Cell, Vol. 16,407-413, February 1979, Copyright 0 1979 by MIT

A Secondary Attachment Site for Bacteriophage X in trpC of E. coli.

Gail E. Christie* and Terry Plattt Department of Molecular Biophysics and Biochemistry Yale University 333 Cedar Street New Haven, Connecticut 06510

Summary

We have determined the nucleotide sequence of a secondary X attachment site in trpC. Direct sequence analysis of Atrp transducing phage DNA fragments carrying the two prophage attach- ment sites reveals a 6 nucleotide homology in the crossover region which is a subset of the 15 nucleotide core sequence in the primary X at- tachment site: GCTTTTTTATACTAA. This 6 nu- cleotide sequence is also present in the intact trpC genome at the attachment site, as shown by analysis of trpC mRNA spanning this region.

Introduction

Integration of bacteriophage X into the E. coli chromosome is a well characterized example of site-specific recombination (for recent reviews, see Nash, 1977; Weisberg, Gottesman and Gottesman, 1977). As first proposed by Campbell (1962), inte- gration occurs via a single reciprocal recombina- tion resulting in linear insertion of the phage ge- nome into the host chromosome. The loci on the bacterial and viral chromosomes at which cross- over occurs are specific, and have been designated att sites. AttB and attP are the bacterial and phage sites involved in integrative recombination; attL and attR are the prophage attachment sites flank- ing the integrated phage genome which recombine to excise the viral chromosome. Integration is me- diated by a specific phage function, int, which maps immediately to the right of attP, and involves at least two host-specific proteins as well (Miller and Friedman, 1977; Williams, Wulff and Nash, 1977). Prophage excision requiresint and the prod- uct of a second phage gene, xis, and regenerates the original attB and attP sites.

The behavior of the four primary att sites in int- dependent recombination suggests that the four arms of the different aft sites are nonhomologous and functionally distinct (Guerrini, 1969). Analysis of mutant aft sites suggests that one component of att site structure is a region of common DNA sequence (Shulman, Mizuuchi and Gottesman,

* Present address: Department of Biochemistry, Stanford Univer- sity Medical Center, Stanford, California 94305. t To whom requests for reprints should be addressed.

1976). Direct DNA sequence analysis (Landy and Ross, 1977) has confirmed these genetic predic- tions. Each att site consists of a 15 nucleotide common core sequence, designated “O”, and flanking arms of phage or bacterial DNA. These arms, designated B, B’, P and P’, exhibit no strik- ing homology. The role of these features in att site recognition is not yet known.

When the bacterial att site located between the E. coli genesgal and bio is deleted, A integration is reduced about 200 fold. Insertion of the phage genome still usesattP, but now occurs at a number of specific secondary sites on the E. coli chromo- some, all designated AOA’ (Shimada, Weisberg and Gottesman, 1972). These sites may be thought of as naturally occurring mutants of attB which are recognized with greatly reduced frequency. When these sites occur within structural genes, integra- tion of A disrupts gene function, and several such secondary attachment sites have been localized (Shimada, Weisberg and Gottesman, 1973). Exci- sion is mediated by int and xis, and restores func- tion of the gene into which the prophage was inserted. Aberrant excision of the prophage results in transducing phage carrying the secondary pro- phage attachment sites. Although the different sec- ondary sites differ from each other as well as from attB, as judged by frequency of int-dependent recombination with various mutant and prophage attachment sites (Shimada, Weisberg and Gottes- man, 1975), they must possess some of the features which specify integration and excision. Compari- son of these sites with the primary attachment site should therefore help to determine the functional significance of various attachment site features.

One secondary attachment site originally identi- fied by Shimada et al. (1973) maps in trpC, the structural gene for indoleglycerol phosphate syn- thetase. Transducing phages carrying trp genes to either side of the insertion can be isolated, and an int-dependent recombination between two such transducing phages yields a phage carrying an entire functional trp operon (Shimada et al., 1973). We have made use of these htrp transducing phages to determine the nucleotide sequence of this secondary integration site in the bacterial chromosome.

