J O U R N A L O F F U N C T I O N A L F O O D S 5 ( 2 0 1 3 ) 1 9 6 6 – 1 9 7 4

.sc iencedi rect .com

Avai lab le at www

ScienceDirect

journal homepage: www.elsevier .com/ locate / j f f

Administration of a b-glucan-enriched extractactivates beneficial hepatic antioxidant andanti-inflammatory mechanisms instreptozotocin-induced diabetic rats

1756-4646/$ - see front matter � 2013 Elsevier Ltd. All rights reserved.http://dx.doi.org/10.1016/j.jff.2013.09.018

* Corresponding author. Tel.: +381 11 20 78 326; fax: +381 11 27 61 433.E-mail address: melita@ibiss.bg.ac.rs (M. Vidakovic).Abbreviations: AGE, advanced glycation end-product; a2M, a2-macroglobulin; ALT, alanine aminotransferase; AP, acute-p

aspartate aminitransferase; BGEE, b-glucan-enriched extract; BUN, blood urea nitrogen; GST, glutathione-S-transferamalondialdehyde; pSTAT3, tyrosine-phosphorylated STAT3; RAGE, receptor for AGE; ROS, reactive oxygen species; STAtransducer and activator of transcription 3; STZ, streptozotocin; TBARS, thiobarbituric acid reactive substances; TNF-a, tumoufactor-a; 2VP, 2-vinyl pyridine

Aleksandra Uskokovic, Mirjana Mihailovic, Svetlana Dinic, Jelena Arambasic Jovanovic,Nevena Grdovic, Jelena Markovic, Goran Poznanovic, Melita Vidakovic*

Department of Molecular Biology, Institute for Biological Research, University of Belgrade, Bulevar Despota Stefana 142, 11060 Belgrade,

Serbia

A R T I C L E I N F O A B S T R A C T

Article history:

Received 25 January 2013

Received in revised form

20 September 2013

Accepted 23 September 2013

Available online 20 October 2013

Keywords:

Acute-phase proteins

b-Glucan

Diabetes

Liver

Oxidative stress

Inflammation

The beneficial effect of a commercially available b-glucan-enriched extract (BGEE) from cer-

eal grain, against a diabetes-induced hepatic redox imbalance and inflammatory response

in streptozotocin-induced diabetic rats was evaluated. Diabetic rats that were treated with

BGEE exhibited lower hyperglycaemia and improved biochemical parameters of liver dam-

age. BGEE attenuated hepatic oxidative stress, revealed by a decreased concentration of

thiobarbituric acid reactive substances and a restored GSH/GSSG ratio. BGEE also exerted

an anti-inflammatory effect on the liver, evidenced by the normalization of the serum con-

centrations of the ‘‘positive’’ and ‘‘negative’’ acute-phase proteins, a2-macroglobulin and

albumin, respectively, as well as by upregulation of anti-inflammatory cytokine IL-10 and

IL-4 mRNA expression, and inhibition of RAGE/NF-jB signaling. These findings suggest that

BGEE application exerts a beneficial effect in the liver of streptozotocin-induced diabetic

rats via its antioxidant and anti-inflammatory activities, and that it therefore possesses

an important potential in diabetes management.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Diabetes mellitus is a metabolic disorder characterized by

hyperglycaemia as a result of disrupted insulin-signaling.

The chronic elevation in glucose concentration and other

metabolites elicits via different pathways, processes that

cause a sharp increase in the production of reactive oxygen

species (ROS), depletion of the cell’s antioxidant defense net-

work and establishment of increased systemic oxidative

stress (Giacco & Brownlee, 2010). The persisting redox

hase; AST,se; MDA,T3, signalr necrosis

J O U R N A L O F F U N C T I O N A L F O O D S 5 ( 2 0 1 3 ) 1 9 6 6 – 1 9 7 4 1967

imbalance leads to the activation of stress-signaling path-

ways which trigger the expression of different inflamma-

tion-regulated genes (Esposito et al., 2002; Evans, Goldfine,

Maddux, & Grodsky, 2002). The oxidative stress-activated pro-

inflammatory pathways represent a complex, interdependent

and self-perpetuating pathogenic mechanism that, together

with poor glycaemic control, promotes a variety of diabetic

complications in different tissues and organs, including the

liver (Rutter, 2000). Hence, oxidative stress represents an

important target for therapeutic intervention in diabetes

management.

Diabetes management is often based on synthetic agents,

but can include plant-derived bioactive principles or nutra-

ceuticals, as many naturally occurring substances have anti-

oxidant activities that can protect tissues against the

damaging effects of ROS (Xue, Chen, Lu, & Jin, 2009). The b-

glucans, which have been identified as active components

of some natural products (Zekovic, Kwiatkowski, Vrvic,

Jakovljevic, & Moran, 2005), are found at high levels in cell

walls of fungi, yeast, oat, barley, and bacteria (Chen & Seviour,

2007). The dietary intake of b-glucans provides considerable

potential for diabetes management by virtue of their ability

to attenuate the postprandial rise in blood glucose levels by

delaying stomach emptying (Lo, Tsai, Wasser, Yang, & Huang,

2006; Peng, Chang, Yang, Huang, & Wang, 2012), decreasing

appetite and reducing food intake so that dietary glucose is

absorbed gradually (Ludwig, 2003).

In the present study we investigated the effect of daily

administration for four weeks, of a b-glucan-enriched extract

(BGEE) from cereal grain, on the oxidative and inflammatory

processes in the liver of type 1 diabetic rats, using the

experimental model of multiple low-dose streptozotocin

(STZ)-induced diabetes.

