Hepatic overexpression of ATP synthase β subunit activates...

of 57 /57
Hepatic overexpression of ATP synthase β subunit activates PI3K/Akt pathway to ameliorate hyperglycemia of diabetic mice Running title: ATP synthase β subunint and hyperglycemia Chunjiong Wang 1,2# , Zhenzhen Chen 1# , Sha Li 1# , Yuan Zhang 3 , Shi Jia 1 , Jing Li 1 , Yujing Chi 1 , Yifei Miao 1 ,Youfei Guan 1,4 and Jichun Yang 1* 1 Department of Physiology and Pathophysiology, Key Laboratory of Molecular Cardiovascular Science Peking (Beijing) University Health Science Center Beijing 100191, China 2 Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin 300070, China 3 Department of Laboratory Medicine, Peking University Third Hospital, Beijing 100191, China 4 Shenzhen University Diabetes Center, Shenzhen University Health Science Center, Shenzhen 518060, China # These authors contributed equally to this work *Correspondence to: Jichun Yang, Ph.D. Department of Physiology and Pathophysiology, Peking (Beijing) University Health Science Center, 38 Xueyuan Road, Beijing, China 100191 Tel: (+86) 10-82805613 E-mail: [email protected] Page 1 of 57 Diabetes Diabetes Publish Ahead of Print, published online December 2, 2013

Embed Size (px)

Transcript of Hepatic overexpression of ATP synthase β subunit activates...

  • Hepatic overexpression of ATP synthase subunit activates PI3K/Akt

    pathway to ameliorate hyperglycemia of diabetic mice

    Running title: ATP synthase subunint and hyperglycemia

    Chunjiong Wang1,2#, Zhenzhen Chen1#, Sha Li1#, Yuan Zhang3, Shi Jia1, Jing Li1,

    Yujing Chi1, Yifei Miao1,Youfei Guan1,4 and Jichun Yang1*

    1 Department of Physiology and Pathophysiology, Key Laboratory of Molecular Cardiovascular Science

    Peking (Beijing) University Health Science Center Beijing 100191, China

    2 Department of Physiology and Pathophysiology, Tianjin Medical University,

    Tianjin 300070, China 3 Department of Laboratory Medicine,

    Peking University Third Hospital, Beijing 100191, China 4 Shenzhen University Diabetes Center,

    Shenzhen University Health Science Center, Shenzhen 518060, China

    # These authors contributed equally to this work

    *Correspondence to:

    Jichun Yang, Ph.D.

    Department of Physiology and Pathophysiology,

    Peking (Beijing) University Health Science Center,

    38 Xueyuan Road, Beijing, China 100191

    Tel: (+86) 10-82805613

    E-mail: [email protected]

    Page 1 of 57 Diabetes

    Diabetes Publish Ahead of Print, published online December 2, 2013

  • Abstract

    ATP synthase subunit (ATPS) had been previously shown to play an important role

    in controlling ATP synthesis in pancreatic cells. This study aimed to investigate the

    role of ATPS in regulation of hepatic ATP content and glucose metabolism in

    diabetic mice. Both ATPS expression and ATP content were reduced in the livers of

    type 1 and type 2 diabetic mice. Hepatic overexpression of ATPS elevated cellular

    ATP content, and ameliorated hyperglycemia of STZ-induced diabetic mice and db/db

    mice. ATPS overexpression increased phosphorylated Akt (pAkt) levels and reduced

    PEPCK and G6pase expression levels in the livers. Consistently, ATPS

    overexpression repressed hepatic glucose production in db/db mice. In cultured

    hepatocytes, ATPS overexpression increased intracellular and extracellular ATP

    content, elevated cytosolic free calcium level and activated Akt independent of insulin.

    ATPS-induced increase in cytosolic free calcium and pAkt levels was attenuated by

    inhibition of P2 receptors. Notably, inhibition of Calmodulin (CaM) completely

    abolished ATPS-induced Akt activation in liver cells. Inhibition of P2 receptors or

    CaM blocked ATPS-induced nuclear exclusion of forkhead box O1 (FOXO1) in liver

    cells. In conclusion, a decrease in hepatic ATPS expression in the liver, leading to the

    attenuation of ATP-P2 receptor-CaM-Akt pathway, may play an important role in the

    progression of diabetes.

    Keywords: diabetes; ATPS; ATP; PI3K-Akt; P2 receptor

    Page 2 of 57Diabetes

  • Introduction

    In the past decades, diabetes had become one of the major diseases threatening

    our health with an estimated global prevalence of 6.4% in 2010 (1). Liver is the key

    tissue that releases glucose into the circulation in fasting status, and an increase in

    hepatic glucose production due to insulin deficiency or insulin resistance is the central

    event in the development and progression of type 1 or type 2 diabetes (2). Moreover,

    liver is also one of the key tissues for lipid metabolism.

    Adenosine triphosphate (ATP) serves as an energy molecule as well as a signal

    molecule in many cells (3). We had previously shown that leucine upregulates ATPS

    to enhance ATP synthesis and insulin secretion in rat islets, type 2 diabetic human

    islets and rattus INS-1 cells. Overexpression or knockdown of ATPS increases or

    reduces cellular ATP levels in INS-1 cells (4; 5). Overall, these findings suggest that

    ATPS plays a crucial role in controlling ATP synthesis.

    In the livers of STZ-induced type 1 diabetic mice, HFD-induced type 2 diabetic

    mice and a methionine and choline deficient (MCD) diet-induced non-alcoholic

    steatohepatitis (NASH) rats, ATP content was significantly reduced (6-8). Hepatic

    ATP content is also decreased in insulin resistant and type 2 diabetic patients (9;

    10). A decrease in hepatic ATP/AMP ratio stimulates food intake by signals via the

    vagus nerve to the brain, which may lead to obesity and insulin resistance in humans

    (11). In obese healthy subjects, hepatic ATP content was inversely related to body

    mass index (BMI), decreasing steadily with increasing BMI (12). Hepatic

    knockdown of PEPCK, one of the key gluconeogenic enzymes, ameliorated

    Page 3 of 57 Diabetes

  • hyperglycemia and insulin resistance with increased hepatic ATP content in db/db

    mice (13). Overall, all these studies revealed that a decrease in ATP content is

    associated with an increase in glucose production in the livers of diabetic animals and

    humans. Given the crucial role of ATPS in controlling mitochondrial ATP synthesis

    (4; 5), we hypothesized that its expression in the livers may be deregulated and

    associated with increased hepatic glucose production under diabetic conditions.

    In this study, we reported that ATPS expression is reduced and correlated with

    ATP content in the livers of type 1 and type 2 diabetic mice. Hepatic overexpression

    of ATPS increased cellular ATP content, and suppressed gluconeogenesis, leading to

    the amelioration hyperglycemia of type1 and type2 diabetic mice.

    Experimental procedures

    Construction of Adenovirus expressing rattus ATPS - Adenovirus expressing

    rattus ATPS was constructed using the ATPS cDNA coding sequence cloned from

    INS-1 cells in our previous study (4) with a 6xHis tag inserted in the N-terminus.

    Overexpression of ATPS in the livers of diabetic mice - To assess the impact of

    high-fat diet on hepatic ATPS expression, 8-week old C57BL/6 mice were fed on

    45% high-fat diet (HFD) or a control diet (Diet #MD45%fat & #MD10%fat,

    Medicience Ltd, China) for 12 weeks (14). The mRNA and protein expression of

    ATPS or other genes in the livers was analyzed by real time PCR and western

    blotting assays. For overexpression of ATPS in the liver, 8-12 week female db/db

    Page 4 of 57Diabetes

  • mouse on BKS background were chosen for experiment. 1.0x109 pfu Ad-ATPS or

    Ad-GFP were injected into the db/db mice via tail vein as previously described

    (16)(15). At the 3rd and 7th day post virus injection, oral glucose tolerance tests were

    performed. On the 8th day, the fed animals were sacrificed for experimental analysis.

    8 week old male C57BL/6 mice were injected intraperitoneally for 7 consecutive days

    with STZ (50mg/kg, sigma) freshly dissolved in citrate buffer (pH=4.2). Control mice

    were injected with citrate buffer. Mice with the fasting blood glucose (FBG) level

    greater than 16.4mmol/L at 30 days post final STZ injection were chosen for

    experiments. The mice were treated with Ad-ATPS or Ad-GFP as db/db mice.

    Fasting blood glucose was monitored at 3 days post viral injection. On the 4th day, the

    fed animals were sacrificed for experimental analysis. Serum was collected for insulin,

    TG and total CHO levels determination, and liver was taken for biochemical analysis.

    All procedures were approved by the Institutional Animal Care and Use Committee of

    Peking University Health Science Center.

    Oral Glucose Tolerance Tests - Mice were fasted for 6 hours (8 am to 2 pm) in a

    cage with fresh bedding prior to oral glucose tolerance test (OGTT). Mice were orally

    administered with glucose at the dose of 3g/kg and blood glucose levels were

    monitored at 0, 15, 30, 60, 90 and 120 minutes post glucose load using a Freestyle

    brand glucometer (Roche) via blood collected from the tail (15). The blood glucose

    concentrations at 0 minute were determined as fasting blood glucose. At the same

    time, blood samples were taken at time points (0, 15, 30 and 60 min) from the tail

    Page 5 of 57 Diabetes

  • vein for detecting insulin levels. Plasma insulin levels were measured using the

    Rat/Mouse Insulin ELASA kit (MILIPORE) (16).

    Pyruvate tolerance tests - The protocol for pyruvate tolerance tests (PTT) was

    detailed elsewhere (17). In brief, db/db mice infected with Ad-ATPS or Ad-GFP for

    7 days were fasted for 16 hours and were injected intraperitoneally with pyruvate

    (0.75mg/Kg body weight in saline). Blood glucose levels were measured from the tail

    vein at indicated times using a Freestyle brand glucometer.