Results

Strategy The Xtrp transducing phages isolated from a trpC lysogen carry the two prophage attachment sites. The AtrpCBA phage carries AOP’ and bacterial DNA to the left of the attachment site; AtrpED derivatives carry POA’ and bacterial sequences to the right. An Eco RI fragment from AtrpEDlO which contains all

Cdl 408

of the trp sequences carried by the transducing phage has been inserted into several vectors de- rived from Col El (Brown et al., 1978). The plasmid pKB3 carries this fragment inserted into the single Eco RI site of pCRI; pVH153 carries the same Eco RI fragment in a mini-Co1 El vector. Restriction fragments from AtrpCBA and both plasmids were used to sequence the two prophage attachment sites.

identification of Restriction Fragments Containing the Secondary att Sites Primary restriction fragments containing the two prophage attachment sites were identified with the aid of known mapping data for A (Landy and ROSS, 1977) and trpC (Christie, 1978; A. Wu, unpublished data). An 850 base pair (bp) Barn HI-Hint II frag- ment containing the AtrpCBA junction (AOP’) was identified on the basis of predicted size and by its absence from a Barn HI + Hint II digest of wild-type h DNA. Digestion of pKB3 with Hind III yields two fragments of about 10,000 bp (containing primarily vector DNA) and one of 1700 bp. The latter has one endpoint in trpD and one endpoint in X. Subse- quent digestion of this 1700 bp fragment with Hpa II yields two Hpa II-Hind III end fragments, one 800 bp long and the other <IO0 bp. Since the Hind III site in h is 260 nucleotides from the attachment site and there are no Hpa II cuts in this region, the 800 bp fragment must contain the prophage attach- ment site.

Restriction endonuclease cleavage sites in the primary restriction fragments containing the pro- phage att sites are shown in Figure la. Mapping was carried out by partial restriction endonuclease digestion of the primary fragments uniquely la- beled with 32P at each 5’ end (Smith and Birnstiel, 1976). Since the cleavage sites in the P and P’ arms had previously been determined (Landy and Ross, 1977), we were able to locate the region of cross- over between phage and bacterial sequences from restriction mapping data. The fragments used for DNA sequence analysis are indicated in Figure la. Mapping data for trpC sequences from the two prophage were confirmed by mapping the Hind Ill-Hint II trpD-trpC fragment isolated from 480trpEA790, which carries the intact trp operon.

DNA Sequence Analysis Sequencing gels showing the crossover region of the prophage attachment sites are shown in Fig- ures 1 b and 1 c. The X DNA sequence derived from our analysis of these prophageatt sites agrees with that found by Landy and Ross (1977) at the primary attachment site (see Figure 2). There is a 6 nucleo- tide homology between POA’ and AOP’ at the junction of the phage and bacterial sequences. These 6 nucleotides are also homologous to the central portion of the 15 nucleotide core of the primary h attachment site. Excision of A integrated at this secondary site restores trpC function (Shi- mada et al., 1973) and should therefore regenerate trpC sequence if one assumes a crossover in the region of the 6 base homology.

We hoped to confirm this predicted wild-type trpC sequence by analysis of an appropriate re- striction fragment isolated from the transducing phage 480trpAE790, which carries the entire tryp- tophan operon. The location of restriction endo- nuclease cleavage sites in trpC made it unreason- ably difficult, however, to isolate a fragment suita- ble for direct sequence analysis by the chemical cleavage method. We have therefore analyzed trpC mRNA synthesized in vivo, which corresponds to the DNA sequence of the r strand of the phage DNA.

