 2×104 per well and cultured for 24 hrs, and 100

then pre-treated with serial concentrations of berberine and infected with HSV-1 or 101

HSV-2 (moi=1). After 24 hrs p.i., cultural medium were discarded and then 200μl fresh 102

medium was dispensed into each well. HSV-1/2-infected cells were frozen and thawed 103

with three cycles to release the virions. Then the virion-containing medium was diluted 104

and dispensed on confluent Vero cell monolayers. Viral titration was performed by 105

counting the numbers of plaques. 106

107

In vitro cytotoxicity assay. The in vitro cytotoxicity of berberine was measured using 108

a commercial CCK-8 kit (Dojindo, Kumamoto, Japan) via colorimetric method according 109

to the manufacturer’s instructions. Briefly, 2×104 cells per well were seeded into 96-well 110

plates and cultured for 24 hrs before serial concentrations of berberine were added in 111

triplicate. After 24 hrs, 10μl CCK-8 reagent was dispensed into each well, and the plates 112

were incubated at 37°C for 3 hrs. Absorbance at 450nm was measured using a TECAN 113

Infinite M200 microplate reader (Männedorf, Switzerland). Cell viability was plotted as 114

the percent viable cells of the mock-treated control cells. 115

116

Western blot and In-cell Western. Cells were lysed using RIPA lysis buffer on ice 117

for 30 min and then centrifuged at 12,000×g for 10 min at 4°C. Total protein 118

concentrations in the supernatants were determined using BCA protein assay kit (Pierce, 119

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

8

Rockford, IL, USA). After separated using SDS-PAGE, the proteins were transferred to 120

polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The 121

membranes were blocked using Odyssey Blocking buffer (LI-COR) and then incubated 122

with primary antibodies for 2 hrs at room temperature (RT). After 5 washes with 123

PBS-0.1% Tween-20 (PBS-T buffer), the membranes were incubated in IRDye IgG 124

(1:10,000) for 1 hr at RT and visualized under LI-COR Odyssey Infrared Imager 125

(LI-COR). 126

In-cell Western was performed in 96-well plate. The cells cultured in a 96-well plate 127

were fixed with 4% paraformaldehyde for 20 min at RT and permeabilized by 5 washes 128

in PBS-0.1% Triton-X 100 with 5 min for each wash. Cell monolayers were blocked for 129

90 min in blocking buffer (4% non-fat dry milk) and then incubated with primary 130

antibodies diluted in blocking buffer (1:200) for 2 hrs at RT. After washing with PBS-T 131

buffer, the cell layers were stained with IRDye IgG (1:1500) for 1 hr, rinsed and scanned 132

in Odyssey Infrared Imager. Relative protein expression level was normalized against 133

β-catenin. 134

135

Synergy analysis. Anti-HSV-2 activity of berberine and acyclovir were tested 136

individually in serial concentrations in HEC-1-A cells through In-cell Western and the 137

50% maximal effective concentration (EC50) values of the single drugs were calculated. 138

The two drug combinations were tested at a fixed molar concentration ratio, which was 139

optimized to give the greatest synergism over a range of serial dilutions. The EC50 values 140

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

9

of single drugs and the combination index (CI) of the two drugs were calculated using 141

CalcuSyn software (21) according to the method of Chou-Talalay (22). The synergy was 142

estimated by CI values (22). CI <0.1: very strong synergism; 0.1–0.3: strong synergism; 143

0.3–0.7: synergism; 0.7–0.85: moderate synergism; 0.85–0.90: slight synergism; 0.9-1.1: 144

Nearly additive and >1.1: antagonism. 145

146

Immunofluorescence staining and microscopic imaging. HEC-1-A cells grown on 147

Φ10mm glass coverslips in a 24-well plate were rinsed with PBS and then fixed with 4% 148

paraformaldehyde for 15 min at RT. The cells were then permeabilized with PBS-0.2% 149

Triton X-100 for 15 min followed by washing twice with PBS. The coverslips were 150

blocked with 1% BSA in PBS for 30 min at RT. Target proteins were immunolabeled 151

using respective primary antibodies and followed by Alexa Fluor 488 goat-anti-mouse 152

488 IgG and Alexa Fluor goat-anti-rabbit 594 IgG (Life Technologies). Nuclei were 153

visualized by staining with DAPI. Images were acquired using an Olmpus FluoView 154

FV10i confocal microscope (Tokyo, Japan). 155

156

Cell transfection and luciferase assay. HEC-1-A cells cultured in a 96-well plate 157

were transiently transfected with luciferase reporter plasmid (100ng/well) using 158

Lipofectamine 2000 transfection reagent (Life Technologies). The cells were further 159

cultured for 24 hrs and treated as described. The relative luciferase activity was 160

determined using Bright-Glo luciferase assay system (Promega). 161

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

10

162

RNA extraction and real-time PCR. Cellular total RNA was extracted using TRIzol 163

reagent (Life Technologies) according to manufacturer’s protocol. cDNA was 164

reverse-transcribed using ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). 165

Real-time PCR was performed in triplicate on ABI Prism 7300 Sequence Detection 166

System using the SYBR Green PCR Master Mix (Life Technologies). The sequences of 167

primer pairs were listed in Table 1. Messenger RNA (mRNA) transcription levels were 168

standardized against housekeeping gene GAPDH. 169

170

HSV-1/blue assay. Confluent HEC-1-A cells in 96-well plate were pre-incubated with 171

drugs for 30min and then infected with HSV-1/blue (moi=1). Cells were lysed with 1% 172

NP-40 in PBS 12 hrs postinfection (p.i.). Cell lysates were then transferred into a new 173

Costar 96-well flat plate and mixed with CPRG (chlorophenol red-β-D-galactopyranoside; 174

Boehringer, Ingelheim, Germany), and β-gal activity were measured in a TECAN Infinit 175

M200 microplate reader at 570nm after 1 hr. 176

177

Statistics. Statistical analysis was performed using two-tailed student t-test. Statistical 178

significance: * p<0.05, ** p<0.01. 179

180

181

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

11

3. Results 182

Berberine inhibited HSV viral replication. To investigate the antiviral effect of 183

berberine on HSV-1 and HSV-2 replication, HEC-1-A cells were pretreated with serial 184

concentrations of berberine and then infected with HSV-1 (HF) and HSV-2 (G), 185

respectively. Berberine effectively inhibited the formation of HSV-induced 186

cytopathogenic effect (CPE) (data not shown). Furthermore, the infectious viral particles 187

were released by three cycles of freezing and thawing the infected cells, and viral 188

infectivity was titrated by measuring the plaque forming unit (PFU). As shown in Fig. 1B 189

and C, berberine inhibited replication of both HSV-1 (Fig. 1B) and HSV-2 (Fig. 1C) in a 190

dose-dependent manner. The EC50 values for HSV-1 and HSV-2 were 6.77±1.13μM and 191