2. Materials and methods

2.1. Materials

The b-glucan-enriched extract (BGEE) from cereal grains is for

human consumption and is produced by Essentia s.r.o., Pop-

rad, in the Slovak Republic, using stringent quality control

to ensure stable purity and potency of the standardized prep-

aration. The BGEE examined herein was supplied by Agrobiv

d.o.o. (Rijeka, Croatia). It is a complex mixture of b-glucan

type fibers with a high capacity for binding water that are

sourced from barley, oat, asparagus, and maize, at a dry sub-

stance ratio of 85:7:1:6. The BGEE is a concentrate of colloid

micronized b-glucan (P80%). Based on methylation analysis,

the material was characterized as a (1,3/1,4) b-glucan with a

small number of 1,6-linked glucose residues. The maximal

protein, fat, and sodium contents in the standardized dry

substance were 20, 10, and 15 mg/g, respectively. Routine

microbiological testing confirmed the absence of any contam-

inants. The quality of the BGEE is ensured by the Essentia cer-

tificate. The extraction procedure and quantitative

measurement of the b-glucans have been reported by Karacs-

onyi and Kuniak (1994) and Hozova, Kuniak, Moravcıkova, and

Gajdosova (2007) who examined 43 samples of 6 cereal varie-

ties (oats, barley, wheat, millet) and pseudocereal (buckwheat,

amaranth). STZ was obtained from MP Biomedicals (Solon,

OH, USA).

2.2. Animals

Male albino 2.5-month old (200–250 g) Wistar rats were used.

The rats were kept under controlled environmental condi-

tions of temperature (22 ± 2 �C), a 12 h light/dark cycle. Stan-

dard food pellets and tap water were provided ad libitum. All

the animal procedures were approved by the Committee for

Ethical Animal Care and Use of the Institute for Biological Re-

search, Belgrade, which acts in accordance with the Guide for

the Care and Use of Laboratory Animals, published by the US

National Institute of Health (NIH Publication No. 85/23, re-

vised in 1986).

2.3. Experimental design

The rats were divided into non-diabetic (n = 12) and diabetic

groups (n = 12). Diabetes was induced by intraperitoneal (i.p.)

injection with multiple low dose of STZ (40 mg/kg), in freshly

prepared 0.1 M citrate buffer (pH 4.5) for five consecutive days.

Blood glucose was measured 24 h after the last STZ injection.

Blood samples were obtained from the tail vein of overnight-

fasted rats, and glucose was measured with a blood glucose-

meter (Accu-Chek Active, Roche Diagnostics Scientific Office,

Cairo, Egypt). Rats were considered to have diabetes when the

fasting blood glucose level exceeded 20 mmol/L. Both, non-

diabetic and diabetic groups of rats were further randomly di-

vided into two sub-groups: controls (n = 6) and rats that were

administered BGEE i.p. at a dose of 80 mg/kg throughout a

four week period (n = 6).

2.4. Determination of blood glucose concentration,glycosylated haemoglobin (GlyHb) and blood urea nitrogen(BUN) levels

Blood glucose concentrations were measured using a com-

mercial kit (Gluco-quant Glucose/HK, Boehringer Mannheim,

Germany) based on the hexokinase/G6P-DH enzymatic meth-

od. GlyHb was determined by the colorimetric assay accord-

ing to Parker, England, DaCosta, Hess, and Goldstein (1981).

The level of blood urea nitrogen (BUN) was estimated accord-

ing to the GLDH method (Human, Wiesbaden, Germany).

2.5. Assessment of the parameters of liver damage

Aspartate and alanine amino transfarase (AST and ALT,

respectively) activities were estimated in the serum by mea-

suring the produced oxaloacetate and pyruvate, respectively,

using an optimized standard UV kinetic method kit (GPT

(ALAT) IFCC mod., GOT (ASAT) IFCC mod). The glutathione-

S-transferase (GST) activity was determined according to Ha-

big, Pubst, and Jakoby (1974). One unit of GST activity was de-

fined as nmol GSH/min/mL of plasma.

2.6. Serum and tissue preparation

Serum was prepared after blood clotting and centrifugation at

2000g for 10 min at room temperature. Samples were stored at

1968 J O U R N A L O F F U N C T I O N A L F O O D S 5 ( 2 0 1 3 ) 1 9 6 6 – 1 9 7 4

�80 �C until assayed. Following blood collection, an abdominal

incision was made and the liver was removed quickly, soaked

in ice-cold 0.9% NaCl and blotted dry. For the thiobarbituric

acid reactive substances (TBARS) assay a 10% homogenate of

fresh liver tissue was prepared in 1.15 M KCl. For Western blot

analysis, a 10% homogenate of liver tissue was prepared in ice

cold lysis buffer (137 mM NaCl, 20 mM Tris–HCl, pH 7.5, 1%

Tween 20, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride

(PMSF)). After centrifugation (2000g, 10 min, 4 �C), the obtained

supernatants were stored at �80 �C until use. For determina-

tion of the GSH/GSSG ratio a 20% homogenate of fresh liver tis-

sue was prepared in phosphate buffer (100 mM NaH2PO4,

1 mM ethylenediaminetetraacetic acid (EDTA) pH 7.5). The

homogenate was centrifuged at 5000g for 5 min at room tem-

perature (Eppendorf 5415 R centrifuge), and the resulting

supernatant was deproteinized with 5% 5-sulfosalicylic acid.