TrpC mRNA Sequence across the Attachment Region Analysis of the T, products of a trpC mRNA frag- ment isolated by hybridization to AtrpED7 I strand DNA (Christie, 1978) suggested that oligonucleo- tide t29 might be the RNAase T, product spanning the region into which A inserts (see Figure 3b). Since this RNA:DNA hybrid was trimmed with RNAase T, during purification, t29 should remain intact (since it contains no internal G residues) even though 7 nucleotides are nonhomologous with the A DNA sequence (see Figure 3a). To test the hypothesis that oligonucleotide t29 contains sequences which overlap the end of the RNA:DNA hybrid, the hybrids were trimmed with pancreatic RNAase instead of T,. As predicted, oligonucleo- tide t29 is absent from the T, fingerprint of the resulting fragment (Figure 3~). Subsequent diges-

Figure 1. Sequence Analysis of the AtrpC Junctions

(a) Map of restriction endonuclease cleavage sites in fragments containing the two prophage attachment site regions from trpC. The numbering scale, in base pairs, is the same as that used by Landy and Ross (1977), where zero is the central base of the core of the primary, A att site. (-) Phage DNA; ( ---) trpC DNA. The bars below the restriction maps indicate the fragments used for DNA sequence analysis. They were sequenced in only one direction (in each case after labeling at the left-hand 5’ end), and the shaded area within each bar represents the extent of nucleotide sequence obtained from each of these fragments. (b) Autoradiograph of a 12.5% sequencing gel showing the crossover region in the AtrpCBA Alu I-Barn HI fragment, labeled with 32P at the 5’ end produced by Alu I. (c) Autoradiograph of a 20% sequencing gel showing the htrpED junction, as determined from the Alu I-Hinf I fragment isolated from pVH153 and labeled with 32P at the Alu I end. This region was also sequenced using a Hinf I-Hae III fragment from pKB3 labeled at the Hinf I end and run on an 8% sequencing gel (data not shown). The 6 nucleotide core region is indicated for each sequence.

A Secondary Lambda att Site in trpC 409

Cell 410

-20 -10 0 +I0 +20 I I I I ! I I

I I I I

~~GTTTCTCGTTCAGCTTTTTTATACTAAGTTGGCATTATA~A

x (PP’) TGCAAAGAGCAAGTCGAAAAAATATGATTCAACCGTAATATTT

I I I ! I I I I I I I I / I

ACGTTTCTCGTkAGCTTTTTTATAAATGGCGGCAATGCG~GC

XtrpED (PA’) TGCAAAGAGCAAGTCGAAAAAATATTTACCGCCGTACGCACG

/ I / I I I I I I

I I

A;ATTGCCGAA;CGTAATGTTTATACTAAGTtGGCAUATAiA

XtrDCBA (AP’) 1 TTTAACGGCTTCGCATTACAA$TATGAUCA~CCG~AA~A~~~

I I I I 1 I I I ------+ I

AAATTGCCGAAtCGiAATGTT&AAA~GG&GCAA~GCG~GC

trJ& (AA’) 1 TTTAACGGCTTCGCATTACAAATATTTACGCACG

I I I I +------

<1------ l

I I I I

ATCCGTTGAAGAC~GCTTTTTTATACTAACT-~GAGCGAAACLG @-bio (BB’) - TAGGCAACTTCGGACGAAAAAATATGATTGAACTCGCTTTGCC Figure 2. DNA Sequences Adjacent to the Core Regions of trpC Secondary att Sites

The AA' DNA sequence is predicted from the two prophage aft sites and confirmed by mRNA sequence analysis. The primary phage (PP’) and bacterial (BB’) sequences from Landy and Ross (1977) are also illustrated for purposes of comparison. Numbering is as described in the legend to Figure 1. (-) Phage DNA; ( -) trpC DNA. The common core region of the primary attachment site is indicated by boldface type, as is the 6 nucleotide homology between this site and the secondarytrpC site. Because the precise crossover point between phage and bacterial DNA is unknown in the PA’ and AP’ cases, the central region has not been assigned. The solid arrow (+) in the wild- type WpC sequence indicates a second occurrence of the 6 nucleotide homology to the core. The dashed arrows (- - ->) indicate an inverted repeat in the AA' sequence. The nucleotide at the 3’ end of this repeat in the A arm also lies at the 5’ end of a 5 nucleotide homology to the B arm at nucleotides -14 to -10.

tion of purified t29 with pancreatic RNAase yielded G, C, U, AC, AU and AAAC, and digestion with RNAase IJ? gave CA, CG, CCA, UA, UUA and UUUA, consistent with the predicted sequence of CCAU- UUAUAAACAUUACG. Direct sequence analysis of t29 by partial digestion with snake venom phospho- diesterase (Figure 3d) yielded all but the first three 5’ nucleotides. The sequence of this RNA corre- sponds exactly to that predicted from the two prophage attachment sites for the DNA across the trpC secondary attachment site.