    Insulin tolerance tests - Insulin tolerance tests (ITT) were done with an

    intraperitoneal injection of insulin (3 U/kg body weight into mice after 6 hours of

    fasting (18). Plasma glucose was measured using blood drawn from the tail vein at

    designated time points (0, 15, 30, 60, 90, 120 minutes post insulin injection) (19).

    Immunoprecipitation and immunoblot assays - The immunoprecipitation was

    performed using Protein G Argrose bead as described previously (20). 200g of liver

    protein was precipitated with anti-ubiquitin or IgG, and separated by 10-12% SDS gel.

    Immunoblot was performed, and the membrane was developed with ECL.

    Cell culture - Human hepatocellular carcinoma (HepG2) cells was purchased from

    American Type Culture Collection (Rockville, MD), and cultured at 37C in 5%

    CO295% air in DMEM medium. The cells were infected with 20 MOI of Ad-GFP or

    Page 6 of 57Diabetes

  • Ad-ATPS for 48 hours. For insulin stimulation, the cells were serum-starved for 12

    hours followed by treatment with 100 nM insulin (NOVO) for 5 minutes and then

    lysed in fresh Roth Lysis buffer. For inhibition of PI3K, the infected cells were treated

    with indicated concentrations of wortmannin (inhibitor of PI3K), PIK75 (inhibitor of

    p110) or TGX221 (inhibitor of p110) for 30 minutes before being lysed. The

    infected cells were treated with indicated concentrations of PPADS (antagonist of P2

    receptor), U73122 (inhibitor of IP3R) and CPZ (inhibitor of CaM) for 30 minutes to 1

    hour before experimental assay. The lysate was centrifuged at 13,000 rpm at 4C for

    10 minutes. 20-100 g total proteins were subjected to western blotting assay

    immediately.

    Primary hepatocyte culture - Primary mouse hepatocyte was cultured as previously

    described (4). In brief, 5-6-week-old male C57BL/6 mice were anaesthetized with

    10% chloral hydrate, and then a catheter was placed in inferior vena cava. The liver

    was perfused with 1 ml of heparin (320 /ml), 40 ml of solution I (Krebss solution +

    0.1 mM EGTA), and 30 ml of solution II (Krebss solution + 2.74 mM CaCl2 + 0.05%

    Collagenase I), respectively. The perfused liver was passed though a 400 screening

    size filter by flushing with RPMI 1640 medium. The hepatocytes were collected by

    centrifuge at 50 g for 2 minutes. Hepatocytes were re-suspended with 1640 medium

    and planted in 6-well plates for experiments after three washes with RPMI 1640.

    Immunoblotting - Cells or liver tissues were lysed in fresh Roth lysis buffer (50 mM

    Page 7 of 57 Diabetes

  • HEPES, 150 mM NaCl, 1% Triton X-100, 5 mM EDTA, 5 mM EGTA, 20 mM Na

    pyrophosphate, 20 mM NaF, 0.2 mg/mL PMSF, 0.01mg/mL leupeptin, and 0.01

    mg/mL aprotinin, pH 7.4). The lysate was centrifuged at 4 C at 13 000 rpm for 10

    min. The protein concentration in the supernatant was determined by bicinchoninic

    acid assay. Twenty-200 g of total protein were separated by 12-15% SDS-PAGE.

    Proteins in the gel were transferred to the Hybond-C Extra membrane (Amersham

    Biosciences) at 120V for 2 h at 4C. The membrane was washed once with TBST (1.2

    g/L Tris Base, 5.84 g/L NaCl, 0.1% Tween-20, pH 7.5) before blocking in TBST

    containing 1% BSA at room temperature for 1 h. The membrane was incubated in

    1:200 ~ 1:1000 primary antibodies at 4C overnight. The membrane was washed five

    times with TBST, and incubated in 1:5000 peroxidase-conjugated secondary

    antibodies at room temperature for 1 h before washing as above, and then developed

    with ECL. After immunoblotting assays of target proteins, the membrane was stripped

    with 0.2 N NaOH and reprobed for EIF5 or other house-keeping protein as loading

    control. Anti-ATPS, pAkt, Akt, FOXO1, Fas, mSREBP1 and SREBP1 antibodies

    were from Abcam. Anti-ATPS, 6His-tag, G6Pase, Ubiquitin, EIF5 and -actin

    antibodies were from Santa. Ant- ATPS and ATPSd antibodies were form Bioworld.

    Anti-CoxIV antibodies were from Invitrogen. Peroxidase-conjugated secondary

    antibodies were from Santa. Activation of Akt was evaluated by analyzing

    phosphorylation at Ser473 site.

    Real-time quantitative PCR assay - Total RNA of tissues and cells were extracted

    Page 8 of 57Diabetes

  • with RNApure High-purity Total RNA Rapid Extraction Kit (BioTeke Corporation).

    Quantification of target gene expression was performed via quantitative real-time

    PCR. The complementary DNA was synthesized with the use of RevertAidTM First

    Strand cDNA Synthesis Kit (Fermentas K1622). Target gene mRNA level was

    normalized to that of -actin in the same sample as detailed previously (21). Each

    sample was measured in duplicate or triplicate in each experiment. Moreover, melting

    curve for each PCR product was analyzed to ensure the specificity of the

    amplification product. All the primer sequences for real time PCR assays were listed

    in supplementary table 1.

    ATP content determination - ATP content was assessed by bioluminescence method

    using ATP-Lite Assay Kit (Vigorous Biotechnology Beijing Co., Ltd). For hepatic

    ATP content determination, 1ml lysis buffer was added into per 100mg frozen tissue.

    For cellular ATP content determination, 300 ul lysis buffer was added into the 35mm

    dish. For extracellular ATP content determination, HepG2 cell culture medium was

    collected. The lysate ATP content or the ATP content in medium was measured by

    luminometric determination of the luciferin-luciferase reaction. For determination of

    relative ATP level in the cells, the ATP content values (nmol) were first normalized to

    the protein mount (nmol/mg protein) in the same sample, and then normalized to the

    control values. For determination of relative ATP level in the medium, the absolute

    concentration was determined and normalized to the control value.

    Cellular calcium measurement - HepG2 cells seeded on coverslips were loaded with

    Page 9 of 57 Diabetes

  • 1M Fura-2 AM (Molecular Probes) for 10min, and then imaged under Olympus ix71

    fluorescence microscope. The emission intensities under 340nm and 380nm

    illumination were recorded every 1 second, and the ratio of the emission densities

    (F340/F380) reflects the intracellular free calcium concentration (5). For basal

    calcium concentration measurement, infected HepG2 cells were treated with indicated

    concentrations of PPADS and Suramin for 1 hour.

    Mitochondria isolation - Mitochondria were isolated from liver tissue or HepG2

    cells using the Mitochondria/Cytosol Fractionation Kit (Pierce) according to

    the manufacture's protocol. In brief, liver tissue or HepG2 cells were homogenized in

    Mito-Cyto extraction buffer provided by the Kit, and then the lysate was centrifuged

    at 800g for 5 min twice to pellet the nucleus and cell debris. The supernatant was

    collected and centrifuged at 10,000g for 10 min to pellet mitochondria, which was

    washed three times with lysis buffer to clean contaminated cytoplasmic proteins (22).

    Immunofluorescence - To detect the translocation of FOXO1, HepG2 cells were

    infected with Ad-GFP or Ad-ATPS for 48 hours and treated with of PPADS (50M)

    and CPZ (100M) for 1 hour before been fixed with 4% paraformaldehyde for 15

    minutes and permeabilized with 0.5% Triton X-100 for 10 minutes. Nonspecific

    binding was blocked in 1% BSA at room temperature for 10 minutes, followed by

    incubation with anti-FOXO1 antibody overnight at 4C. The slides were then

    incubated with Alexa fluo 594 antibodies (1:200). Images were obtained

    Page 10 of 57Diabetes

  • using Confocal microscopy.

    Statistical analysis - Data are presented as mean S.E.M. Statistical significance of

    differences between groups was analyzed by unpaired Students t test or by one-way

    analysis of variance (ANOVA) when more than two groups were compared.

    Results

    ATPS expression was reduced in the livers of db/db and HFD-fed diabetic mice.

    To determine the potential role of ATPS in the progression of hepatic insulin

    resistance and type 2 diabetes, its expression in the livers of db/db and HFD-fed

    diabetic mice was analyzed. The mRNA (Figure 1A) and protein (Figure 1B) levels of

    ATPS were significantly reduced in the livers of db/db mice. In contrast, the mRNA

    levels of , , and subunits of F1 domain, and b, c and d subunits of F0 domain

    were not significantly different between db/db and db/m mouse livers (Suppl Figure

    1A). The protein levels of and subunits of F1 domain, and d subunits of F0

    domain were confirmed to remain unchanged between db/db and db/m mouse livers

    (Suppl Figure 1B). Hepatic ATP content was also reduced in db/db mice when

    compared with db/m mice (Figure 1C). The mRNA and protein levels of ATPS, and

    ATP content were also reduced in the livers of HFD-fed diabetic mice (Figure D-F).

    Similarly, the mRNA levels of , , , , b, c and d subunits of ATP synthase were not

    significantly different between HFD and NC mouse livers (Suppl Figure 1C). The

    Page 11 of 57 Diabetes

  • protein levels of , and d subunits were also confirmed to remain unchanged in

    HFD-fed diabetic mouse livers (Suppl Figure 1D).