5.04±1.07μM, respectively. 192

We initially investigated its anti-HSV activity by monitoring the reduction of gD 193

expression, an HSV late gene product. As shown in Fig. 2A and B, berberine was 194

effective in inhibiting the expression of both HSV-1 (Fig. 2A) and HSV-2 gD (Fig. 2B). 195

To confirm these results, we investigated the effect of berberine on HSV-1 or HSV-2 gD 196

expression level by measuring the copy numbers of gD mRNA transcript via real-time 197

PCR. Similarly, the inhibitory effect was in parallel to that of the protein expression (Fig. 198

2C and D). The expression of another late gene product, VP5, the major capsid protein, 199

was also determined, and the results were consistent with the gD expression (Fig. 2E and 200

F). Western blot analysis of gD expression in another HSV permissive cell line, 201

HEK293T cells, further substantiated the inhibitory effect of berberine and ruled out cell 202

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

12

type specific effect of the drug, as shown in Fig. 2G. Taken together, we conclude that 203

berberine inhibits the replication of HSV-1 and HSV-2 and the viral late gene expression. 204

The viral inhibitory activity was not due to the effect of cytotoxicity of the drug to the 205

host cells as we showed that berberine had low cytotoxicities to both HEK293T and 206

HEC-1-A cell lines. As shown in Fig. 2H, the 50% cytotoxicity concentration (CC50) of 207

berberine to HEC-1-A cells was greater than 400μM, significantly higher than the viral 208

inhibitory dosage. The CC50 of berberine to HEK293T cells was 165.7μM, still 209

significantly higher than that used in its antiviral assay. These results suggest that the viral 210

inhibitory activity of berberine is not due to its cytotoxicity. 211

212

Berberine inhibited HSV infection at a post-entry step. A time-of-drug-addition 213

assay was performed to determine the steps of berberine action during HSV-2 replication 214

cycle. As shown in Fig. 3, HSV-2-infected HEC-1-A cells were treated with berberine, 215

acyclovir and dextran sulfate (DXS) (a polyanion that inhibits HSV virion attachment and 216

entry) at indicated time point p.i. The results showed that HSV-2 began to escape from 217

the inhibition by berberine 4-8 hrs p.i., whereas it escaped from the inhibition by DXS 218

0-2 hrs p.i. Acyclovir inhibited HSV-2 gD expression during the entire 0-8 hrs p.i. Based 219

on the observation above, we postulate that berberine may act at an early stage of HSV 220

replication cycle, between viral entry and viral genomic DNA replication, probably 221

during IE gene expression stage. 222

223

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

13

Berberine inhibited HSV immediate early and early genes expression. We further 224

explored the mechanisms of berberine inhibition of gD expression by investigating the 225

immediate early (IE) genes that regulate the late genes. Due to the importance of HSV IE 226

expression in the viral replication, we first investigated the inhibitory effect of berberine 227

on one of the IE genes, infected cell polypeptides 4 (ICP4) 24 hrs p.i. As shown in Fig. 228

4A, using an In-cell Western assay, we showed that berberine inhibited HSV-1 ICP4 229

expression in a dose-dependent manner, consistent with the reduction of late gene 230

expression (shown in Fig. 2). We also employed HSV-1/blue recombinant virus to 231

determine the inhibitory effect of berberine on reporter gene lacZ expression. This virus 232

contains an HSV-1 ICP4 promoter-driven lacZ gene inserted into HSV-1 TK gene loci 233

(23, 24). As shown in Fig. 4B, berberine inhibited ICP4 promoter-driven lacZ gene 234

expression in a dose-dependent manner, further demonstrating that berberine might 235

inhibit HSV replication through interfering with viral IE gene expression. 236

We also investigated the time course of the inhibitory effect of berberine on ICP4 gene 237

expression at early stages of HSV infection and the result showed that berberine could 238

inhibit ICP4 expression 8 and 12 hrs p.i., and completely inhibited gD expression (Fig. 239

4C). We also investigated the time course of the inhibitory effect of berberine on ICP27 240

gene expression at early stages of HSV infection, and the result showed that berberine 241

could also have inhibitory effect on ICP27 expression 8 and 12 hrs p.i. (Fig. 4D). 242

Whether berberine inhibited HSV-1 early gene expression was also determined. As 243

shown in Fig. 4E, berberine could block ICP8 expression completely. ICP8 is a 244

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

14

single-strand DNA-binding protein, which is required for HSV genomic DNA replication 245

(25). The inhibitory effect of berberine on ICP8 was consistent with the results of the late 246

genes expression (Fig. 2). 247

248

Berberine inhibited HSV-2-induced NF-κB activation. HSV infection induces a 249

persistent NF-κB activation, which is necessary for the viral replication and host cell 250

survival at the early stage of viral infection (26-29). To better understand whether 251

berberine could inhibit HSV-2-induced NF-κB activation, we used NF-κB luciferase 252

reporter plasmid to evaluate its effect. As shown in Fig. 5A, berberine down-regulated 253

HSV-2-induced NF-κB activation in a dose-dependent manner. MG132, a specific 254

proteasome and NF-κB inhibitor and served as a positive control, completely inhibited 255

NF-κB activation. We also examined the level of IκB-α, an endogenous NF-κB inhibitor 256

and found that HSV-2 infection induced the degradation of IκB-α, whereas berberine 257

could block the IκB-α degradation 12 and 24 hrs p.i. (Fig. 5B). We also evaluated the 258

effect of berberine on TNF-α -induced NF-κB activation, and the result showed that 259

berberine at the concentration of 50μM could suppress TNF-α -induced NF-κB and 260

treatment with berberine only did not induce the NF-κB activation (Fig. 5C). p65 is a 261

subunit of NF-κB transcription complex, which plays a crucial role in inflammatory and 262

immune responses. The inhibitory effect of IκB-α upon NF-κB in the cytoplasm is 263

exerted primarily through the interaction with p65 and p65 nuclear translocation is often 264

taken as an indication of NF-κB activation. We also demonstrated that berberine could 265

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

15

inhibit virus-mediated p65 nuclear translocation and HSV-2 gD expression, 266

simultaneously (Fig. 5D). Together, the data suggests that berberine may inhibit 267