Discussion

Differences in the frequency of h integration at various attachment sites must reflect differences in their DNA sequences. Specific recognition ele- ments for DNA:DNA and protein:DNA interactions could be involved. Mapping of deletions near att (Davis and Parkinson, 1971; Nash, 1974) suggests that long-range interactions probably do not occur; that is, that the recognition elements lie fairly close to the crossover region. It has been widely as- sumed that these recognition elements lie in all four arms flanking the crossover locus: B, B’, P and P’ (Gottesman and Weisberg, 1971). As Shul- man et al. (1976) have pointed out, however, only

two recognition elements are needed to distinguish among the four configurations involved in integra- tive and excisive recombination. For example, the phage attachment site could be recognized by the presence of P and P’, the two prophage attachment sites by the absence of either P or P’, and the bacterial site by the absence of both P and P’. Indeed, the OP’ region is much richer in distinctive sequence features than the bacterial att site (Landy and Ross, 1977), and the sequence in the P’ arm adjacent to the core appears to be involved in the binding of int protein (Kikuchi and Nash, 1978). Thus far the only bacterial sequence which appears to have functional significance is the core se- quence itself, which is almost certainly involved in a base pairing interaction with the core in attP. If there are important recognition elements in the bacterial sequence flanking the core, regions of homology or similarities in predicted secondary structure between the primary attachment site and secondary bacterial sites might be expected.

We have shown that a secondary attachment site in trpC has an uninterrupted homology of 6 nucleo- tides with the common core region of the primary attachment site. There is only one other region of homology between BOB’ and the trpC site within 70 nucleotides centered around the crossover site

A Secondary Lambda aft Site in trpC 411

Figure 3. Analysis of trpC mRNA Spanning the Attachment Site

32P-labeled mRNA was prepared from trpALD702 as described in Experimental Procedures. (a) Hybridization of trpC mRNA to MrpEDl I strand DNA. The orientation of nucleotide sequence in this figure is A’OP (the reverse of that in previous figures) so that promoter- proximal trpC sequences are on the left. The large arrows indicate sites of T, RNAase cleavage: the smaller arrows indicate sites of cleavage by pancreatic RNAase. Autoradiographs of two-dimensional T1 RNAase fingerprints of the trpC mRNA fragment after trimming with either (b) T, RNAase or (c) pancreatic RNAase. The disappearance of t29 in (c) verifies that some portion of its sequence is unhybridized, as predicted in (a). (d) Autoradiograph of a two-dimensional fingerprint of the products of partial digestion of oligonucleotide t29 with snake venom phosphodiesterase (see Experimental Procedures). The nucleotide which produced the observed first dimension mobility shift from each fragment to the next larger one is indicated next to the lines connecting the partial products. The sequence inferred from this fingerprint, . .UUUAUAAACAUUACG, coincides with the last 15 nucleotides predicted by the composite AOA’ DNA sequence, lacking only the 5’ terminal sequence CCA, which was found independently as a U, RNAase product of t29.

(see Figure 2), and this homology is not found in other secondary att sites (A. Landy, personal com- munication). There are one direct repeat and two inverted repeats roughly centered around the crossover region in trpC; these features are not shared with the primary bacterial attachment site. Unlike BOB’, the trpC site does not contain an extended region of high A + T composition. The absence of common features outside of the core in the bacterial sequence is consistent with a model in which the specific recognition elements for X integration reside in the two phage arms and the common core region. Such a model has been proposed on the basis of sequence data obtained from mutant phage att sites generated by int-de- pendent deletions (Hoess and Landy, 1978), which, like trpC, have a shorter uninterrupted homology to the core and no detectable homologies between the A and A’ arms and the analogous arms of attP or atti3. One direct prediction of this hypothesis is that the frequency of X integration at a given site on the E. coli chromosome should be a direct function of the degree of homology to the A core sequence. Shimada et al. (1975) calculated that if

the E. coli chromosome is considered a random DNA sequence, the observed number of secondary loci would predict that these recognition sites con- sist of 5-6 bp, and hence sequence analysis of additional secondary bacterial attachment sites should be most revealing.