After centrifugation at 7000g for 5 min at 4 �C, the resulting

supernatant was neutralized with triethanolamine and stored

at �80 �C until use. Nuclear and cytosol fractions were pre-

pared from liver tissue according to the instructions described

in ProteoJET cytoplasmic and nuclear protein extraction kit

(Fermentas, Burlington, ON, Canada).

2.7. Assessment of the indicators of the acute-phaseresponse, a2-macroglobulin (a2M) and albumin, in the serum

Relative changes in serum a2M levels were determined by

Western blotting using anti-goat a2M antibody (Santa Cruz

Biotechnology, Santa Cruz, CA, USA). Serum albumin was

determined according to Gambal (1971). The serum was trea-

ted with polyethylene glycol (25%, v/v) at 4 �C for 24 h in order

to precipitate all other serum proteins except albumin that re-

mained in the supernatant, followed by 20 min centrifugation

at 30,000g (Beckman, rotor Ti-50, Brea, CA, USA). The concen-

tration of albumin was determined in the obtained superna-

tant, according to Lowry, Rosebrough, Farr, and Randall (1951).

2.8. Thiobarbituric acid reactive substances (TBARS)assay

TBARS levels were assayed for products of lipid peroxidation

as described by Ohkawa, Ohishi, and Yagi (1979). The basic

principle of the TBARS method is based on the reaction of

malondialdehyde with thiobarbituric acid (TBA) at 95 �C.

Briefly, aliquots of the liver homogenates (0.1 ml) were mixed

with 0.2 ml of 8.1% SDS, 1.5 ml of 20% acetic acid (pH 3.5),

1.5 ml of 0.8% TBA and 0.7 ml water and heated at 95 �C for

60 min. After cooling to room temperature, 1 ml of water

and 5 ml of n-butanol/pyridine (15:1, v/v) were added, mixed

and centrifuged at 3000g for 10 min. The red pigment in the

supernatant fractions was estimated by absorbance at

532 nm. A calibration curve was prepared with 1,1,3,3-tetra-

methoxypropan (concentrations ranged from 25 nmol/ml to

1 lmol/ml).

2.9. Determination of GSH/GSSG

Total glutathione (GSH) and glutathione disulphide (GSSG)

levels were determined by the standard recycling method

using the Glutathione Assay Kit (Cayman Chemicals Com-

pany, Ann Arbor, MI, USA). Glutathione disulphide was quan-

tified after derivatization of reduced glutathione with 2-

vinylpyridine (2VP). Samples for GSSG determination were

incubated at room temperature with 2 ll 0.5 M 2VP solution

per 50 ll of deproteinized sample for 1 h. The levels of total

GSH and GSSG were calculated from standard curves con-

structed using reference GSH and GSSG.

2.10. SDS–polyacrylamide gel electrophoresis (SDS–PAGE)and Western blot analysis

Twenty micrograms of proteins and 10 ll of serum were

separated by 12% SDS–PAGE and electroblotted onto PVDF

membranes. Western blot analysis was performed using

polyclonal antibodies against rat signal transducer and acti-

vator of transcription 3 (STAT3) factor, tyrosine-phosphory-

lated STAT3 (pSTAT3), receptor for advanced glycated end-

product (RAGE) and the 65 kD protein (p65) nuclear factor-

jB (NF-jB), and goat a2M antibody (Santa Cruz Biotechnol-

ogy, Santa Cruz, CA, USA). Anti-b actin (Abcam, Cambridge,

UK) and anti-lamin B (Santa Cruz Biotechnology, Santa

Cruz, CA, USA) antibodies were used as loading controls.

Immunoreactive bands were identified with an enhanced

chemiluminescence detection system (Santa Cruz Biotech-

nology, CA, USA) according to the manufacturer’s instruc-

tions. The density of the bands was quantified using

TotalLab (Phoretix, Newcastle Upon Tyne, UK) electrophore-

sis software (ver. 1.10).

2.11. Real-time quantitative PCR analysis (RT-qPCR)

Total RNA was isolated from liver tissue using RNeasy Mini Kit

(Qiagen, Hilden, Dusseldorf, Germany) as recommended by

manufacturer. For cDNA synthesis, 1 lg of the total RNA was

treated with DNase I and reverse-transcribed with RevertAid

First Strand cDNA Synthesis Kit (Fermentas, Burlington, ON,

Canada) using oligo(dT) primers. mRNA levels were quantita-

tively determined on an ABI Prism 7000 Sequence Detection

system (Applied Biosystems, Carlsbad, CA, USA) using

SYBR-green technology. To perform the qPCR reaction, 10 ll

Maxima SYBR Green/ROX qPCR Master Mix (2·) were mixed

with forward and reverse primers (10 lM each), cDNA tem-

plate and nuclease-free water to reach a final volume of

20 ll. RT-qPCR amplification conditions included an initial

step at 50 �C for 2 min, followed by a step of initial denatur-

ation at 95 �C for 10 min and a subsequent 2-step program

at 95 �C for 15 s and 58 �C for 60 s for 40 cycles. PCR reactions

were carried out in triplicate. Expression levels of target genes

were normalized to b-actin gene expression level. Sequences

of the primers (Invitrogen, Carlsbad, CA, USA) used in this

study are listed in Table 1.

2.12. Statistical analysis

Mean and standard error values (SE) were determined for all

the parameters studied. Results were statistically analyzed

Table 1 – Sequences of the primers used for RT-qPCR analysis.