HSV-2-induced NF-κB activation which may result in an inhibition of HSV replication. . 268

269

Berberine inhibited HSV-2-induced JNK activation, but showed less effect on p38 270

MAP kinase activation. JNK and p38 MAP kinase pathways are stimulated by HSV-1 271

infection and their activations play a central role on HSV-1 replication (30, 31). We 272

investigated whether HSV-2 infection would activate both MAPK cascades in HEC-1-A 273

cells and whether berberine would inhibit HSV-2-induced AP-1 activation, which was the 274

main transcription factor downstream of JNK/p38 MAP kinase. We found that berberine 275

inhibited HSV-2-induced AP-1-binding site-driven luciferase expression in a 276

dose-dependent manner, implying that it could attenuate virus-mediated MAPK 277

activation through modulating certain cascade(s) (Fig. 6A). Also, we found that HSV-2 278

infection resulted in persistent activation of JNK and p38 MAP kinase pathways in 279

HEC-1-A cells (Fig. 6B), and their specific inhibitors (SB203580 and SP600125, 280

respectively) were able to reduce HSV-2 replication (Fig. 6C). Further evidence showed 281

that berberine could disrupt the phosphorylation of upstream activator JNK, but not p38 282

MAP kinase. As shown in Fig. 6D, HSV-2 infection caused JNK phosphorylation, which 283

could be suppressed by berberine. The phosphorylation of its substrate, c-Jun was also 284

attenuated by the berberine treatment. In contrast, berberine would increase the 285

phosphorylation level of p38 MAP kinase in mock-infected cells. Although the low 286

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

16

concentrations of berberine (12.5μM) partially inhibited HSV-2-induced p38 activation, 287

high concentrations activated p38 MAP kinase cascade instead. ATF-2, both the substrate 288

of JNK and p38 MAP kinase, was also activated in berberine-treated uninfected cells, but 289

suppressed in infected ones which might be due to the JNK pathway. These results 290

indicate that berberine inhibits HSV-2-induced JNK activation, but only has marginal 291

inhibitory effect on p38 MAP kinase activation. And the effect of berberine on 292

PMA-induced MAPK activation was also investigated. As shown in Fig. 6E, berberine 293

could inhibit PMA-induced phosphorylation of JNK and its specific substrate c-Jun, but 294

showed less effect on p38 MAP kinase and ATF-2. Together, the data suggests that 295

berberine may inhibit HSV-2-induced JNK activation which may result in an inhibition of 296

HSV replication, but not p38 MAP kinase cascade. 297

298

Berberine down-regulated HSV-2-induced IL-8 and TNF-α expression. Previous 299

studies report that HSV infection could up-regulate the expression of certain 300

cytokines/chemokines, which is associated with cellular NF-κB and MAPK activation (32, 301

33). Therefore, whether berberine would inhibit the virus-induced up-regulation of 302

cytokines/chemokines was investigated via real-time PCR. As shown in Fig. 7A and B, 303

berberine effectively inhibited the expression of virus-induced IL-8 and TNF-α, two 304

hallmarks of chemotactic and proinflammatory factors, respectively. Using a TNF-α 305

reporter plasmid, we also confirmed the inhibitory effect of berberine on TNF-α promoter 306

activity (Fig. 7C). 307

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

17

The synergistic effect of berberine and acyclovir against HSV-2 infection. Since 308

berberine and acyclovir, an inhibitor of herpesviruse TK, likely acted with distinct 309

mechanisms against HSV (as demonstrated in section 3.2), the viral inhibitory activity of 310

combining berberine and acyclovir was investigated. As shown in Fig. 8, the combination 311

index (CI) of berberine and acyclovir was 0.814, which represented a moderate synergism 312

against HSV-2 infection when two drugs were used in combination, suggesting potential 313

beneficial effects of using two drugs in combination. 314

315

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

18

Discussion 316

Berberine is a natural product found in many traditional Chinese herbs. It is found in 317

such plants as Berberis, Hydrastis canadensis (goldenseal), Xanthorhiza 318

simplicissima (yellow root) and Phellodendron amurense (Amur cork tree), has been used 319

traditionally to treat fungal infections, Candida albicans, parasites and bacterial/viral 320

infections (17, 34-36). Some reports suggest it as a potential anti-tumor and 321

anti-inflammatory agent (37, 38). 322

Berberine exhibits inhibitory activity against some viruses, including influenza A virus 323

(39) and human cytomegalovirus (40). Chin et al. firstly report that berberine from 324

Coptidis rhizoma showed anti-HSV effect (41). Due to low cytotoxicity and minimal 325

side-effects, berberine is considered to be a promising antiviral drug candidate for 326

alternative treatment. In the current study, we demonstrated that berberine could 327

effectively inhibit HSV-1 and HSV-2 replication at the concentrations below the 50% 328

cytotoxicity dosage (Fig. 1 and 2). We also studied the synergistic effect of berberine and 329

acyclovir against HSV-2 infection in vitro, and showed that these two drugs exhibited 330

moderate synergism against viral replication (Fig. 8). Combination treatment of acyclovir 331

with drug that has the ability to inhibit HSV replication could increase the anti-HSV 332

activity in vitro and in vivo (42-45). In our study, we found that berberine not only 333

attenuated HSV replication, but also depressed the inflammatory response and associated 334

pathways activation. Thus, berberine and acyclovir may be potentially used in 335

combination for treatment of HSV infection. 336

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

19

The time-of-drug-addition analysis indicated that berberine exerted its inhibitory effect 337

after viral attachment and entry, but before HSV genomic DNA replication (Fig. 3). 338

Further mechanistic analysis showed that berberine inhibited the viral IE genes, ICP4 and 339

ICP27 expression. We postulate that berberine might act at the stage of HSV IE gene 340

expression and thus inhibit the expression of the early (ICP8) and the late genes (ICP5 341

and gD) expression, leading to the reduced HSV infectivity and inhibition of viral 342

replication. HSV IE gene expression plays significant roles in the viral replication and 343

regulates the early and late gene expression. ICP4 and ICP27 are two major 344

transcriptional activators for the viral early and late genes and essential for viral growth 345

(46, 47). Our evidence suggests that the inhibitory effect of berberine is mediated by 346

acting on ICP4 and ICP27 expression, leading to the down-modulation of downstream 347

early and late genes expression. 348

HSV can utilize certain cellular signaling pathways to facilitate its replication. In this 349

paper, we found that berberine depressed the degradation of endogenous NF-κB inhibitor 350