    Hepatic overexpression of ATPS ameliorated hyperglycemia in db/db mice. The

    efficacy of Ad-ATPS treatment on cellular ATPS protein level was firstly

    determined in HepG2 cells (Suppl Figure 2). Then, ATPS was overexpressed in the

    livers of db/db mice via tail vein injection of Ad-ATPS to evaluate its impact on ATP

    content and glucose metabolism. At 3 days post virus injection, Ad-ATPS-treated

    mice exhibited significant improvement of fasting hyperglycemia and glucose

    intolerance when compared with Ad-GFP-treated mice (Figure 2A-B). At 7 days post

    virus injection, the fasting hyperglycemia and glucose intolerance was markedly

    attenuated in Ad-ATPS-treated mice when compared with Ad-GFP-treated mice

    (Figure 2C). The fasting blood glucose of mice at 0, 3 and 7 days post viral injection

    was shown in Figure 2D. At the 8th day post virus injection, the serum insulin levels in

    Ad-ATPS-treated mice were significantly lower than that in control mice (Figure 2E).

    ATPS overexpression also reduced hepatic lipid deposition in db/db mice (Suppl

    Figure 3).

    ATPS overexpression activated Akt and repressed gluconeogenic genes in the

    livers of db/db mice. Ad-ATPS treatment increased ATPS protein level in the livers

    of db/db mice (Figure 3A). Moreover, overexpressed ATPS was shown to be

    predominantly located in mitochondria (Figure 3B). In contrast, injection of

    Page 12 of 57Diabetes

  • Ad-ATPS had little effect on the mRNA and protein levels of ATPS in skeletal

    muscle and pancreas, indicating the specificity of ATPS overexpression in the liver

    (Suppl Figure 4). ATPS overexpression elevated cellular ATP content, increased

    phosphorylated Akt (pAkt) levels and reduced the protein level of gluconeogenic gene

    G6Pase in the livers of db/db mice (Figure 3C-E). The mRNA levels of PEPCK and

    G6Pase in the livers were significantly repressed after ATPS overexpression (Figure

    3F). In vivo, OGTT, insulin secretion, insulin tolerance test (ITT) and pyruvate

    tolerance test (PTT) assays indicated there is no significant difference between saline-

    and Ad-GFP-treated mice (Suppl Figures 5 and 6). Moreover, ATPS overexpression

    failed to affect insulin secretion in db/db mice (Suppl Figure 5D-E). In vitro, Ad-GFP

    infection also failed to significantly affect Akt activation in HepG2 cells (Suppl

    Figure 5F). These findings suggested that the virus itsself at the dose used in the

    current study has little effect on glucose metabolism and Akt activation in mouse liver

    cells. ITT assays indicated that the global insulin sensitivity was improved by hepatic

    overexpression of ATPS (Suppl Figure 6A-B). PTT assays revealed that hepatic

    glucose production was repressed after ATPS overexpression (Suppl Figure 6C-D).

    Overall, these findings were consistent with the decrease in gluconeogenic genes and

    the attenuation of hyperglycemia in db/db mice after hepatic ATPS overexpression.

    ATPS activated PI3K-Akt signaling pathway through P2 receptor. Because Akt

    plays a crucial role in controlling glucose metabolism, the effect of ATPS on Akt

    activation was further analyzed in HepG2 cells and primary cultured mouse

    Page 13 of 57 Diabetes

  • hepatocytes. In HepG2 cells, immunofluoresence staining and immunoblotting assays

    indicated that Ad-ATPS treatment increased ATPS protein level in mitochondria

    (Suppl Figures 7-8). ATPS overexpression significantly elevated intracellular and

    extracellular ATP levels in both HepG2 cells (Figure 4A) and primary cultured mouse

    hepatocytes (Figure 4B). In HepG2 cells infected by Ad-GFP, insulin potently

    stimulated Akt activation (Figure 4C). Ad-ATPS treatment markedly elevated pAkt

    levels (Figure 4C) when compared with Ad-GFP treated cells without insulin

    stimulation. ATPS overexpression also augmented insulin-stimulated Akt activation

    in HepG2 cells (Figure 4C). Similarly, ATPS also induced Akt activation in primary

    cultured mouse hepatocytes in the absence of insulin stimulation (Figure 4D).

    ATPS-induced Akt activation was completely blocked by PI3K inhibitor wortmannin

    in HepG2 cells in the absence of insulin stimulation (Figure 4E). Inhibition of PI3K

    p110 catalytic subunit blocked ATPS-induced Akt activation by about 70-80%,

    whereas inhibition of PI3K p110 catalytic subunit had little effect on ATPS-induced

    Akt activation in the absence of insulin (Figure 4E). Overall, these results suggested

    that ATPS-induced Akt activation requires the activity of PI3K p110 catalytic

    subunit but is independent of insulin.

    ATP can be released to function as a signal molecule in various cell types (23; 24).

    In HepG2 cells, ATPS-induced Akt activation was significantly attenuated by ATP

    receptor P2 receptor antagonist PPADS (Figure 5A). Pretreatment with another P2

    receptor antagonist suramin also attenuated ATPS-induced Akt activation (Suppl

    Figure 9A). Furthermore, inhibition of P2 receptor downstream molecule PLC using

    Page 14 of 57Diabetes

  • U73122 also attenuated ATPS-induced Akt activation (Figure 5B). ATPS

    overexpression elevated cytosolic free calcium level, which was inhibited by PPADS

    and suramin in HepG2 cells (Figure 5C). Because an increase in cytosolic free

    calcium level has been shown to activate PI3K/Akt signaling axis through CaM in

    several cell types (25; 26), we further analyzed whether ATPS induced Akt activation

    via calcium-CaM signaling pathway. The results indicated that depletion of

    extracellular calcium partially attenuated (Suppl Figure 9B), whereas inhibition of

    CaM using CPZ completely abolished ATPS-induced Akt activation in HepG2 cells

    (Figure 5D).

    Inhibition of P2 receptor or CaM blocked ATPS-induced translocation of

    FOXO1. Activation of Akt plays a crucial role in suppressing gluconeogenesis by

    phosphorylating and inactivating FOXO1, the key transcriptor controlling the

    transcription of gluconeogenic genes PEPCK and G6Pase (27). As expected, ATPS

    overexpression significantly promoted nuclear exclusion of FOXO1 with the

    activation of Akt in HepG2 cells (Figure 6). In support, inhibition of P2 receptors or

    CaM blocked ATPS-promoted nuclear exclusion of FOXO1 with the attenuation of

    Akt activation (Figure 6).

    Hepatic overexpression of ATPS ameliorated hyperglycemia of streptozocin

    (STZ)-induced type 1 diabetes mice. In the livers of STZ-induced type 1 diabetic

    mice, the mRNA and protein levels of ATPS expression was also significantly

    Page 15 of 57 Diabetes

  • reduced with a decrease in ATP content (Figure 7A-C). Hepatic overexpression of

    ATPS for 3 days elevated cellular ATP content and ameliorated fasting

    hyperglycemia in STZ-induced type 1 diabetic mice (Figure 7C-E). ATPS

    overexpression increased pAkt levels and reduced mRNA and protein levels of

    PEKCK and G6Pase in the livers of STZ-treated mice, suggesting that hepatic

    gluconeogenesis was inhibited (Figure 7F-H).

    Page 16 of 57Diabetes

  • Discussion

    In the livers of type 1 and type 2 diabetic mice, ATPS expression was reduced

    and positively correlated with ATP content. Hepatic overexpression of ATPS

    elevated cellular ATP content, suppressed hepatic glucose production, and improved

    hyperglycemia, hyperinsulinemia, insulin resistance and fatty liver in db/db mice.

    Hepatic overexpression of ATPS also elevated cellular ATP and ameliorated

    hyperglycemia in STZ-induced diabetic mice. ATPS overexpression increased pAkt

    levels and repressed the expression of gluconeogenic genes in the livers of these

    diabetic mice. These findings suggested that inhibition of hepatic glucose production

    will attenuate hyperglycemia and global insulin resistance in type 2 diabetic mice.

    Similarly, it had been previously reported that silencing of hepatic PEPCK suppressed

    hepatic glucose production and improved global insulin resistance in db/db mice (13).

    In vitro, ATPS overexpression increased intracellular and extracellular ATP levels in

    HepG2 cells and primary cultured mouse hepatocytes. In support of our previous (4; 5)

    and current findings that ATPS plays a crucial role in controlling ATP synthesis,

    hydrogen peroxide induces ATPS expression and increases cellular ATP level in

    melanocytes (28). Proteomic analysis revealed that ATPS expression was reduced

    with a decrease in ATP content in mouse livers after ischemia-reperfusion treatment

    (29). No change of other subunits of ATP synthase was found in ischemia-reperfusion

    injured mouse livers in the same study (29).

    Extracellular ATP can activate PI3K-Akt pathway through P2 receptors in several

    cell types. Ishikawa et al found that Pannexin 3 releases ATP into extracellular space,

    Page 17 of 57 Diabetes

  • which activates PI3K/Akt pathway via P2 receptors to promote the proliferation of

    osteoblasts (30). Electrical pulses can stimulate skeletal muscle cells to release ATP,

    which enhances glucose uptake via activation of PI3K-Akt pathway through P2

    receptors (31). Extracellular ATP also activates PI3K-Akt pathway to attenuate

    ischemia-induced apoptosis of human endothelial cells (32). P2 receptors were

    divided into P2X receptors and P2Y receptors. P2X receptors are ligand-gated ion

    channels which are permeable for calcium (33), while P2Y receptors are G

    protein-coupled receptors which stimulate PLC to increase IP3, resulting in calcium

    release from internal storage (23). Liver cells and HepG2 cells have been shown to

    release ATP. P2 receptors are also constitutively expressed in liver cells and HepG2

    cells (24; 34). Exposure to exogenous ATP has been reported to elevate cytosolic free

    calcium level in HepG2 cells and primary cultured mouse hepatocytes (35). PPADS is

    a specific inhibitor for P2X subtype, whereas suramin is considered to be a

    broad-spectrum P2 receptor inhibitor (36). Both PPADS and suramin significantly

    attenuated ATPS-induced increase in cytosolic free calcium level and Akt activation

    in HepG2 cells. Depletion of extracellular calcium also attenuated ATPS-induced

    Akt activation. Furthermore, U73122, an inhibitor of P2Y receptor downstream

    molecule PLC also attenuated ATPS-induced Akt activation in HepG2 cells. These

    results revealed the involvement of both P2X and P2Y receptors in ATPS-induced

    increase in cytosolic free calcium level and Akt activation in liver cells.