Gene name Sequence (5 0–3 0) Fragment size (bp)

Rat TNF-a FP: CTCCCAGAAAAGCAAGCAAC 210

RP: CGAGCAGGAATGAGAAGAGG

Rat IL-10 FP: GAAGACCCTCTGGATACAGATGC 165

RP: TGCTCCACTGCCTTGCTTTT

Rat IL-4 FP: CGGTGAACTGAGGAAACTCTGTAGA 143

RP: TCAGTGTTGTGAGCGTGGACTC

RAGE FP: CAGGAAGGACTGAAGCTTGG 321

RP: GTTTCCCATCCAAGTGCCAG

FP, forward primer and RP, reverse primer.

Fig. 1 – The effects of BGEE treatment on: (A) TBARS level,

and (B) the GSH/GSSG ratio in livers of non-diabetic (ND) and

diabetic (D) rats. Values are means with their standard

errors (n 6). Means not sharing a common letter are

significantly different between groups (P < 0.05).

J O U R N A L O F F U N C T I O N A L F O O D S 5 ( 2 0 1 3 ) 1 9 6 6 – 1 9 7 4 1969

by analysis of variance (ANOVA). Duncan’s multiple range test

(DMRT) was performed to determine the significant difference

between groups.

3. Results

3.1. The effect of BGEE administration on hyperglycaemiaand the indicators of diabetes-activated pathologicalprocesses in the liver

Experimental diabetes was confirmed by the high fasting ser-

um glucose levels in STZ-treated rats. Under diabetic condi-

tions, the levels of GlyHb and BUN were 2- and 4-fold above

the control values. The activation of detrimental processes

in the liver of diabetic rats was observed as increased specific

enzymatic activities of the established markers of hepatotox-

icity, ALT, AST, and, GST (Table 2). The administration of BGEE

to diabetic rats alleviated hyperglycaemia, decreased GlyHb

and BUN levels, improved the enzymatic activities of ALT

and AST, and restored serum GST activity to the control level.

3.2. The effect of BGEE administration on the controlpoints that influence the oxidative response in the liver ofdiabetic rats

To assess the function of BGEE in oxidative processes in the

liver provoked by STZ-induced diabetes, we examined the

oxidation of lipids and glutathione. The level of TBARS served

as a marker of lipid peroxidation (Fig. 1A). The TBARS level

was significantly higher in the livers of diabetic rats than in

Table 2 – The effect of BGEE on plasma glucose level, GlyHb, BUN and enzyme activities of ALT, AST, and GST in non-diabetic and STZ induced-diabetic rats (Mean values with their standard errors, n 6).

ND D

Experimental groups Control BGEE treated Control BGEE treated

Glucose (mmol/L) 5.4 ± 0.3a 5.1 ± 0.2a 29.1 ± 1.3b 18.6 ± 1.1c

GlyHb (lmol/gHb) 8.8 ± 0.4a 7.9 ± 0.3a 18.0 ± 0.8b 11.9 ± 0.4c

BUN (mmol/L) 5.3 ± 0.2a 4.8 ± 0.2a 22.8 ± 0.9b 14.8 ± 0.6c

AST (U/L) 174 ± 7.2a 163 ± 6.8a 357 ± 12.8b 277 ± 10.4c

ALT (U/L) 56 ± 2.2a 48.2 ± 2.1a 193 ± 7.2b 174 ± 6.8c

GST (U/ml) 26.9 ± 1.4a 23.7 ± 1.2a 188 ± 8.1b 26.5 ± 1.3c

GlyHb-glycosylated hemoglobin; BUN-blood urea nitrogen; AST-aspartate aminotransferase; ALT-alanine aminotransferase; GST-glutatione-S-

transferase; ND-non-diabetic rats; D-diabetic rats.a,b,cMean values with unlike superscript letters were significantly different (P < 0.05).

1970 J O U R N A L O F F U N C T I O N A L F O O D S 5 ( 2 0 1 3 ) 1 9 6 6 – 1 9 7 4

non-diabetic rats. Treatment of diabetic rats with BGEE re-

versed the elevated TBARS level to the physiological value.

From this, we concluded that BGEE administration prevented

diabetes-related lipid peroxidation. A significant decrease in

the GSH/GSSG ratio was detected in the livers of diabetic rats

compared to non-diabetic rats (Fig. 1B). This decrease was

prevented by the treatment of diabetic rats with BGEE; the

treatment restored the GSH/GSSG level to the physiological

value measured in non-diabetic rats.

3.3. The effect of BGEE administration on theinflammatory response in the liver of diabetic rats

Shortly after tissue injury, hepatic secretion of several posi-

tive acute-phase (AP) proteins is increased while the concen-

tration of negative AP proteins is decreased. Most AP proteins

are glycoproteins synthesized mainly by hepatocytes upon

stimulation by proinflammatory cytokines and released into

the bloodstream. To assess the inflammatory status of the li-

ver, we examined the changes in the serum concentrations of

the prominent rat AP protein a2M, and the ‘‘negative’’ AP pro-

tein albumin (Fig. 2A). The significant rise in a2M and decrease

in albumin concentration was observed in diabetic rats. This

result points to the activation of an AP-like stress response in

the liver, indicating that in diabetes the liver switched to an

inflammatory state. BGEE-treated diabetic rats exhibited a de-

crease in liver inflammation, judging by the lower level of ser-

Fig. 2 – The effect of BGEE treatment of non-diabetic (ND) and dia

sera and (B) abundance of STAT3 and pSTAT3 in liver nuclear a

results of quantification of immunoblots using TotalLab [Phoret

graph depicting changes in STAT3 and pSTAT3 protein levels re

controls, and expressed as the percentage relative to non-diabe

(n 6). Means not sharing a common letter are significantly diffe

um a2M and normalized albumin concentration. In

agreement with the activation of an AP-like response, in dia-

betic rats STAT3, a key mediator of AP gene induction in the

liver was induced. This was observed as a higher ratio of nu-

clear vs cytosolic STAT3, and as an increased nuclear level of

the activated/phosphorylated pSTAT3 isoform in diabetic rats

compared to non-diabetic rats (Fig. 2B). After the treatment of

diabetic rats with BGEE the nuclear vs cytosolic STAT3 ratio

was not completely re-established, however, the relative

abundance of nuclear pSTAT3 was as estimated in the non-

diabetic rats.