IκB-α and p65 nuclear translocation induced by HSV-2 infection, leading to the inhibition 351

of NF-κB activation. It has been reported that HSV infection undergoes a sustained host 352

cell NF-κB activation, which is necessary to prevent host cell from apoptosis at 3 to 6 hrs 353

p.i. and lasts until viral lytic phase (48). NF-κB belongs to the foremost transcription 354

factors that mediate immune, inflammatory, or anti-apoptotic responses. NF-κB can be 355

activated by exposure of cells to lipopolysaccharide (LPS), inflammatory cytokines 356

(TNF-α, IL-1β, etc.), phorbol ester, UV irradiation, viral infection or expression of certain 357

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

20

viral gene products (49). Since it plays a key role in promoting HSV infection, inhibition 358

of NF-κB signaling might be a promising therapeutic approach in HSV-induced 359

inflammatory responses (50). The effect of berberine on the NF-κB activation during 360

HSV replication indicates that it might be a potential inhibitor in HSV multiplication. It 361

was worth mentioning that berberine showed significant antiviral activity at low 362

concentration, however, it could not inhibit HSV-2-induced NF-κB activation at the same 363

concentration. Only high concentrations of berberine could inhibit virus-induced NF-κB 364

activation. It suggested to us that berberine is a multifunctional molecule and may have 365

other mechanisms of action for anti-herpes virus effect. 366

Reports have shown that HSV infection resulted in an activation of JNK/MAP kinase 367

pathway. Both JNK and p38 mitogen-activated protein kinases are stimulated after HSV 368

infection. A subset of cellular genes transactivated by AP-1 may ensure efficient viral 369

gene expression and DNA replication and facilitate viral replication (31, 51). JNK and 370

p38 MAP kinases are two main members of mitogen-avtivated protein kinase family, and 371

these two stress-activated protein kinases are activators for sensing various stimuli, such 372

as proinflammatory cytokines, genotoxic agents, osmotic shock and bacterial LPS (52). 373

Activated JNK/p38 MAP kinases can transmit upstream signals to downstream factors, 374

thus to mediate apoptosis, differentiation, growth or immune responses. JNK/p38 MAP 375

kinases are also reported to be stimulated by many viruses or virus-associated proteins, 376

including vaccinia virus (53), rotavirus (54), varicella-zoster virus (VZV) (55), HIV-1 377

(56), HSV-1 (30), coxsackievirus B3 (CVB3) (57), influenza virus (58) and hepatitis B/C 378

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

21

virus (HBV/HCV) (59). Our data showed that berberine had inhibitory effect on the 379

activation of transcription factor AP-1, the main downstream factor of JNK/p38 MAP 380

kinase, and that HSV infection led to a robust JNK phosphorylation, which was mitigated 381

by berberine treatment. The virus-induced c-Jun and ATF-2 phosphorylations were also 382

suppressed by the drug in a dose-dependent manner. Although berberine at 12.5μM 383

exhibited slight inhibitory effect on HSV-induced p38 phosphorylation, the higher 384

concentration (50μM) increased the level of phosphorylated p38 in both mock-infected 385

and HSV-infected cells (Fig. 6B). Besides, berberine could attenuate PMA-induced JNK 386

activation, but showed marginal effect on p38 MAP kinase (Fig. 6E). Based on the 387

observations that berberine inhibited HSV-induced JNK phosphorylation, we postulate 388

that berberine may act at upstream of JNK cascade, which requires further investigation. 389

IL-8 and TNF-α are important hallmarks of chemotactic and proinflammatory responses, 390

respectively, and these two inflammatory cytokines are up-regulated during HSV-1 391

infection, which is associated with MAPK and NF-κB pathways (32, 33). IL-8 392

promoter region has binding sites for NF-κB and AP-1, and this proinflammatory factor 393

can be regulated by NF-κB and MAPK activation (60, 61). TNF-α promoter has four 394

NF-κB binding sites and one AP-1 binding site (62). We showed that berberine inhibited 395

HSV-2-induced up-regulation of IL-8 and TNF-α expression (Fig. 7), consistent with our 396

evidence that berberine down-regulated these downstream factors via modulating MAPK 397

and NF-κB pathways. 398

In conclusion, we investigated the inhibitory mechanism of berberine on HSV-1 and 399

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

22

HSV-2 infection and found that berberine exhibited a significant inhibition on 400

HSV-induced JNK and NF-κB activation. As a result, we conclude that the inhibitory 401

effect of berberine on host cell JNK and NF-κB activation may result in an inhibition of 402

HSV replication. However, further study is needed to delineate the mechanisms in detail 403

on the roles of IE genes and NF-κB and JNK pathways. In view of its low cytotoxicity 404

and significant anti-herpetic activity, berberine might be a valuable candidate for further 405

study as a promising anti-HSV drug. 406

407

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

23

Acknowledgement 408

We thank Dr. Tao Peng from Guangzhou Institutes of Biomedicine and Health, 409

Chinese Academy of Sciences for the generous gift of HSV-1/blue strain. This study was 410

supported by the Major Research and Development Project from the Ministry of Health 411

of China (Grant No. 2012ZX10001-007-009-001 and 2013ZX10001005-003) and the 412

Innovative Project for Graduate Students of Jiangsu Province (Grant No. CXLX13_039). 413

414

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

24

415

References 416

1. Lafferty WE, Downey L, Celum C, Wald A. 2000. Herpes simplex virus type 1 417

as a cause of genital herpes: impact on surveillance and prevention. Journal of 418

Infectious Diseases 181:1454-1457. 419

2. Whitley RJ, Roizman B. 2001. Herpes simplex virus infections. The Lancet 420

357:1513-1518. 421

3. Corey L, Wald A, Celum CL, Quinn TC. 2004. The effects of herpes simplex 422

virus-2 on HIV-1 acquisition and transmission: A review of two overlapping 423

epidemics. Jaids-Journal of Acquired Immune Deficiency Syndromes 35:435-445. 424

4. Freeman EE, Weiss HA, Glynn JR, Cross PL, Whitworth JA, Hayes RJ. 2006. 425

Herpes simplex virus 2 infection increases HIV acquisition in men and women: 426

systematic review and meta-analysis of longitudinal studies. Aids 20:73-83. 427

5. Mbopi-Kéou F-X, Grésenguet G, Mayaud P, Weiss HA, Gopal R, Matta M, 428

Paul J-L, Brown DW, Hayes RJ, Mabey DC. 2000. Interactions between herpes 429

simplex virus type 2 and human immunodeficiency virus type 1 infection in 430

African women: opportunities for intervention. Journal of Infectious Diseases 431