    Cytosolic free calcium level is crucial second messenger in ATP/P2 receptor

    signaling pathway. Increased cytosolic free calcium level activates CaM, which can

    Page 18 of 57Diabetes

  • activate PI3K via direct association with its p85 regulatory subunit, leading to

    activation of Akt (37). Importantly, inhibition of CaM using CPZ completely

    abolished ATPS-induced Akt activation in HepG2 cells. ATPSinduced Akt

    activation requires the activity of PI3K p110 catalytic subunit but is independent of

    insulin signaling. These findings were consistent with recent discoveries that p110

    predominantly mediated Akt activation in liver cells. Deletion of p110 blunted Akt

    activation in response to insulin, whereas deletion of p110 had little effect on

    insulin-stimulated Akt activation in the liver (38). Furthermore, ATPS

    overexpression reduced hepatic and serum TG content with little effect on liver and

    serum CHO levels in db/db mice. The protein levels of key lipogenic genes FAS and

    mature SREBP-1 were reduced in the livers of db/db mice after ATPS

    overexpression (Suppl Figure 3D). FOXO1 is a crucial transcriptor controlling the

    transcription of glucogeogenic enzymes PEPCK and G6Pase (27). Insulin-stimulated

    activation of Akt can phosphorylate FOXO1 and promote its translocation from

    nucleus to cytoplasma, suppressing the transcription of gluconeogenic genes and

    hepatic gluconeogenesis (27). ATPS overexpression promotes nuclear exclusion of

    FOXO1, which can be inhibited by antagonisms of P2 receptor or CaM. Overall, these

    findings revealed that ATPS overexpression elevated ATP synthesis and secretion in

    liver cells. Released ATP activates both P2X and P2Y receptors to increase cytosolic

    free calcium level, which activates CaM-PI3K-Akt signaling axis to suppress

    gluconeogenesis independent of insulin. However, it should be noted that elevated

    intracellular ATP levels will inhibit the activity of ATP sensitive K+ (K(ATP)) channel

    Page 19 of 57 Diabetes

  • and increase the influx of extracellular calcium through L-type voltage-gated calcium

    channel (39; 40), which may also contribute to ATPS-induced increase in free

    cytosolic calcium and Akt activation. Interestingly, although we found that ATPS

    overexpression for 7 days significantly reduced the mRNA level PEPCK in db/db

    mouse livers, its protein level remained unchanged (Figure 3D-F, Suppl Figure

    10A-C). The decrease in PEPCK mRNA level was confirmed by two different set of

    primers according to the mRNA sequence of PEPCK (Suppl Figure 10C). At 3 days

    post ATPS overexpression, both the mRNA and protein levels of PEPCK were

    significantly reduced in the livers of db/db mice (data not shown) and STZ-induced

    diabetic mice (Figure 7). Co-immunoprecipitation assay revealed that the

    ubiquitination of PEPCK protein was reduced at 7 days after ATPS overexpression,

    suggesting that the ubiquitin-mediated degradation of PEPCK protein might decrease

    (Suppl Figure 10D). A decrease in PEPCK protein degradation might be a protective

    mechanism against persistent suppression of hepatic glucose production induced by

    long-term of ATPS overexpression.

    It had been intensively studied that excessive accumulation of free fatty acids

    (FFAs), in particular saturated FFAs such as palmitate, plays an important role in the

    progression of insulin resistance in various tissues (41). Hojlund et al found that

    ATPS protein level is reduced in skeletal muscle of insulin-resistant and type 2

    diabetic patients (42; 43). In vivo, FFAs induced insulin resistance in skeletal muscle

    cells with a decrease in ATP generation (44). Rooibos ameliorates

    palmitate-induced insulin resistance in C2C12 muscle cells with increased cellular

    Page 20 of 57Diabetes

  • ATP levels (45). In support, inhibition of ATP synthase using oligomycin reduces

    cellular ATP levels and induces insulin resistance in cultured human myotubes (46). In

    the current study, we found that palmitate downregulated ATPS and induced insulin

    resistance in HepG2 cells, which was reversed by overexpression of ATPS (Suppl

    Figure 11). Palmitate has been shown to induce insulin resistance by stimulating

    reactive oxygen species (ROS) production in hepatocytes (47). We further found that

    ATPS overexpression reduced palmitate-induced ROS production in HepG2 cells

    (Suppl Figure 12). ATPS also tended to reduce ROS production in basal condition in

    HepG2 cells (Suppl Figure 12). In lipid stressed condition, an increase in electron

    transfer on respiratory chain as well as a decrease in ATPS expression may

    contribute to ROS overproduction and oxidative stress, which is one of the main

    causes of hepatic insulin resistance (47; 48). These findings suggest that repression of

    ATPS expression, leading to a decrease in ATP synthesis and a possible increase in

    ROS production, might be a novel mechanism for lipid-induced insulin resistance in

    liver and muscle cells.

    Activation of adenosine 5'-monophosphate (AMP)-activated protein kinase

    (AMPK) exerts beneficial effects on amelioration of hyperglycemia (49). The activity

    of AMPK is modulated by various factors such as an increase in AMP/ATP ratio,

    adiponectin and metformin (49). Anti-diabetic drug metformin can target

    mitochondrial complex I to inhibit ATP production (50; 51), leading to the activation

    of AMPK (52), which at least partially mediates metformins hypoglycemic effects.

    However, some deleterious effects of AMPK activation including inhibition of insulin

    Page 21 of 57 Diabetes

  • secretion (53), induction of pancreatic cell and renal medullary interstitial cell

    apoptosis (54; 55) had also been reported. Given the role of ATP as the key energy

    storage molecule and an important signaling molecule (30-32), activation of

    ATPS-ATP-P2 receptor signaling may have some unique advantages than activation

    of metformin-AMPK signaling in the treatment of type 2 diabetes.

    In summary, the present study demonstrated that ATPS expression is

    positively correlated with ATP content in the livers of diabetic mice. A decrease in

    ATPS expression in the liver, leading to the reduction of ATP content and attenuation

    P2 receptor-PI3K-Akt signaling pathway, may play an important role in the

    progression of diabetes. Upregulating hepatic ATPS might be an attractive method

    for treatment of both type 1 and type 2 diabetes (Figure 8).

    Acknowledgments

    This study was supported by grants from the Ministry of Science and Technology

    (2012CB517504/2011ZX09102) and the Natural Science Foundation of China

    (81170791/30870905/81200625/81322011). This study was also supported by a grant

    from Beijing Natural Science Foundation (7122107).

    No potential conflicts of interest relevant to this article were reported.

    C.W., Z.C., S.L., S.J., Y.Z. and Y.M. researched data, contributed to discussion.

    C.W. wrote Manuscript. J.L. and Y.C. reviewed/edited manuscript. C.W., Y.G. and J.Y.

    designed the study, and revised/edited manuscript. Dr. Jichun Yang is the guarantor of

    this work and, as such, had full access to all the data in the study and takes

    Page 22 of 57Diabetes

  • responsibility for the integrity of the data and the accuracy of the data analysis

    Page 23 of 57 Diabetes

  • References

    1. Shaw JE, Sicree RA, Zimmet PZ: Global estimates of the prevalence of diabetes for 2010 and 2030.

    Diabetes Res Clin Pract 2010;87:4-14

    2. Biddinger SB, Kahn CR: From mice to men: insights into the insulin resistance syndromes. Annu

    Rev Physiol 2006;68:123-158

    3. Corriden R, Insel PA: Basal release of ATP: an autocrine-paracrine mechanism for cell regulation.

    Sci Signal 2010;3:re1

    4. Yang J, Wong RK, Wang X, Moibi J, Hessner MJ, Greene S, Wu J, Sukumvanich S, Wolf BA, Gao Z:

    Leucine culture reveals that ATP synthase functions as a fuel sensor in pancreatic beta-cells. J Biol

    Chem 2004;279:53915-53923

    5. Yang J, Wong RK, Park M, Wu J, Cook JR, York DA, Deng S, Markmann J, Naji A, Wolf BA, Gao Z:

    Leucine regulation of glucokinase and ATP synthase sensitizes glucose-induced insulin secretion in

    pancreatic beta-cells. Diabetes 2006;55:193-201

    6. Miyamoto A, Takeshita M, Pan-Hou H, Fujimori H: Hepatic changes in adenine nucleotide levels

    and adenosine 3'-monophosphate forming enzyme in streptozotocin-induced diabetic mice. J Toxicol

    Sci 2008;33:209-217

    7. Berglund ED, Lee-Young RS, Lustig DG, Lynes SE, Donahue EP, Camacho RC, Meredith ME,

    Magnuson MA, Charron MJ, Wasserman DH: Hepatic energy state is regulated by glucagon receptor

    signaling in mice. The Journal of clinical investigation 2009;119:2412-2422

    8. Serviddio G, Bellanti F, Tamborra R, Rollo T, Romano AD, Giudetti AM, Capitanio N, Petrella A,

    Vendemiale G, Altomare E: Alterations of hepatic ATP homeostasis and respiratory chain during

    development of non-alcoholic steatohepatitis in a rodent model. Eur J Clin Invest 2008;38:245-252

    9. Szendroedi J, Chmelik M, Schmid AI, Nowotny P, Brehm A, Krssak M, Moser E, Roden M:

    Abnormal hepatic energy homeostasis in type 2 diabetes. Hepatology 2009;50:1079-1086