Cytokine TNF-a is also involved in the stimulation of the

AP response in the liver. Accordingly, in the livers of diabetic

rats, TNF-a mRNA expression was upregulated. However,

BGEE administration to diabetic rats did not significantly low-

er TNF-a expression (Fig. 3). Examination of anti-inflamma-

tory cytokine IL-10 and IL-4 mRNA expression revealed their

downregulation in diabetic rats, but markedly increased

expression after the BGEE treatment.

To further clarify the specific response and underlying sig-

naling event related to the protective effects of BGEE against

oxidative stress and inflammatory processes in the liver of

diabetic rats, we focused on the RAGE/NF-jB axis that as-

sumes a major role in chronic diabetic inflammation. RAGE

expression was assessed by RT-qPCR and Western blot analy-

sis. RT-qPCR showed that RAGE mRNA was induced in the liv-

ers of diabetic rats, and that this was effectively prevented by

betic (D) rats on (A) levels of a2-macroglobulin and albumin in

nd cytosol fractions assessed by Western blot analysis. The

ix] electrophoresis software [ver. 1.10] are presented in the

lative to nuclear (lamin B) and cytosol (b-actin) loading

tic rats (100%). Values are means with their standard errors

rent between groups (P < 0.05).

Fig. 3 – The effect of BGEE treatment on TNF-a, IL-10 and IL-4

mRNA expression in the livers of non-diabetic (ND) and

diabetic (D) rats determined by real-time qPCR. Relative

mRNA expression levels were normalized to b actin and are

expressed as percentages relative to the non-diabetic

control value (100%). Values are means with their standard

errors (n 6). Means not sharing a common letter are

significantly different between groups (P < 0.05).

J O U R N A L O F F U N C T I O N A L F O O D S 5 ( 2 0 1 3 ) 1 9 6 6 – 1 9 7 4 1971

the BGEE treatment (Fig. 4A). This result corresponds directly

with the observed relative changes in RAGE protein levels in

untreated and BGEE-treated diabetic rats (Fig. 4B). In many

cell types, increased nuclear translocation of NF-jB is a key

downstream event in the RAGE signaling pathway. NF-jB acti-

vation was assessed by examining the translocation of p65

from the cytosol to the nucleus. Western blot analysis showed

that p65 was increased in the liver nuclear fraction and mark-

edly decreased in the cytosol in diabetic rats compared to

non-diabetic rats (Fig. 4C). In the livers of BGEE-treated dia-

betic rats, the nuclear/cytosol ratio of p65 was changed: nu-

clear p65 was decreased and cytosolic p65 was increased in

comparison to diabetic rats. This result suggests that BGEE

administration to diabetic rats alleviated the intensity of dia-

betes-induced RAGE/NF-jB signaling in the liver.

4. Discussion

Hepatic oxidative stress and inflammatory processes eventu-

ate a pathological progression toward liver dysfunction and

onset of complex hepatobilliary disorders such as observed

in long-standing, poorly controlled diabetes. The central ef-

fect of the BGEE treatment of diabetic rats was a reduction

of hyperglycaemia. This effect was reported previously in ani-

mal experiments and b-glucans (Lo et al., 2006). While chronic

exposure to elevated glucose concentrations elicits damage in

a variety of cell types through diverse mechanisms, oxidative

stress is considered to be a common link of cell dysfunction

(Kahn, 2003). Supra-physiological glucose concentrations

augment liver damage through ROS-mediated lipid peroxida-

tion events (Palsamy, Sivakumar, & Subramanian, 2010). Con-

centrations of the lipid peroxidation product TBARS serve to

ascertain the redox balance in diabetic patients (Cheeseman

& Slate, 1993). The antioxidative effect of BGEE administration

to diabetic rats was revealed by its ability to suppress the rise

in TBARS. The depletion in diabetes of GSH, an important

constituent of intracellular protective mechanisms against

oxidative stress, has been documented in experimental

(Dincer, Alademir, _Ilkova, & Akcay, 2002) and clinical (Muruga-

nandam et al., 1992) studies. We observed a lower GSH/GSSG

ratio in the livers of diabetic rats and its normalization after

BGEE administration. This result is further proof of the anti-

oxidative effect of BGEE administration. Our previous results

revealed that the treatment of diabetic rats with BGEE signif-

icantly improved the activities of liver antioxidative enzymes

SOD and CAT (Mihailovic et al., 2013a). Furthermore, the over-

all improvement of antioxidative defense mechanisms influ-

enced by the BGEE treatment, correlated with a reduction of

DNA damage in the livers of diabetic rats, as revealed by the

comet assay. Since the index of induced DNA damage did

not statistically differ between the non-diabetic controls

and non-diabetic rats treated with BGEE, it was assumed that

BGEE did not exert any apparent genotoxic effects (Mihailovic

et al., 2013a).