182:1090-1096. 432

6. Wald A, Link K. 2002. Risk of human immunodeficiency virus infection in 433

herpes simplex virus type 2–seropositive persons: a meta-analysis. Journal of 434

Infectious Diseases 185:45-52. 435

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

25

7. Roberts CM, Pfister JR, Spear SJ. 2003. Increasing proportion of herpes 436

simplex virus type 1 as a cause of genital herpes infection in college students. 437

Sexually transmitted diseases 30:797-800. 438

8. De Clercq E, Field HJ. 2006. Antiviral prodrugs–the development of successful 439

prodrug strategies for antiviral chemotherapy. British journal of pharmacology 440

147:1-11. 441

9. Earnshaw D, Bacon T, Darlison S, Edmonds K, Perkins R, Hodge RV. 1992. 442

Mode of antiviral action of penciclovir in MRC-5 cells infected with herpes 443

simplex virus type 1 (HSV-1), HSV-2, and varicella-zoster virus. Antimicrobial 444

agents and chemotherapy 36:2747-2757. 445

10. Wald A, Zeh J, Barnum G, Davis L, Corey L. 1996. Suppression of subclinical 446

shedding of herpes simplex virus type 2 with acyclovir. Annals of Internal 447

medicine 124:8-15. 448

11. Reyes M, Shaik NS, Graber JM, Nisenbaum R, Wetherall NT, Fukuda K, 449

Reeves WC. 2003. Acyclovir-resistant genital herpes among persons attending 450

sexually transmitted disease and human immunodeficiency virus clinics. Archives 451

of internal medicine 163:76-80. 452

12. Shin YK, Weinberg A, Spruance S, Bernard M, Bacon TH, Boon RJ, Levin 453

MJ. 2003. Susceptibility of herpes simplex virus isolates to nucleoside analogues 454

and the proportion of nucleoside-resistant variants after repeated topical 455

application of penciclovir to recurrent herpes labialis. Journal of Infectious 456

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

26

Diseases 187:1241-1245. 457

13. Stránská R, Schuurman R, Nienhuis E, Goedegebuure IW, Polman M, Weel 458

JF, Wertheim-Van Dillen PM, Berkhout RJ, van Loon AM. 2005. Survey of 459

acyclovir-resistant herpes simplex virus in the Netherlands: prevalence and 460

characterization. Journal of Clinical Virology 32:7-18. 461

14. Hsu W-H, Hsieh Y-S, Kuo H-C, Teng C-Y, Huang H-I, Wang C-J, Yang S-F, 462

Liou Y-S, Kuo W-H. 2007. Berberine induces apoptosis in SW620 human 463

colonic carcinoma cells through generation of reactive oxygen species and 464

activation of JNK/p38 MAPK and FasL. Archives of toxicology 81:719-728. 465

15. Choi MS, Yuk DY, Oh JH, Jung HY, Han SB, Moon DC, Hong JT. 2008. 466

Berberine inhibits human neuroblastoma cell growth through induction of 467

p53-dependent apoptosis. Anticancer research 28:3777-3784. 468

16. Tang J, Feng YB, Tsao S, Wang N, Curtain R, Wang YW. 2009. Berberine and 469

Coptidis Rhizoma as novel antineoplastic agents: A review of traditional use and 470

biomedical investigations. Journal of ethnopharmacology 126:5-17. 471

17. Pandey MK, Sung B, Kunnumakkara AB, Sethi G, Chaturvedi MM, 472

Aggarwal BB. 2008. Berberine Modifies Cysteine 179 of IκBα Kinase, 473

Suppresses Nuclear Factor-κB–Regulated Antiapoptotic Gene Products, and 474

Potentiates Apoptosis. Cancer research 68:5370-5379. 475

18. Cui G, Qin X, Zhang Y, Gong Z, Ge B, Zang YQ. 2009. Berberine differentially 476

modulates the activities of ERK, p38 MAPK, and JNK to suppress Th17 and Th1 477

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

27

T cell differentiation in type 1 diabetic mice. Journal of biological chemistry 478

284:28420-28429. 479

19. McLean C, Erturk M, Jennings R, Challanain DN, Minson A, Duncan I, 480

Boursnell M, Inglis S. 1994. Protective vaccination against primary and recurrent 481

disease caused by herpes simplex virus (HSV) type 2 using a genetically disabled 482

HSV-1. Journal of Infectious Diseases 170:1100-1109. 483

20. Qiu M, Chen Y, Chu Y, Song S, Yang N, Gao J, Wu Z. 2013. Zinc ionophores 484

pyrithione inhibits herpes simplex virus replication through interfering with 485

proteasome function and NF-κB activation. Antiviral research 100:44-53. 486

21. Chou T, Hayball M. CalcuSyn: Windows Software for Dose Effect Analysis. 487

1991. Ferguson, Mo 63135. 488

22. Chou T-C, Talalay P. 1984. Quantitative analysis of dose-effect relationships: the 489

combined effects of multiple drugs or enzyme inhibitors. Advances in enzyme 490

regulation 22:27-55. 491

23. Dicker IB, Seetharam S. 1995. Herpes simplex type 1: lacZ recombinant viruses. 492

I. Characterization and application to defining the mechanisms of action of known 493

antiherpes agents. Antiviral research 28:191-212. 494

24. Zhu Q-C, Wang Y, Peng T. 2010. Herpes simplex virus (HSV) immediate-early 495

(IE) promoter-directed reporter system for the screening of antiherpetics targeting 496