    10. Schmid AI, Szendroedi J, Chmelik M, Krssak M, Moser E, Roden M: Liver ATP synthesis is lower

    and relates to insulin sensitivity in patients with type 2 diabetes. Diabetes Care 2011;34:448-453

    11. Cooper ME, Regnell SE: The hepatic cannabinoid 1 receptor as a modulator of hepatic energy state

    and food intake. Br J Clin Pharmacol 2013;

    12. Nair S, V PC, Arnold C, Diehl AM: Hepatic ATP reserve and efficiency of replenishing:

    comparison between obese and nonobese normal individuals. Am J Gastroenterol 2003;98:466-470

    13. Gomez-Valades AG, Mendez-Lucas A, Vidal-Alabro A, Blasco FX, Chillon M, Bartrons R,

    Bermudez J, Perales JC: Pck1 gene silencing in the liver improves glycemia control, insulin sensitivity,

    and dyslipidemia in db/db mice. Diabetes 2008;57:2199-2210

    14. Wu J, Wang C, Li S, Li S, Wang W, Li J, Chi Y, Yang H, Kong X, Zhou Y, Dong C, Wang F, Xu A,

    Yang J, Gustafsson JA, Guan Y: Thrsp promotes hepatic lipogenesis, and its expression LXRalpha

    through an SREBP1c-dependent mechanism. Hepatology (Baltimore, Md 2013;

    15. Li J, Chi Y, Wang C, Wu J, Yang H, Zhang D, Zhu Y, Wang N, Yang J, Guan Y: Pancreatic-derived

    factor promotes lipogenesis in the mouse liver: role of the Forkhead box 1 signaling pathway.

    Hepatology (Baltimore, Md 2011;53:1906-1916

    16. Tamura Y, Ogihara T, Uchida T, Ikeda F, Kumashiro N, Nomiyama T, Sato F, Hirose T, Tanaka Y,

    Mochizuki H, Kawamori R, Watada H: Amelioration of glucose tolerance by hepatic inhibition of

    nuclear factor kappaB in db/db mice. Diabetologia 2007;50:131-141

    17. Kim KH, Jeong YT, Oh H, Kim SH, Cho JM, Kim YN, Kim SS, Kim do H, Hur KY, Kim HK, Ko

    Page 24 of 57Diabetes

  • T, Han J, Kim HL, Kim J, Back SH, Komatsu M, Chen H, Chan DC, Konishi M, Itoh N, Choi CS, Lee

    MS: Autophagy deficiency leads to protection from obesity and insulin resistance by inducing Fgf21 as

    a mitokine. Nat Med 2013;19:83-92

    18. Pendse AA, Johnson LA, Tsai YS, Maeda N: Pparg-P465L mutation worsens hyperglycemia in

    Ins2-Akita female mice via adipose-specific insulin resistance and storage dysfunction. Diabetes

    2010;59:2890-2897

    19. Pei L, Waki H, Vaitheesvaran B, Wilpitz DC, Kurland IJ, Tontonoz P: NR4A orphan nuclear

    receptors are transcriptional regulators of hepatic glucose metabolism. Nat Med 2006;12:1048-1055

    20. Yang J, Wang C, Li J, Burkhardt BR, Robert-Cooperman CE, Wilson C, Gao Z, Wolf BA:

    PANDER binds to the liver cell membrane and inhibits insulin signaling in HepG2 cells. FEBS Lett

    2009;583:3009-3015

    21. Yang J, Gao Z, Robert CE, Burkhardt BR, Gaweska H, Wagner A, Wu J, Greene SR, Young RA,

    Wolf BA: Structure-function studies of PANDER, an islet specific cytokine inducing cell death of

    insulin-secreting beta cells. Biochemistry 2005;44:11342-11352

    22. Abdul-Ghani MA, Muller FL, Liu Y, Chavez AO, Balas B, Zuo P, Chang Z, Tripathy D, Jani R,

    Molina-Carrion M, Monroy A, Folli F, Van Remmen H, DeFronzo RA: Deleterious action of FA

    metabolites on ATP synthesis: possible link between lipotoxicity, mitochondrial dysfunction, and

    insulin resistance. Am J Physiol Endocrinol Metab 2008;295:E678-685

    23. Franke H, Illes P: Involvement of P2 receptors in the growth and survival of neurons in the CNS.

    Pharmacol Ther 2006;109:297-324

    24. Gonzales E, Julien B, Serriere-Lanneau V, Nicou A, Doignon I, Lagoudakis L, Garcin I, Azoulay D,

    Duclos-Vallee JC, Castaing D, Samuel D, Hernandez-Garcia A, Awad SS, Combettes L, Thevananther

    S, Tordjmann T: ATP release after partial hepatectomy regulates liver regeneration in the rat. J Hepatol

    2010;52:54-62

    25. Shin SY, Choi BH, Ko J, Kim SH, Kim YS, Lee YH: Clozapine, a neuroleptic agent, inhibits Akt

    by counteracting Ca2+/calmodulin in PTEN-negative U-87MG human glioblastoma cells. Cellular

    signalling 2006;18:1876-1886

    26. Katz S, Ayala V, Santillan G, Boland R: Activation of the PI3K/Akt signaling pathway through

    P2Y(2) receptors by extracellular ATP is involved in osteoblastic cell proliferation. Arch Biochem

    Biophys 2011;513:144-152

    27. Cheng Z, White MF: Targeting Forkhead box O1 from the concept to metabolic diseases: lessons

    from mouse models. Antioxid Redox Signal 2011;14:649-661

    28. Kim HE, Lee SG: Induction of ATP synthase beta by HO induces melanogenesis by activating PAH

    and cAMP/CREB/MITF signaling in melanoma cells. Int J Biochem Cell Biol 2013;45:1217-1222

    29. Xu C, Zhang X, Yu C, Lu G, Chen S, Xu L, Ding W, Shi Q, Li Y: Proteomic analysis of hepatic

    ischemia/reperfusion injury and ischemic preconditioning in mice revealed the protective role of

    ATP5beta. Proteomics 2009;9:409-419

    30. Ishikawa M, Iwamoto T, Nakamura T, Doyle A, Fukumoto S, Yamada Y: Pannexin 3 functions as

    an ER Ca(2+) channel, hemichannel, and gap junction to promote osteoblast differentiation. J Cell Biol

    2011;193:1257-1274

    31. Osorio-Fuentealba C, Contreras-Ferrat AE, Altamirano F, Espinosa A, Li Q, Niu W, Lavandero S,

    Klip A, Jaimovich E: Electrical Stimuli Release ATP to Increase GLUT4 Translocation and Glucose

    Uptake via PI3Kgamma-Akt-AS160 in Skeletal Muscle Cells. Diabetes 2012;

    32. Urban D, Hartel FV, Gadiraju K, Gunduz D, Aslam M, Piper HM, Noll T: Extracellular ATP

    Page 25 of 57 Diabetes

  • attenuates ischemia-induced caspase-3 cleavage in human endothelial cells. Biochem Biophys Res

    Commun 2012;425:230-236

    33. Emmett DS, Feranchak A, Kilic G, Puljak L, Miller B, Dolovcak S, McWilliams R, Doctor RB, Fitz

    JG: Characterization of ionotrophic purinergic receptors in hepatocytes. Hepatology 2008;47:698-705

    34. Feranchak AP, Fitz JG, Roman RM: Volume-sensitive purinergic signaling in human hepatocytes. J

    Hepatol 2000;33:174-182

    35. Amaral SS, Oliveira AG, Marques PE, Quintao JL, Pires DA, Resende RR, Sousa BR, Melgaco JG,

    Pinto MA, Russo RC, Gomes AK, Andrade LM, Zanin RF, Pereira RV, Bonorino C, Soriani FM, Lima

    CX, Cara DC, Teixeira MM, Leite MF, Menezes GB: Altered responsiveness to extracellular ATP

    enhances acetaminophen hepatotoxicity. Cell Commun Signal 2013;11:10

    36. Barajas-Lopez C, Espinosa-Luna R, Christofi FL: Changes in intracellular Ca2+ by activation of P2

    receptors in submucosal neurons in short-term cultures. Eur J Pharmacol 2000;409:243-257

    37. Cheng A, Wang S, Yang D, Xiao R, Mattson MP: Calmodulin mediates brain-derived neurotrophic

    factor cell survival signaling upstream of Akt kinase in embryonic neocortical neurons. J Biol Chem

    2003;278:7591-7599

    38. Sopasakis VR, Liu P, Suzuki R, Kondo T, Winnay J, Tran TT, Asano T, Smyth G, Sajan MP, Farese

    RV, Kahn CR, Zhao JJ: Specific roles of the p110alpha isoform of phosphatidylinsositol 3-kinase in

    hepatic insulin signaling and metabolic regulation. Cell Metab 2010;11:220-230

    39. Kim JA, Kang YS, Lee SH, Lee EH, Yoo BH, Lee YS: Glibenclamide induces apoptosis through

    inhibition of cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channels and

    intracellular Ca(2+) release in HepG2 human hepatoblastoma cells. Biochemical and biophysical

    research communications 1999;261:682-688

    40. Ma CJ, Nie AF, Zhang ZJ, Zhang ZG, Du L, Li XY, Ning G: Genipin stimulates glucose transport in

    C2C12 myotubes via an IRS-1 and calcium-dependent mechanism. J Endocrinol 2013;216:353-362

    41. Holland WL, Knotts TA, Chavez JA, Wang LP, Hoehn KL, Summers SA: Lipid mediators of

    insulin resistance. Nutr Rev 2007;65:S39-46

    42. Hojlund K, Yi Z, Lefort N, Langlais P, Bowen B, Levin K, Beck-Nielsen H, Mandarino LJ: Human

    ATP synthase beta is phosphorylated at multiple sites and shows abnormal phosphorylation at specific

    sites in insulin-resistant muscle. Diabetologia 2010;53:541-551

    43. Hojlund K, Wrzesinski K, Larsen PM, Fey SJ, Roepstorff P, Handberg A, Dela F, Vinten J,

    McCormack JG, Reynet C, Beck-Nielsen H: Proteome analysis reveals phosphorylation of ATP

    synthase beta -subunit in human skeletal muscle and proteins with potential roles in type 2 diabetes. J

    Biol Chem 2003;278:10436-10442

    44. Hirabara SM, Curi R, Maechler P: Saturated fatty acid-induced insulin resistance is associated with

    mitochondrial dysfunction in skeletal muscle cells. Journal of cellular physiology 2010;222:187-194

    45. Mazibuko SE, Muller CJ, Joubert E, de Beer D, Johnson R, Opoku AR, Louw J: Amelioration of

    palmitate-induced insulin resistance in C2C12 muscle cells by rooibos (Aspalathus linearis).