The significant reduction of hepatic oxidative stress after

BGEE administration was accompanied by the improvement

of hepatic biochemical parameters, lower enzymatic activi-

ties of AST and ALT, as well as of GST, which is considered

as a very specific biomarker of hepatocellular damage and

inflammation (Cascales et al., 1999). These results point to

an overall improvement of liver functioning as a consequence

of BGEE treatment. The ability of BGEE to restore normal or-

gan functioning is also supported by the observed improve-

ment of kidney activity shown by the decrease of the BUN

level after the treatment of diabetic rats with BGEE.

There is an increasing body of evidence that correlates the

hyperglycaemia and diabetic phenotype with chronically ele-

vated systemic levels of AP proteins (Lin et al., 2001). Although

the induction of AP proteins exerts a number of protective

functions their excessive or persistent overexpression during

chronic illnesses such as diabetes can lead to tissue and organ

damage (Gerhardinger et al., 2005). Augmented AP response

may be a mechanism that explains many of the clinical and

biochemical features of type 2 diabetes and its complications

(Pickup, Chusney, Thomas, & Burt, 2000). In addition, Yokoy-

ama, Jensen, Jensen, and Deckert (1995) find that AP proteins

are elevated in type 1 diabetes, especially in albuminuric pa-

tients. Indeed, in our STZ-induced diabetic rats, the increases

in AP-promoting signaling molecules, liver TNF-a, nuclear

STAT3, and the AP protein a2MG in the serum and a lower ser-

um albumin concentration provide evidence for the activa-

tion of an AP type of reaction of the liver that is

incorporated in the systemic inflammatory response. A sig-

nificant decrease of a2M and a rise in serum albumin concen-

tration were observed after the treatment of diabetic rats with

BGEE. This result reveals an important attenuation of the

inflammatory response in diabetic rat liver that was most

likely linked to the decrease in STAT3 activation. This is

further supported by the observed changes in cytokine

expression levels. Namely, the BGEE treatment initiated

anti-inflammatory mechanisms, as judged by the upregula-

tion of the expression of IL-10 and IL-4 which play important

physiological functions in limiting inflammation (Asadullah,

Sterry, & Volk, 2003). In addition, IL-10 was shown to prevent

hepatocellular damage via its anti-inflammatory action (Gao,

2005). However, the absence of an effect of BGEE administra-

tion to diabetic rats on the expression of TNF-a reveals that

its inflammation suppressing activity is limited. Indeed, stud-

Fig. 4 – The effect of the BGEE treatment on the RAGE/NF-jB axis in the livers of non-diabetic (ND) and diabetic (D) rats. (A)

RAGE mRNA levels were determined by RT-qPCR, normalized to b actin and expressed as the percentage relative to the control

value (100%). (B) RAGE protein levels in liver homogenates and (C) p65 NF-jB protein levels in liver nuclear and cytosol

fractions assessed by Western blot analysis. The blots were normalized to the corresponding loading controls, quantified by

TotalLab [Phoretix] electrophoresis software [ver. 1.10], and expressed as percentages relative to the non-diabetic controls

(100%). Values are means with their standard errors (n 6). Means not sharing a common letter are significantly different

between groups (P < 0.05).

1972 J O U R N A L O F F U N C T I O N A L F O O D S 5 ( 2 0 1 3 ) 1 9 6 6 – 1 9 7 4

ies of the oxidative and inflammatory activities of glucan-

containing products have yielded controversial conclusions

(Tsiapali et al., 2001), and while some reports emphasize the

proinflammatory activity of b-glucans (Williams, 1997) and

ROS generation (Toklu et al., 2006), studies also describe the

anti-inflammatory and antioxidative effects of b-glucans

(Kiho, Sakai, Ukai, Hara, & Tanaka, 1988). Our work which

was based on the treatment of diabetic rats with BGEE pro-

vides evidence for the antioxidative and anti-inflammatory

potential of certain b-glucans.

The mechanistic link between hyperglycaemia, oxidative

stress and inflammation in diabetes includes the accumula-

tion of advanced glycation end products (AGE) in tissues. Aside

from their direct toxicity, AGE exert detrimental effects by

interacting with their receptor (RAGE), resulting in the activa-

tion of NF-jB which regulates the expression of genes involved

in inflammation, including RAGE itself (Aragno et al., 2008),

thus producing a self-perpetuating proinflammatory pathway

and amplification of tissue injury. RAGE-dependent and per-

petuated NF-jB activation has been demonstrated in vitro in

experimental diabetes and in patients with type 1 diabetes

(Bierhaus, Humpert, Stern, Arnold, & Nawroth, 2005). Our re-

sults show that BGEE accomplished its antioxidative and

anti-inflammatory effects by blunting the RAGE/NF-jB signal-

ing pathway. The improved hyperglycaemia in BGEE-treated

STZ-induced diabetic rats significantly contributed towards

decreased AGE levels. Previously, we revealed the capability

of BGEE to decrease the formation of AGE in an in vitro glyca-

tion process that pointed to its direct glycation-suppressive

potential in vivo (Mihailovic et al., 2013b). The anti-inflamma-

tory as well as antioxidative functions of BGEE could have also

been accomplished in part by its antagonistic targeting of the

RAGE/NF-jB axis. It is well known that some ligands activate

RAGE strongly while structurally similar ones do not activate

J O U R N A L O F F U N C T I O N A L F O O D S 5 ( 2 0 1 3 ) 1 9 6 6 – 1 9 7 4 1973

it at all (Sparvero et al., 2009). The latter ligands can antago-

nize the activation of RAGE and prevent further transmission

of proinflammatory stimuli. The authors pointed to an impor-

tant antagonism of a group of RAGE-binding ligands that

counteract (or modulate) the deleterious effects of the AGE-

RAGE interaction. It is possible that the b-glucan polysaccha-

ride contained in BGEE bound to RAGE, competed with AGE

and thereby decreased the deleterious effects of the signaling

cascade induced by the AGE-RAGE interaction in STZ-induced

diabetes. Such an interference would prevent inflammation,

oxidative stress generation and consequent hepatic injury.