the early stage of HSV infection. Journal of biomolecular screening 497

15:1016-1020. 498

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

28

25. Boehmer PE, Lehman I. 1993. Herpes simplex virus type 1 ICP8: 499

helix-destabilizing properties. Journal of virology 67:711-715. 500

26. Goodkin ML, Ting AT, Blaho JA. 2003. NF-κB is required for apoptosis 501

prevention during herpes simplex virus type 1 infection. Journal of virology 502

77:7261-7280. 503

27. Gregory D, Hargett D, Holmes D, Money E, Bachenheimer S. 2004. Efficient 504

replication by herpes simplex virus type 1 involves activation of the IκB 505

kinase-IκB-p65 pathway. Journal of virology 78:13582-13590. 506

28. Li H, Li X, Wei Y, Tan Y, Liu X, Wu X. 2009. HSV-2 induces TLRs and 507

NF-κB-dependent cytokines in cervical epithelial cells. Biochemical and 508

biophysical research communications 379:686-690. 509

29. Yedowitz JC, Blaho JA. 2005. Herpes simplex virus 2 modulates apoptosis and 510

stimulates NF-κB nuclear translocation during infection in human epithelial 511

HEp-2 cells. Virology 342:297-310. 512

30. Gillis PA, Okagaki LH, Rice SA. 2009. Herpes Simplex Virus Type 1 ICP27 513

Induces p38 Mitogen-Activated Protein Kinase Signaling and Apoptosis in HeLa 514

Cells. Journal of Virology 83:1767-1777. 515

31. McLean T, Bachenheimer S. 1999. Activation of cJUN N-terminal kinase by 516

herpes simplex virus type 1 enhances viral replication. Journal of virology 517

73:8415-8426. 518

32. Li H, Zhang J, Kumar A, Zheng M, Atherton SS, Yu FSX. 2006. Herpes 519

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

29

simplex virus 1 infection induces the expression of proinflammatory cytokines, 520

interferons and TLR7 in human corneal epithelial cells. Immunology 521

117:167-176. 522

33. Melchjorsen J, Sirén J, Julkunen I, Paludan SR, Matikainen S. 2006. 523

Induction of cytokine expression by herpes simplex virus in human 524

monocyte-derived macrophages and dendritic cells is dependent on virus 525

replication and is counteracted by ICP27 targeting NF-κB and IRF-3. Journal of 526

general virology 87:1099-1108. 527

34. Birdsall TC, Kelly GS. 1997. Berberine therapeutic potential of an alkaloid 528

found in several medicinal plants. Alternative Medicine Review 2. 529

35. Mahata S, Bharti AC, Shukla S, Tyagi A, Husain SA, Das BC. 2011. Berberine 530

modulates AP-1 activity to suppress HPV transcription and downstream signaling 531

to induce growth arrest and apoptosis in cervical cancer cells. Molecular cancer 532

10:39. 533

36. Remppis A, Bea F, Greten HJ, Buttler A, Wang H, Zhou Q, Preusch MR, Enk 534

R, Ehehalt R, Katus H. 2010. Rhizoma coptidis Inhibits LPS-Induced 535

MCP-1/CCL2 Production in Murine Macrophages via an AP-1 and NF Mediators 536

of inflammation 2010. 537

37. Kuo CL, Chi CW, Liu TY. 2004. The anti-inflammatory potential of berberine in 538

vitro and in vivo. Cancer Letters 203:127-137. 539

38. Lee C-H, Chen J-C, Hsiang C-Y, Wu S-L, Wu H-C, Ho T-Y. 2007. Berberine 540

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

30

suppresses inflammatory agents-induced interleukin-1β and tumor necrosis 541

factor-α productions via the inhibition of IκB degradation in human lung cells. 542

Pharmacological Research 56:193-201. 543

39. Cecil CE, Davis JM, Cech NB, Laster SM. 2011. Inhibition of H1N1 influenza 544

A virus growth and induction of inflammatory mediators by the isoquinoline 545

alkaloid berberine and extracts of goldenseal (Hydrastis canadensis). International 546

immunopharmacology 11:1706-1714. 547

40. Hayashi K, Minoda K, Nagaoka Y, Hayashi T, Uesato S. 2007. Antiviral 548

activity of berberine and related compounds against human cytomegalovirus. 549

Bioorganic & medicinal chemistry letters 17:1562-1564. 550

41. Chin LW, Cheng Y-W, Lin S-S, Lai Y-Y, Lin L-Y, Chou M-Y, Chou M-C, 551

Yang C-C. 2010. Anti-herpes simplex virus effects of berberine from Coptidis 552

rhizoma, a major component of a Chinese herbal medicine, Ching-Wei-San. 553

Archives of virology 155:1933-1941. 554

42. Andersen JH, Jenssen H, Gutteberg TJ. 2003. Lactoferrin and lactoferricin 555

inhibit Herpes simplex 1 and 2 infection and exhibit synergy when combined with 556

acyclovir. Antiviral research 58:209-215. 557

43. Schinazi R, Peters J, Williams C, Chance D, Nahmias A. 1982. Effect of 558

combinations of acyclovir with vidarabine or its 5'-monophosphate on herpes 559

simplex viruses in cell culture and in mice. Antimicrobial agents and 560

chemotherapy 22:499-507. 561

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

31

44. Stanwick TL, Schinazi RF, Campbell DE, Nahmias AJ. 1981. Combined 562

antiviral effect of interferon and acyclovir on herpes simplex virus types 1 and 2. 563

Antimicrobial agents and chemotherapy 19:672-674. 564

45. Yoosook C, Bunyapraphatsara N, Boonyakiat Y, Kantasuk C. 2000. 565

Anti-herpes simplex virus activities of crude water extracts of Thai medicinal 566

plants. Phytomedicine 6:411-419. 567

46. DeLuca NA, Schaffer PA. 1985. Activation of immediate-early, early, and late 568

promoters by temperature-sensitive and wild-type forms of herpes simplex virus 569

type 1 protein ICP4. Molecular and cellular biology 5:1997-2008. 570

47. McGregor F, Phelan A, Dunlop J, Clements J. 1996. Regulation of herpes 571

simplex virus poly (A) site usage and the action of immediate-early protein IE63 572

in the early-late switch. Journal of virology 70:1931-1940. 573

48. Patel A, Hanson J, McLean TI, Olgiate J, Hilton M, Miller WE, 574

Bachenheimer SL. 1998. Herpes simplex virus type 1 induction of persistent 575

NF-κB nuclear translocation increases the efficiency of virus replication. Virology 576

247:212-222. 577

49. Baldwin Jr AS. 1996. The NF-κB and IκB proteins: new discoveries and insights. 578

Annual review of immunology 14:649-681. 579

50. Amici C, Belardo G, Rossi A, Santoro MG. 2001. Activation of IκB Kinase by 580

Herpes Simplex Virus Type 1 A NOVEL TARGET FOR ANTI-HERPETIC 581

THERAPY. Journal of Biological Chemistry 276:28759-28766. 582

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

32

51. Zachos G, Clements B, Conner J. 1999. Herpes simplex virus type 1 infection 583

stimulates p38/c-Jun N-terminal mitogen-activated protein kinase pathways and 584

activates transcription factor AP-1. Journal of Biological Chemistry 585

274:5097-5103. 586

52. Kyriakis JM, Avruch J. 2001. Mammalian mitogen-activated protein kinase 587

signal transduction pathways activated by stress and inflammation. Physiological 588

reviews 81:807-869. 589

53. Andrade A, Silva P, Pereira A, De Sousa L, Ferreira P, Gazzinelli R, Kroon E, 590

Ropert C, Bonjardim C. 2004. The vaccinia virus-stimulated mitogen-activated 591

protein kinase (MAPK) pathway is required for virus multiplication. Biochem. J 592