    Phytomedicine 2013;

    46. Gaster M: Insulin resistance and the mitochondrial link. Lessons from cultured human myotubes.

    Biochim Biophys Acta 2007;1772:755-765

    47. Gao D, Nong S, Huang X, Lu Y, Zhao H, Lin Y, Man Y, Wang S, Yang J, Li J: The effects of

    palmitate on hepatic insulin resistance are mediated by NADPH Oxidase 3-derived reactive oxygen

    species through JNK and p38MAPK pathways. J Biol Chem 2010;285:29965-29973

    48. Ye J: Mechanisms of insulin resistance in obesity. Front Med 2013;7:14-24

    Page 26 of 57Diabetes

  • 49. Zhang BB, Zhou G, Li C: AMPK: an emerging drug target for diabetes and the metabolic syndrome.

    Cell metabolism 2009;9:407-416

    50. Foretz M, Hebrard S, Leclerc J, Zarrinpashneh E, Soty M, Mithieux G, Sakamoto K, Andreelli F,

    Viollet B: Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK

    pathway via a decrease in hepatic energy state. The Journal of clinical investigation

    2010;120:2355-2369

    51. Brunmair B, Staniek K, Gras F, Scharf N, Althaym A, Clara R, Roden M, Gnaiger E, Nohl H,

    Waldhausl W, Furnsinn C: Thiazolidinediones, like metformin, inhibit respiratory complex I: a

    common mechanism contributing to their antidiabetic actions? Diabetes 2004;53:1052-1059

    52. Stephenne X, Foretz M, Taleux N, van der Zon GC, Sokal E, Hue L, Viollet B, Guigas B:

    Metformin activates AMP-activated protein kinase in primary human hepatocytes by decreasing

    cellular energy status. Diabetologia 2011;54:3101-3110

    53. Wang Y, Nishi M, Doi A, Shono T, Furukawa Y, Shimada T, Furuta H, Sasaki H, Nanjo K: Ghrelin

    inhibits insulin secretion through the AMPK-UCP2 pathway in beta cells. FEBS letters

    584;584:1503-1508

    54. Kim WH, Lee JW, Suh YH, Lee HJ, Lee SH, Oh YK, Gao B, Jung MH: AICAR potentiates ROS

    production induced by chronic high glucose: roles of AMPK in pancreatic beta-cell apoptosis. Cellular

    signalling 2007;19:791-805

    55. Han Q, Zhang X, Xue R, Yang H, Zhou Y, Kong X, Zhao P, Li J, Yang J, Zhu Y, Guan Y: AMPK

    potentiates hypertonicity-induced apoptosis by suppressing NFkappaB/COX-2 in medullary interstitial

    cells. J Am Soc Nephrol 2011;22:1897-1911

    Page 27 of 57 Diabetes

  • Figure legends

    Figure 1. ATPS expression was reduced in the livers of db/db and HFD-fed

    diabetic mice. (A) The mRNA level of ATPS was reduced in the livers of db/db

    mice. (B) The protein level of ATPS was reduced in the livers of db/db mice. (C)

    Hepatic ATP content was reduced in db/db mice. N=5, *p

  • were performed using antibodies against ATPS or 6xHis tag. Mi, mitochondrial

    fraction. (C) ATPS overexpression elevated ATP content in the livers. (D-E) ATPS

    overexpression on the protein levels of gluconeogenic genes in the livers.

    Representative images were shown in (D) and quantitative data shown in (E). (F)

    ATPS overexpression reduced the mRNA levels of G6Pase and PEPCK in the livers.

    N=5-8, *p

  • Akt activation in HepG2 cells. Infected cells were treated with PPADS (50M) for 1

    hour before pAkt levels were analyzed. (B) Inhibition of PLC attenuated

    ATPS-induced Akt activation in HepG2 cells. Infected cells were treated with PLC

    inhibitor U73122 (5M) for 1 hour before pAkt levels were analyzed. (C) Inhibition

    of P2 receptors attenuated ATPS-induced increase in cytosolic free calcium level.

    Infected cells were treated with PPADS or suramin (50M) for 1 hour before cellular

    calcium levels were analyzed. The calcium levels were obtained from more than 300

    single cells in at least 3 independent experiments. (D) Inhibition of CaM completely

    abolished ATPS-induced Akt activation. Infected cells were treated with CaM

    antagonist CPZ (100M) for 1 hour before pAkt levels were analyzed. N=5, *p

  • treatment increased ATPS protein level in the livers of STZ-induced diabetic mice.

    (E) Hepatic overexpression of ATPS ameliorated fasting hyperglycemia of

    STZ-treated mice. 3 days post viral injection, fasting blood glucose was monitored.

    (F-G) ATPS overexpression increased pAkt levels and reduced the protein levels of

    G6Pase and PEPCK in the livers. (H) ATPS overexpression reduced the mRNA

    levels of G6Pase and PEPCK in the livers. N=9, *p

  • images were shown in upper panel, and quantitative data shown in lower panel. C)

    The mRNA levels of ATP synthase subunits in livers of HFD-mice. C57BL/6 mice

    were fed on a high-fat diet (HFD) for 12 weeks. D) The protein levels of ATP

    synthase subunits in the livers of HFD mice. The representative gel images were

    shown in upper panel, and quantitative data were shown in lower panel. NC, normal

    chow; HFD, high fat diet. N=5, *p

  • ATPS protein (A) and mRNA (B) levels in skeletal muscle of db/db mice. C-D)

    Ad-ATPS injection had little effect on ATPS protein (C) and mRNA (D) levels in

    pancreas of db/db mice. N=5-8, there is no statistically significance between two

    groups of mice.

    Figure 5. Hepatic overexpression of ATPS improved glucose tolerance in db/db

    mice. A-C) OGTT data of mice at 0, 3 and 7 days post viral injection. Three groups of

    db/db mice were treated with saline, Ad-GFP or Ad-ATPS via tail-vein injection,

    respectively. D) Insulin secretion of mice at 7 days post viral injection. N=8, *p

  • Figure 7. Immunoflurescence staining revealed that overexpressed ATPS was

    located in mitochondria of HepG2 cells. Overexpressed ATPS was mainly located

    in mitochondria. COX IV, Cytochrome c oxidase subunit 4, mitochondrial marker.

    The images were captured by confocal microscopy and the representatives of at least

    3 independent experiments.

    Figure 8. Overexpressed ATPS protein was located in mitochondria of HepG2

    cells. Mitochondrial and cytosolic fractions were isolated, and immunoblotting was

    performed to analyze the distribution of ATPS protein. The images shown here were

    the representatives of at least 3 independent experiments.

    Figure 9. Suramin attenuated ATPS-induced Akt activation in HepG2 cells. A)

    Infected HepG2 cells were treated with indicated concentration of suramin for 1 hour

    before pAkt levels were analyzed. B) ATPS-induced Akt activation was partially

    dependent on the presence of extracellular calcium. Ad-ATPS-infected cells were

    treated with calcium free medium plus 0.5mM EGTA for 2 hours before pAkt levels

    were analyzed. N=5, *p

  • db/db mouse livers. The representative gel images were shown in (A), and

    quantitative data shown in (B). C) ATPS overexpression on the mRNA levels of

    PEPCK in db/db mouse livers. Two sets of primers according to PEPCK mRNA were

    used. D) ATPS overexpression on ubiquitination of PEPCK protein in db/db mouse

    livers. IP, immunoprecipation; IB, immunoblotting; Ub, ubiquitin. E) ATPS

    overexpression on ATP levels in mouse livers. N=6, *p

  • and the fluorescence intensity was measured by flow cytometry. ROS level was

    determined using DCFH-DA Method. N=3,*P

  • db/m db/db

    0.0

    0.5

    1.0

    *

    Re

    lati

    ve

    AT

    P c

    on

    ten

    t

    (fo

    ld o

    f C

    on

    )

    Figure 1

    NC HFD0.0

    0.5

    1.0

    *

    Re

    lati

    ve

    AT

    P c

    on

    ten

    t

    (fo

    ld o

    f C

    on

    )

    A

    B

    C

    db/m db/db0.0

    0.5

    1.0

    1.5

    *R

    ela

    tiv

    e A

    TP

    S

    mR

    NA

    (fo

    ld o

    f C

    on

    )

    HFD

    ATPS

    eIF5

    NC HFD0.0

    0.5

    1.0

    1.5

    *

    Re

    lati

    ve

    AT

    PS

    p

    rote

    in

    (fo

    ld o

    f C

    on

    )

    NC

    D

    E

    F

    NC HFD0.0

    0.5

    1.0

    1.5

    *

    Rela

    tiv

    e A

    TP

    S

    mR

    NA

    (fo

    ld o

    f C

    on

    )