Our findings further support a beneficial effect of b-glucans

on the liver, previously proposed to be achievable by targeting

the RAGE axis (Basta et al., 2011). While, it can be argued that

BGEE directly influenced the RAGE axis, we cannot rule out the

possibilities that BGEE directly scavenged free radicals in vivo,

as supported by our finding of its prominent free radical scav-

enging activity in vitro (Mihailovic et al., 2013a), and/or that

BGEE directly interfered with AGE formation. The precise

mechanism through which BGEE influences the RAGE/NF-jB

axis in experimentally-induced diabetes remains to be an-

swered in our further studies.

5. Conclusion

Our study reveals an important ameliorative effect of BGEE

administration on hyperglycaemia, and a potent antioxidant

effect in the liver of STZ-induced diabetic rats. The observed

suppressive effect of BGEE administration on the hepatic

inflammatory response can be attributed to upregulation of

anti-inflammatory cytokines and on inhibition of STAT3 and

RAGE/NF-jB signaling. The presented results shed light on

the usefulness of BGEE in the management of diabetic com-

plications and other oxidative stress- and inflammation-re-

lated pathological states.

Competing interest

The authors declare that they have no competing interests.

Acknowledgements

The authors are grateful to the AGROBIV d.o.o. for providing

the b-glucan-enriched extract used in this study. This work

was supported by the Ministry of Education, Science and Tech-

nological Development of the Republic of Serbia, Grant No.

173020. The authors declare no competing financial interest.

R E F E R E N C E S

Aragno, M., Mastrocola, R., Alloatti, G., Vercellinatto, I., Bardini, P.,Geuna, S., et al. (2008). Oxidative stress triggers cardiacfibrosis in the heart of diabetic rats. Endocrinology, 149, 380–388.

Asadullah, K., Sterry, W., & Volk, H. D. (2003). Interleukin-10therapy – Review of a new approach. Pharmacological Reviews,55, 241–269.

Basta, G., Navarra, T., De Simone, P., Del Turco, S., Gastaldelli, A., &Filipponi, F. (2011). What is the role of the receptor for

advanced glycation end products–ligand axis in liver injury?Liver Transplantation, 17, 633–640.

Bierhaus, A., Humpert, P. M., Stern, D. M., Arnold, B., & Nawroth, P.P. (2005). Advanced glycation end product receptor-mediatedcellular dysfunction. Annals of the New York Academy of Sciences,1043, 676–680.

Cascales, P., Fernandez-Cornejo, V. J., Sanchez del Campo, F., deTorre, M., Sanchez Eixeres, M. R., Soriano, N., Gonzalez, F.,et al. (1999). Value of alpha-glutathione sulfotransferase in theassessment of hepatic injury after experimental long-termpreservation. Transplantation Proceedings, 31, 2435–2436.

Cheeseman, K. H., & Slate, T. F. (1993). An introduction to freeradical biochemistry. British Medical Bulletin, 49, 481–493.

Chen, J., & Seviour, R. (2007). Medicinal importance of fungal b-(1–3), (1–6)-glucans. Mycological Research, 111, 635–652.

Dincer, Y., Alademir, Z., _Ilkova, H., & Akcay, T. (2002).Susceptibility of glutatione and glutathione-relatedantioxidant activity to hydrogen peroxide in patients withtype 2 diabetes: Effect of glycemic control. Clinical Biochemistry,35, 297–301.

Esposito, K., Nappo, F., Marfella, R., Giugliano, G., Giugliano, F.,Ciotola, M., Quagliaro, L., et al. (2002). Inflammatory cytokineconcentrations are acutely increased by hyperglycemia inhumans. Circulation, 106, 2067–2072.

Evans, J. L., Goldfine, I. D., Maddux, B. A., & Grodsky, G. M. (2002).Oxidative stress and stress-activated signaling pathways: Aunifying hypothesis of type 2 diabetes. Endocrine Reviews, 23,599–622.

Gambal, D. (1971). Simple, rapid procedure for isolating serumalbumin. Biochimica et Biophysica Acta, 251, 54–56.

Gao, B. (2005). Cytokines, STATs and liver disease. Cellular &Molecular Immunology, 2, 92–100.

Gerhardinger, C., Costa, M. B., Coulombe, M. C., Toth, I., Hoehn, T.,& Grosu, P. (2005). Expression of acute-phase responseproteins in retinal Muller cells in diabetes. InvestigativeOphthalmology & Visual Science, 46, 349–357.

Giacco, F., & Brownlee, M. (2010). Oxidative stress and diabeticcomplications. Circulation Research, 107, 1058–1070.

Habig, W. H., Pubst, M. J., & Jakoby, W. B. (1974). Glutathione S-transferase. Journal of Biological Chemistry, 249, 7130–7139.

Hozova, B., Kuniak, L., Moravcıkova, P., & Gajdosova, A. (2007).Determination of water-insoluble b-D-glucan in the whole-grain cereals and pseudocereals. Czech Journal of Food Sciences,25, 316–324.

Kahn, S. E. (2003). The relative contributions of insulin resistanceand b-cell dysfunction to the pathophysiology of type 2diabetes. Diabetologia, 46, 3–19.