381:437-446. 593

54. Holloway G, Coulson BS. 2006. Rotavirus activates JNK and p38 signaling 594

pathways in intestinal cells, leading to AP-1-driven transcriptional responses and 595

enhanced virus replication. Journal of virology 80:10624-10633. 596

55. Rahaus M, Desloges N, Wolff MH. 2004. Replication of varicella-zoster virus is 597

influenced by the levels of JNK/SAPK and p38/MAPK activation. Journal of 598

General Virology 85:3529-3540. 599

56. Jacqué JM, Mann A, Enslen H, Sharova N, Brichacek B, Davis RJ, Stevenson 600

M. 1998. Modulation of HIV‐1 infectivity by MAPK, a virion–associated kinase. 601

The EMBO journal 17:2607-2618. 602

57. Si X, Luo H, Morgan A, Zhang J, Wong J, Yuan J, Esfandiarei M, Gao G, 603

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

33

Cheung C, McManus BM. 2005. Stress-activated protein kinases are involved in 604

coxsackievirus B3 viral progeny release. Journal of virology 79:13875-13881. 605

58. Pleschka S, Wolff T, Ehrhardt C, Hobom G, Planz O, Rapp UR, Ludwig S. 606

2001. Influenza virus propagation is impaired by inhibition of the Raf/MEK/ERK 607

signalling cascade. Nature cell biology 3:301-305. 608

59. Panteva M, Korkaya H, Jameel S. 2003. Hepatitis viruses and the MAPK 609

pathway: is this a survival strategy? Virus research 92:131-140. 610

60. Hoffmann E, Dittrich-Breiholz O, Holtmann H, Kracht M. 2002. Multiple 611

control of interleukin-8 gene expression. Journal of leukocyte biology 612

72:847-855. 613

61. Kunsch C, Rosen CA. 1993. NF-kappa B subunit-specific regulation of the 614

interleukin-8 promoter. Molecular and Cellular Biology 13:6137-6146. 615

62. Bazzoni F, Kruys V, Shakhov A, Jongeneel C, Beutler B. 1994. Analysis of 616

tumor necrosis factor promoter responses to ultraviolet light. Journal of Clinical 617

Investigation 93:56. 618

619

620

621

622

623

624

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

34

Figures Legends 625

Fig. 1. Berberine inhibited HSV viral replication. (A) The molecular structure of 626

berberine. (B-C) Berberine inhibited the formation of intracellular HSV infectious 627

particles. Confluent HEC-1-A cells were mixed with serial concentrations of berberine 628

prior to infection with HSV- 1(HF) or HSV-2(G) (moi=1) for 24 hrs. The infectious viral 629

particles were released by three cycles of freezing and thawing the infected cells, and 630

viral infectivity was titrated by measuring the plaque forming unit (PFU) as described. 631

Titrations of HSV- 1(HF) or HSV-2 (G) are the means±the standard deviations of results 632

of three separate experiments. 633

634

Fig. 2. Berberine inhibited HSV late gene expression. (A-D) Berberine inhibited gD 635

expression. HEC-1-A cells were treated with various concentrations of berberine and then 636

infected with HSV-1 or HSV-2 (moi=1). gD-1/2 protein expression level was determined 637

via In-cell Western and normalized by β-catenin 24 hrs p.i. (A-B). The mRNA transcripts 638

level of gD was quantified via real-time PCR analysis (C-D). (E-F) Berberine interfered 639

with viral ICP5 expression. HEC-1-A cells treated with serial concentrations of berberine 640

were infected with HSV-1 or HSV-2, and ICP5 expression was determined via In-cell 641

Western 24 hrs p.i. (G) Berberine inhibited HSV-1 and HSV-2 gD expression in 642

HEK293T cells. HEK293T cells were treated with various concentrations of berberine 643

(Berb) prior to infection with HSV-1 or HSV-2 (moi=1). gD expression level was 644

determined via Western blot 24 hrs p.i. (H) The cytotoxic effect of berberine on HEC-1-A 645

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

35

and HEK293T cells. Cells were treated with serial concentrations of berberine. The cell 646

viability was determined by CCK-8 colorimetric assay after 24 hrs. All experiments were 647

performed three times. The representative results were shown. Data are mean values 648

(±SD) of triplicate determinations. 649

650

Fig. 3. Berberine inhibited HSV infection at a post-entry step. HEC-1-A cells were 651

infected with HSV-2 (moi=1) and exposed to berberine (50μM), acyclovir (50μg/ml) or 652

DXS (100μg/ml) at indicated time points. Viral infection level was represented by gD-2 653

expression as determined by In-cell Western 24 hrs p.i. Data represent mean values (±SD) 654

of triplicate determinations from three dependent experiments. 655

656

Fig. 4. Berberine inhibited HSV immediate early gene expression. (A) Berberine 657

inhibited ICP4-1 expression in a dose-dependent manner. Confluent HEC-1-A cells were 658

treated with indicated concentrations of berberine prior to infection with HSV-1 (moi=1). 659

ICP4-1 expression was determined via In-cell Western and normalized by β-catenin level 660

24 hrs p.i. (B) Berberine inhibited HSV-1/blue ICP4 promoter-driven lacZ gene 661

expression in a dose-dependent manner. HEC-1-A cells were treated with serial 662

concentrations of berberine or MG132 (5μg/ml) prior to infection with HSV-1/blue 663

(moi=1). The β-Gal activity was measured as described 12 hrs p.i. (C) HEC-1-A cells 664

were either mock-treated or treated with berberine (50 μM) and then infected with HSV-1 665

(moi=1). Cells were lysed at each time point. ICP4 was visualized by Western blot. (D) 666

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

36

HEC-1-A cells were either mock-treated or treated with berberine (50 μM) and then 667

infected with HSV-1 (moi=1). Cells were lysed at each time point. ICP27 was visualized 668

by Western blot. (E) HEC-1-A cells were either mock-treated or treated with berberine 669

(50 μM) and then infected with HSV-1 (moi=1). Cells were lysed at each time point. 670