    0.0

    0.5

    1.0*

    db/m db/db

    Rela

    tiv

    e A

    TP

    S

    pro

    tein

    (fo

    ld o

    f C

    on

    )

    ATPS

    db/m db/db

    eIF5

    Page 37 of 57 Diabetes

  • Figure 2A

    B

    Ad-GFP Ad-ATPS0

    10

    20

    30

    40

    50

    *

    Se

    rum

    in

    su

    lin

    (ng

    /mL

    )

    0 30 60 90 1200

    10

    20

    30

    40

    50

    60Ad-GFP

    Ad-ATPS

    Day 0

    Time (minute)

    Blo

    od

    glu

    co

    se

    (mm

    ol/L

    )

    Day 3

    0 30 60 90 1200

    10

    20

    30

    40

    50Ad-GFP

    Ad-ATPS

    *

    ** *

    **

    Time (minute)

    Blo

    od

    glu

    co

    se

    (mm

    ol/L

    )

    0 30 60 90 1200

    10

    20

    30

    40Ad-GFP

    Ad-ATPS

    Day 7

    Time (minute)

    **

    * * *

    *Blo

    od

    glu

    co

    se

    (mm

    ol/L

    )

    0 70

    5

    10

    15

    20

    Ad-GFP

    Ad-ATPS

    3

    * *

    Days post viral injection

    Fa

    sti

    ng

    blo

    od

    glu

    co

    se

    (m

    mo

    l/L

    )

    C

    D

    E

    Page 38 of 57Diabetes

  • G6Pase PEPCK0.0

    0.5

    1.0

    1.5 Ad-GFPAd-ATPS

    * *

    Re

    lati

    ve

    mR

    NA

    le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    pAkt/Akt G6Pase PEPCK0

    1

    2

    3 Ad-GFPAd-ATPS

    *

    *

    Re

    lati

    ve

    pro

    tein

    le

    ve

    l

    (fo

    ld o

    f c

    on

    )

    Figure 3A

    B

    Ad-GFP Ad-ATPS0.0

    0.5

    1.0

    1.5*

    Re

    lati

    ve

    AT

    P c

    on

    ten

    t

    (fo

    ld o

    f C

    on

    )

    C

    Ad-GFP Ad-ATPS

    Ad-GFP Ad-ATPS0

    1

    2

    3 *R

    ela

    tiv

    e A

    TP

    S

    pro

    tein

    (fo

    ld o

    f C

    on

    )

    EIF5

    ATPS

    6xHis tag pAkt

    Akt

    G6Pase

    PEPCK

    eIF5

    Ad-GFP Ad-ATPS

    D

    E

    FactinATPS

    Mi

    Ad-GFP Ad-ATPS

    Cytoplasm

    6His-tag

    COXIV

    Ad-GFP Ad-ATPS

    ATPS

    Mitochondria

    Page 39 of 57 Diabetes

  • Figure 4

    Ad-

    GFP

    Ad-

    ATP

    S

    Ad-

    GFP

    Ad-

    ATP

    S

    0

    1

    2

    3

    4

    **

    *Cell Medium

    Re

    lati

    ve

    AT

    P c

    on

    ten

    t

    (fo

    ld o

    f C

    on

    )

    A

    C

    D

    E

    Ad-GFP Ad-ATPS0

    5

    10

    15

    20

    25 0 nM INS100 nM INS

    *

    *

    *

    #

    Re

    lati

    ve

    pA

    kt/

    Ak

    t le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    pAkt

    Akt

    ATPS

    eIF5

    Ad-GFP Ad-ATPS

    Insulin - + - +

    Ad-

    GFP

    Ad-

    ATP

    S

    Ad-

    GFP

    Ad-

    ATP

    S

    0

    1

    2

    *

    *Cell Medium

    Re

    lati

    ve

    AT

    P c

    on

    ten

    t

    (fo

    ld o

    f C

    on

    )

    Ad-GFP Ad-ATPS0

    1

    2

    3

    4 *

    Re

    lati

    ve

    pA

    kt/

    Ak

    t le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    pAkt

    Akt

    eIF5

    Ad-GFP Ad-ATPS

    DW

    ort

    p110

    p110

    DW

    ort

    p110

    p110

    0

    5

    10

    15

    20 Ad-GFPAd-ATPS

    **

    Re

    lati

    ve

    pA

    kt/

    Ak

    t le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    pAkt

    Akt

    Ad-GFP Ad-ATPS

    D W D W

    eIF5

    B

    Page 40 of 57Diabetes

  • Figure 5

    0

    1

    2

    3

    4*

    #

    Ad-GFP Ad-ATPS

    U73122 - - +

    Re

    lati

    ve

    pA

    kt/

    Ak

    t le

    ve

    l

    (fo

    ld o

    f c

    on

    )

    pAkt

    Akt

    eIF5

    Ad-GFP Ad-ATPS

    - - +U73122

    PPADS - + - +

    Ad-GFP Ad-ATPS

    pAkt

    Akt

    EIF5

    0

    5

    10

    15

    *

    Ad-GFP Ad-ATPS

    PPADS - + - +

    Re

    lati

    ve

    pA

    kt/

    Ak

    t le

    ve

    l

    (fo

    ld o

    f c

    on

    )

    #

    pAkt

    Akt

    eIF5

    0

    1

    2

    3

    4

    5

    #

    Ad-GFP Ad-ATPS

    CPZ - - +

    *R

    ela

    tiv

    e p

    Ak

    t/A

    kt

    le

    ve

    l

    (fo

    ld o

    f c

    on

    )

    Ad-GFP Ad-ATPS

    - - +CPZ

    A

    B

    C

    D

    Ad-

    GFP

    Ad-

    ATP

    S

    PPA

    DS

    sura

    min

    0.0

    0.50.540.550.560.570.580.590.60

    * # #

    34

    0/3

    80

    Page 41 of 57 Diabetes

  • FOXO1 DAPI Merge

    Ad-GFP

    Ad-ATPS

    Ad-ATPS

    + PPADS

    Ad-ATPS

    + CPZ

    Figure 6 Page 42 of 57Diabetes

  • Figure 7

    Con STZ

    0.0

    0.5

    1.0

    *

    Con STZATPS

    eIF5

    Rela

    tiv

    e A

    TP

    S

    pro

    tein

    (fo

    ld o

    f C

    on

    )

    Con STZ0.0

    0.5

    1.0

    *

    Rela

    tiv

    e A

    TP

    S

    mR

    NA

    (fo

    ld o

    f C

    on

    )

    Ad-GFP Ad-ATPS0

    1

    2

    #

    ATPS

    6xHis tag

    eIF5

    Ad-GFP Ad-ATPS

    Rela

    tiv

    e A

    TP

    S

    pro

    tein

    (fo

    ld o

    f C

    on

    )

    Con Ad-GFP Ad-ATPS

    0.0

    0.5

    1.0

    **

    #

    Re

    lati

    ve

    AT

    P c

    on

    ten

    t

    (fo

    ld o

    f C

    on

    )

    0

    5

    10

    15

    20

    25

    Con

    STZ+Ad-GFP

    STZ+Ad-ATPS

    0 day 3 day

    #

    **** **

    Fa

    sti

    ng

    blo

    od

    glu

    co

    se

    (mm

    ol/L

    )

    pAkt

    /Akt

    G6P

    ase

    PEPCK

    0

    1

    2

    3

    4

    5Ad-GFP

    Ad-ATPS

    #

    Re

    lati

    ve

    pro

    tein

    le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    ##

    A

    B

    C

    GD

    E

    F

    pAkt

    Akt

    PEPCK

    G6Pase

    eIF5

    Ad-GFP Ad-ATPSG6P

    ase

    PEPCK

    0.0

    0.5

    1.0

    1.5 Ad-GFPAd-ATPS

    #

    Re

    lati

    ve

    mR

    NA

    le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    #

    H

    Page 43 of 57 Diabetes

  • Figure 8

    ATPS

    ATP release

    P2X P2Y

    Ca2+/CaM/PI3K

    Akt

    Gluconeogenic

    genes

    Page 44 of 57Diabetes

  • ATP

    S

    ATP

    S

    ATP

    S

    ATP

    S

    ATP

    S

    ATP

    Sb

    ATP

    Sc

    ATP

    Sd0.0

    0.5

    1.0

    1.5 db/mdb/db

    *

    Re

    lati

    ve

    mR

    NA

    le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    ATPS ATPS ATPSd0.0

    0.5

    1.0

    1.5 db/mdb/db

    Re

    lati

    ve

    pro

    tein

    le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    ATPS

    EIF5

    ATPSd

    db/m db/db

    ATPS

    -actin

    ATP

    S

    ATP

    S

    ATP

    S

    ATP

    S

    ATP

    S

    ATP

    Sb

    ATP

    Sc

    ATP

    Sd0.0

    0.5

    1.0

    1.5 NCHFD

    *

    Re

    lati

    ve

    mR

    NA

    lev

    el

    (fo

    ld o

    f C

    on

    )

    ATPS

    EIF5

    ATPSd

    NC HFD

    ATPS

    -actin

    ATPS ATPS ATPSd0.0

    0.5

    1.0

    1.5 NCHFD

    Re

    lati

    ve

    pro

    tein

    le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    A C

    B D

    Supplemental Figure 1Page 45 of 57 Diabetes

  • 20 10 20 50 100 MOI

    Ad-ATPS

    ATPS

    actin

    A

    Ad-GFP

    6His-tag

    actin

    20 25 50 5 10 20 MOI

    B

    Ad-ATPSAd-GFP

    Supplemental Figure 2 Page 46 of 57Diabetes

  • Ad-GFP Ad-ATPS0

    100

    200

    300

    400

    *

    Se

    rum

    TG

    le

    ve

    l

    (m

    g/d

    l)