Karacsonyi, S., & Kuniak, L. (1994). Polysaccharides of pleurotusostreatus: Isolation and structure of pleuran, an alkali-insoluble b-D-glucan. Carbohydrate Polymers, 24, 307–312.

Kiho, T., Sakai, M., Ukai, S., Hara, C., & Tanaka, Y. (1988). Anti-inflammatory effect of the polysaccharide from the fruitbodies of Auricularia species. Carbohydrate Research, 142,344–351.

Lin, Y., Rajala, M. W., Berger, J. P., Moller, D. E., Barzilai, N., &Scherer, P. E. (2001). Hyperglycemia-induced production ofacute phase reactants in adipose tissue. Journal of BiologicalChemistry, 276, 42077–42083.

Lo, H. C., Tsai, F. A., Wasser, S. P., Yang, J. G., & Huang, B. M. (2006).Effects of ingested fruiting bodies, submerged culturebiomass, and acidic polysaccharide glucuronoxylomannan ofTremella mesenterica Retz.: Fr. on glycemic responses in normaland diabetic rats. Life Sciences, 78, 1957–1966.

Lowry, O. H., Rosebrough, N. L., Farr, A. L., & Randall, R. I. (1951).Protein measurement with folin phenol reagent. Journal ofBiological Chemistry, 193, 265–275.

Ludwig, D. s. (2003). Glycemic index and the regulation of bodyweight. Lipids, 38, 117–121.

1974 J O U R N A L O F F U N C T I O N A L F O O D S 5 ( 2 0 1 3 ) 1 9 6 6 – 1 9 7 4

Mihailovic, M., Arambasic, J., Uskokovic, A., Dinic, S., Grdovic, N.,Markovic, J., et al. (2013a). b-Glucan administration to diabeticrats reestablishes redox balance and stimulates cellular pro-survival mechanisms. Journal of Functional Foods, 5, 267–278.

Mihailovic, M., Arambasic, J., Uskokovic, A., Dinic, S., Grdovic, N.,Markovic, J., et al. (2013b). b-Glucan administration to diabeticrats alleviates oxidative stress by lowering hyperglycaemia,decreasing non-enzymatic glycation and protein O-GlcNAcylation. Journal of Functional Foods, 5, 1226–1234.

Muruganandam, A., Drouillard, C., Thibert, R. J., Cheung, R. M.,Draisey, T. F., & Mutus, B. (1992). Glutathione metabolicenzyme activities in diabetic platelets as a function ofglycemic control. Thrombosis Research, 67, 385–397.

Ohkawa, H., Ohishi, N., & Yagi, K. (1979). Assay for lipid peroxidesin animal tissues by thiobarbituric acid reaction. AnalyticalBiochemistry, 95, 351–358.

Palsamy, P., Sivakumar, S., & Subramanian, S. (2010). Resveratrolattenuates hyperglycemia-mediated oxidative stress,proinflammatory cytokines and protects hepatocytesultrastructure in streptozotocin–nicotinamide-inducedexperimental diabetic rats. Chemico-Biological Interactions, 186,200–210.

Parker, K. M., England, J. D., DaCosta, J., Hess, E. L., & Goldstein, D.E. (1981). Improved colorimetric assay for glycosylatedhemoglobin. Clinical Chemistry, 27, 669–672.

Peng, C.-H., Chang, H.-C., Yang, M.-Y., Huang, C.-N., Wang, S.-J., &Wang, C.-J. (2012). Oat attenuate non-alcoholic fatty liver andobesity via inhibiting lipogenesis in high fat-fed rat. Journal ofFunctional Foods, 5, 53–61.

Pickup, J. C., Chusney, G. D., Thomas, S. M., & Burt, D. (2000).Plasma interleukin-6, tumour necrosis factor a and blood

cytokine production in type 2 diabetes. Life Sciences, 67,291–300.

Rutter, G. A. (2000). Diabetes: The importance of the liver. CurrentBiology, 10, 736–738.

Sparvero, L. J., Asafu-Adjei, D., Kang, R., Tang, D., Amin, N., Im, J.,et al. (2009). RAGE (receptor for advanced glycationendproducts), RAGE ligands, and their role in cancer andinflammation. Journal of Translational Medicine, 7, 17.

Toklu, H. Z., S�ener, G., Jahovic, N., Uslu, B., Arbak, S., & Yegen, B. C.(2006). b-Glucan protects against burn-induced oxidativeorgan damage in rats. International Immunopharmacology, 6,156–169.

Tsiapali, E., Whaley, S., Kalbfleisch, J., Ensley, H. E., Browder, W., &Williams, D. L. (2001). Glucans exhibit weak antioxidantactivity, but stimulate macrophage free radical activity. FreeRadical Biology and Medicine, 30, 393–402.

Williams, D. L. (1997). Overview of (1–3)-b-D-glucanimmunobiology. Mediators of Inflammation, 6, 247–250.

Xue, S., Chen, X., Lu, J., & Jin, L. (2009). Protective effect of sulfatedAchyranthes bidentata polysaccharides on streptozotocin-induced oxidative stress in rats. Carbohydrate Polymers, 75,415–419.

Yokoyama, H., Jensen, J. S., Jensen, T., & Deckert, T. (1995). Serumsialic acid concentration is elevated in IDDM especially inearly diabetic nephropathy. Journal of Internal Medicine, 237,519–523.

Zekovic, D. B., Kwiatkowski, S., Vrvic, M., Jakovljevic, D., & Moran,C. A. (2005). Natural modified (1–3)-b-glucans in healthpromotion and disease alleviation. Critical Reviews inBiotechnology, 25, 205–230.