ICP8 was visualized by Western blot. Data represent mean values (±SD) of triplicate 671

determinations from three dependent experiments. 672

673

Fig. 5. Berberine inhibited HSV-2-induced NF-κB activation. (A) HEC-1-A cells were 674

transfected with NF-κB-luc reporter plasmid. The cells were mock-treated, treated with 675

indicated concentrations of berberine or MG132 (5μg/ml) prior to mock-infected or 676

infected with HSV-2 (moi=1). The relative luciferase activity was determined after 24 hrs 677

and expressed as a fold change of that of the mock-treated cells. (B) Berberine inhibited 678

HSV-2-induced IκB-α degradation. HEC-1-A cells were mock-infected or infected with 679

HSV-2 (moi=1) in the absence or presence of berberine (12.5 and 50μM) or MG132 680

(5μg/ml). IκB-α, gD and GAPDH levels were determined 12 or 24 hrs p.i. by Western 681

blot. The band intensity was determined by Odyssey V3.0 software. (C) Berberine 682

suppressed TNF-α -induced NF-κB activation. HEC-1-A cells transfected with NF-κB-luc 683

reporter plasmid were mock-treated, treated with berberine (50μM) or MG132 (5μg/ml) 684

prior to exposure to TNF-α (100ng/ml). The relative luciferase activity was determined 685

after 12 hrs and expressed as a fold change of that of the mock-treated cells. (D) 686

Berberine interfered with HSV-2-induced p65 nuclear translocation. HEC-1-A cells were 687

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

37

mock-infected or infected with HSV-2 (moi=1) in the presence or absence of berberine 688

(50μM). p65 translocation was determined via immunofluorescence assay 24 hrs p.i. Data 689

represent mean values (±SD) of triplicate determinations from three dependent 690

experiments. 691

692

Fig. 6. Berberine inhibited HSV-2-induced JNK activation, but showed less effect on 693

p38 MAP kinase activation. (A) Berberine inhibited HSV-2-induced AP-1 activation. 694

HEC-1-A cells were transfected with AP-1-luc reporter plasmid. The cells were 695

mock-treated, treated with serial concentrations of berberine, SB203580 (20μM) or 696

SP600125 (20μM) prior to mock-infected or infected with HSV-2 (moi=1). SB203580 697

and SP600125, p38/MAP kinase and JNK inhibitors, respectively, were used as controls. 698

The relative luciferase activity was determined after 24 hrs and expressed as a fold 699

change of that of the mock-treated cells. (B) HSV-2 infection induced the activation of 700

JNK and p38 MAP kinase pathways in HEC-1-A cells. HEC-1-A cells were infected with 701

HSV-2 (moi=1). Cells were lysed at each time point. The phosphorylation level of p38 702

MAP kinase, JNK and their substrates were determined via Western blot. (C) SB203580 703

and SP600125 showed inhibitory effect of HSV-2 replication in HEC-1-A cells. 704

HEC-1-A cells seeded in 96-well plate were treated with serial concentration of 705

SB203580 and SP600125 prior to infected with HSV-2 (moi=1). gD protein expression 706

level was determined via In-cell Western and normalized by β-catenin 24 hrs p.i. (D) 707

Berberine inhibited the virus-induced JNK phosphorylation, but shown less effect on p38 708

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

38

MAP kinases phosphorylation. HEC-1-A cells were mock-infected or infected with 709

HSV-2 (moi=1) in the presence or absence of berberine. JNK, p38 MAP kinase, and their 710

phosphorylated forms and the downstream p-c-Jun, p-ATF-2 were determined 12 hrs p.i. 711

(E) Berberine inhibited PMA-induced JNK activation. HEC-1-A cells were mock-treated 712

or treated with PMA (4μg/ml) in the presence or absence of berberine. JNK, p38 MAP 713

kinase, and their phosphorylated forms and their substrates were determined after 2 hrs. 714

All experiments were performed three times and the representative results were shown. 715

Data represent mean values (±SD) of triplicate determinations. 716

717

Fig. 7. Berberine down-regulated HSV-2-induced IL-8 and TNF-α expression. 718

HEC-1-A cells were mock-infected or infected with HSV-2 (moi=1) in the presence or 719

absence of berberine (50μM). The IL-8 (A) and TNF-α (B) expression levels were 720

quantified by real-time PCR after 24 hrs p.i. (C) Berberine inhibited HSV-2-induced 721

TNF-α promoter activation. HEC-1-A cells were transfected with TNF-α promoter 722

luciferase reporter plasmid, and after 24 hrs, cell were infected with HSV-2 (moi=1) in 723

the presence of serial concentrations of berberine or MG132 (5μg/ml). The relative 724

luciferase activity was measured 24 hrs p.i. Data represent mean values (±SD) of 725

triplicate determinations from three dependent experiments. 726

727

Fig. 8. Berberine showed moderate synergistic effect with acyclovir against HSV-2 728

infection. The effective concentrations for inhibition of HSV-2 infection by a compound 729

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

39

alone and in combination were plotted in two curves. The CI values were calculated using 730

CalcuSyn. CI <0.1: very strong synergism; 0.1–0.3: strong synergism; 0.3–0.7: synergism; 731

0.7–0.85: moderate synergism; 0.85–0.90: slight synergism; 0.9-1.1: Nearly additive 732

and >1.1: antagonism. Data represent mean values (±SD) of triplicate determinations 733

from three dependent experiments. 734

735

Table 1. Primer pairs used in this study 736

Gene Name Sequence

Forward Reverse

HSV-1 gD AGCAGGGGTTAGGGAGTTG CCATCTTGAGAGAGGCATC

HSV-2 gD CCAAATACGCCTTAGCAGACC CACAGTGATCGGGATGCTGG

IL-8 ATTGAGAGTGGACCACACTG ACTACTGTAATCCTAACACCTG

TNF-α CCTGCCCCAATCCCTTTATT CCCTAAGCCCCCAATTCTCT

GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG

737

738

739

740

741

742

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

Table 1. Primer pairs used in this study

Gene Name Sequence

Forward Reverse

HSV-1 gD AGCAGGGGTTAGGGAGTTG CCATCTTGAGAGAGGCATC

HSV-2 gD CCAAATACGCCTTAGCAGACC CACAGTGATCGGGATGCTGG

IL-8 ATTGAGAGTGGACCACACTG ACTACTGTAATCCTAACACCTG

TNF-α CCTGCCCCAATCCCTTTATT CCCTAAGCCCCCAATTCTCT

GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG

on May 24, 2018 by guest

http://aac.asm.org/

Dow

nloaded from