    Ad-GFP Ad-ATPS0

    5

    10

    15

    20

    *

    He

    pa

    tic

    TG

    co

    nte

    nt

    (m

    g/g

    .tis

    su

    e)

    A

    B

    Ad-GFP Ad-ATPS C

    D

    FAS mSREBP-10.0

    0.5

    1.0

    1.5 Ad-GFPAd-ATPS

    **

    Re

    lati

    ve

    pro

    tein

    le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    Ad-GFP Ad-ATPS

    FAS

    mSREBP-1

    SREBP-1

    eIF5

    Supplemental Figure 3Page 47 of 57 Diabetes

  • Ad-GFP Ad-ATPS0.0

    0.5

    1.0

    1.5

    Rela

    tiv

    e A

    TP

    S

    pro

    tein

    (fo

    ld o

    f C

    on

    )

    Ad-GFP Ad-ATPS0.0

    0.5

    1.0

    1.5

    Re

    lativ

    e A

    TP

    S

    mR

    NA

    (fo

    ld o

    f C

    on

    )

    Ad-GFP Ad-ATPS0.0

    0.5

    1.0

    1.5

    2.0R

    ela

    tiv

    e A

    TP

    S

    mR

    NA

    (fo

    ld o

    f C

    on

    )

    Ad-GFP Ad-ATPS0.0

    0.5

    1.0

    1.5

    Rela

    tiv

    e A

    TP

    S

    pro

    tein

    (fo

    ld o

    f C

    on

    )

    Muscle Pancreas

    ATPS

    EIF5

    Ad-GFP Ad-ATPS

    -actin

    ATPS

    EIF5

    Ad-GFP Ad-ATPS

    -actin

    A C

    B D

    Supplemental Figure 4 Page 48 of 57Diabetes

  • 0 30 60 90 1200

    20

    40

    60Saline

    Ad-GFP

    Ad-ATPS

    Time (minute)

    ** *

    * **

    Day 3

    Blo

    od

    glu

    co

    se

    (m

    mo

    l/L

    )

    0 30 60 90 1200

    10

    20

    30

    40

    50 SalineAd-GFP

    Ad-ATPS

    Day 0

    Time (minute)

    Blo

    od

    glu

    co

    se

    (m

    mo

    l/L

    )

    0 30 60 90 1200

    20

    40

    60 SalineAd-GFP

    Ad-ATPS

    Day 7

    *

    * * **

    *

    Time (minute)

    Blo

    od

    glu

    co

    se

    (m

    mo

    l/L

    )

    pAKT

    AKT

    EIF5

    ATPSGFPSaline

    -actin

    Saline Ad-GFP Ad-ATPS0

    2

    4

    6

    ns

    *

    Re

    lati

    ve

    pA

    kt/

    Ak

    t le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    A D

    B

    0 15 30 45 600

    10

    20

    30

    40 SalineAd-GFP

    Ad-ATPS

    *

    Time (minute)

    Ins

    ulin

    le

    ve

    l (n

    g/m

    L)

    C

    Supplemental Figure 5

    Saline Ad-GFP Ad-ATP0

    500

    1000

    1500

    AU

    C (

    ng

    /mL

    .min

    ute

    )E

    F

    Page 49 of 57 Diabetes

  • Sal

    ine

    Ad-

    GFP

    Ad-

    ATP

    S

    0

    500

    1000

    1500

    **

    ITT

    AU

    C (

    mm

    ol/L

    *min

    ute

    )ITT at Day 7

    0 30 60 90 1200

    5

    10

    15

    20

    25

    Ad-GFP

    Ad-ATPS

    Saline

    ****

    ** ** ****

    Time (minute)

    Blo

    od

    glu

    co

    se

    (m

    mo

    l/L

    )

    PTT at Day 7

    0 30 60 90 120 150 1800

    10

    20

    30

    Saline

    Ad-GFP

    Ad-ATPS

    ****

    **** ******

    **

    Time (minute)

    Blo

    od

    glu

    co

    se

    (m

    mo

    l/L

    )

    Salin

    e

    Ad-

    GFP

    Ad-

    ATP

    0

    1000

    2000

    3000

    4000

    5000

    **

    PTT

    AU

    C (

    mm

    ol/L

    *min

    ute

    )

    A C

    B D

    Supplemental Figure 6 Page 50 of 57Diabetes

  • COX IV DAPI MergeATPS

    Ad-LacZ

    Ad-ATPS

    Supplemental Figure 7Page 51 of 57 Diabetes

  • Ads- GFP ATPS GFP ATPS

    Mitochondria cytoplasma

    ATPS

    COXIV

    actin

    Supplemental Figure 8 Page 52 of 57Diabetes

  • Ad-

    GFP

    Ad-

    ATP

    S

    Ad-

    ATP

    S

    Ad-

    ATP

    S

    0

    2

    4

    6

    8

    10 *

    suramin(M) 0 0 10 50

    #

    #

    Re

    lati

    ve

    pA

    kt/

    Ak

    t le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    suramin 0 0 10 50 (M)

    pAkt

    Akt

    eIF5

    Ad-GFP Ad-ATPS

    0

    1

    2

    3

    4

    5

    Ad-GFP Ad-ATPS

    Ca2+ + + -

    *#

    Re

    lati

    ve

    pA

    kt/

    Ak

    t le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    Ad-GFP Ad-ATPS

    pAkt

    Akt

    eIF5

    Ca2+ + +

    A B

    Supplemental Figure 9Page 53 of 57 Diabetes

  • Saline Ad-GFP Ad-ATPS0.0

    0.5

    1.0

    1.5

    2.0

    *Saline

    Ad-GFP

    Ad-ATPS

    Re

    lati

    ve

    AT

    P c

    on

    ten

    t

    (fo

    ld o

    f C

    on

    )

    pAKT

    AKT

    EIF5

    G6Pase

    PEPCK

    -actin

    pAkt

    /Akt

    G6P

    ase

    PEPC

    K

    0.0

    0.5

    1.0

    1.5

    2.0

    2.5 SalineAd-GFP

    Ad-ATPS*

    *

    Re

    lati

    ve

    pro

    tein

    le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    G6Pase PEPCK PEPCK0.0

    0.5

    1.0

    1.5 SalineAd-GFPAd-ATPS

    * * *

    Primer set 1 Primer set 2

    Re

    lati

    ve

    mR

    NA

    le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    A C

    B

    EIB: anti-PEPCK

    Ubiquitin-input:

    IB: anti-Ubiquitin

    Ad-GFP Ad-ATPS

    IP: Ub Ub Ub Ub IgG

    D

    Supplemental Figure 10 Page 54 of 57Diabetes

  • Con FFA

    0.0

    0.5

    1.0

    *

    Rela

    tiv

    e A

    TP

    S

    pro

    tein

    (fo

    ld o

    f C

    on

    )Con FFA

    ATPS

    eIF5

    C

    C+I

    NS

    FFA

    FFA+I

    NS C

    C+I

    NS

    FFA

    FFA+I

    NS

    0

    2

    4

    6

    8 Ad-GFP

    Ad-ATPS

    *

    *

    Re

    lati

    ve

    pA

    kt/

    Ak

    t le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    pAkt

    Akt

    INS - + - + - + - +

    FFA - - + + - - + +

    Ad-GFP Ad-ATPS

    eIF5

    A

    B

    C

    Supplemental Figure 11Page 55 of 57 Diabetes

  • 0h 6h

    0.0

    0.5

    1.0

    1.5

    2.0 Ad-LacZAd-ATPS *

    #

    Palmitate

    p=0.07

    Re

    lati

    ve

    RO

    S le

    ve

    l

    (fo

    ld o

    f C

    on

    )

    Supplemental Figure 12 Page 56 of 57Diabetes

  • Table 1. List of oligonucleotide primer pairs used in real time RT-PCR and RT-PCR

    analysis.

    Gene sense antisense

    ATPS(H,M) 5'-AACATTGTTGGCAATGAGCA-3' 5'-ATGTAGCCCGTGAAGACCTC-3'

    ATPS 5'-TGTCCGCTTACATTCCAACA-3' 5'-CTTCATGGTACCTGCCACCT-3'

    ATPS 5'-GGCTGGACTCAGCTACATCCGGT-3' 5'-TGCCAGAACAGGGGCCCACA-3'

    ATPS 5'-CCGTGCAGCCGCAATGGAT-3' 5'-TACAGAGCCAAAGAACCTGTCCCA-3'

    ATPS 5'-CTTTGCCTCCCCGACGCAGG-3' 5'-ACGGAGCCGCTGCTCACAAA-3'

    ATPSb 5'-TCAGAAGCGCCATTACCTCT-3' 5'-TTGGCAATGGTCTCCTTTTC-3'

    ATPSc 5'-CCATCTAAGCAGCCTTCCTG-3' 5'-CCCAGAATGGCATAGGAGAA-3'

    ATPSd 5'- CTGCGATTGACTGGGCTTAC -3' 5'- AGACACAAACTCAGCACAGC -3'

    G6Pase 5'-AGGAAGGATGGAGGAAGGAA-3' 5'-TGGAACCAGATGGGAAAGAG-3'

    PEPCK

    (set 1)

    5'-ATCTTTGGTGGCCGTAGACCT-3' 5'-CCGAAGTTGTAGCCGAAGAA-3'

    PEPCK

    (set 2)

    5'-ACCCAAGAGCAGAGAGACAC-3' 5'- ATGCCCATCCGAGTCATGAT -3'

    GK 5'-TATGAAGACCGCCAATGTGA-3' 5'-CACTGAGCTCTCATCCACCA-3'

    -actin 5'-AGCCATGTACGTAGCCATCC -3' 5'-GCTGTGGTGGTGAAGCTGTA -3'

    M: mouse; H: human. If not indicated, all the primer sequences are referred to mouse orgin.

    Page 57 of 57 Diabetes