The observed common core region in the primary att site is consistent with the predictions made for attachment site structure on the basis of genetic studies of att mutants (Shulman and Gottesman, 1973; Shulman et al., 1976). There has been much speculation, however, regarding the actual posi- tion at which the crossover occurs, and whether it proceeds by staggered (Kaiser and Wu, 1968) or flush (Dove, 1970) cuts in the DNA. A mechanism involving staggered cuts in the DNA predicts that secondary attachment sites must contain a region of uninterrupted homology with the phage attach- ment site, as in the case of trpC and the mutant A att deletion sites (Hoess and Landy, 1978). In the hga/KTE secondary attachment site (Bidwell and Landy, 1979), however, the homology is not contin- uous, and the precise crossover point in ga/T occurs outside of the 6 nucleotides in which cross-

Cell 412

over must have occurred during integration into trpC. These two contrasting examples rule out the possibility that there is a unique crossover point with the h core sequence. One model that could account for these observations involves formation of a heteroduplex intermediate by branch migra- tion (Lee, Davis and Davidson, 1970), as has been proposed for general recombination (Thompson, Camien and Warner, 1976). Once the strand ex- change has been initiated, it should be able to propagate through a region of homology or partial homology and could conceivably terminate either at a unique site different from the site of initiation of the exchange or at any of a number of sites within the homologous region. In the case of the gal7 site, imperfect homology in the heteroduplex might be resolved by mismatch repair, as dis- cussed in the accompanying paper (Bidwell and Landy, 1979). Such a mechanism would reconcile the segregration of att mutations observed by Shul- man and Gottesman (1973) with the apparent re- quirement for a flush cut observed by Bidwell and Landy (1979) in thegal site, and is consistent with the lack of a unique crossover point within the A core sequence.

An unexpected feature of this secondary trpC site is the occurrence of the 6 nucleotide homolo- gous sequence in two places, on opposite strands. If this homology to the A core is the only recogni- tion element in the bacterial sequence, A should integrate with equal efficiency at either site. This possibility is currently under investigation in our laboratory.

Experimental Procedures

Phage and Bacterial Strains AtrpCBA (Squires, Lee and Yanofsky, 1975) and htrpED7 (Rose et al., 1973) were derived from the trpC lysogen KS507 (Shimada et al., 1973); AtrpEDlO was independently isolated from the same lysogen. Plasmid pKB3 is a hybrid of pCR1 (8.7 md; Clarke and Carbon, 1975) and the 4.7 md Eco RI fragment containing the prophage attachment site from htrpEDl0. PVH153 is a mini-Co1 El derivative containing the same Eco RI fragment (Helinski et al., 1977). 48GtrpAE790 carries the entire tryptophan operon (Deeb, Okamoto and Hall, 1967). E. coli strain W3110trpALD702 carries a deletion of all but 25 nucleotides of the transcribed trp sequences proximal to trpC (Bronson, Squires and Yanofsky, 1973; G. Christie and T. Platt, unpublished results). All these strains were provided by C. Yanofsky.

Restriction Endonuclease Mapping and DNA Sequence Analysis Primary restriction endonuclease digests were treated with bac- terial alkaline phosphatase (from J. Chlebowski), and the DNA fragments were labeled at their 5’ termini using 3ZP-y-ATP (NEN; 3000 Ci/mmole) and T, polynucleotide kinase (PL Biochemicals). Following secondary digestion, the products were isolated by electrophoresis on polyacrylamide gels (either 3.5 or 10% BioRad acrylamide, 39:i acrylamide:bisacrylamide) in 50 mM Tris-borate (pH 8.3), 1 mM EDTA. Fragments were eluted by electrophoresis in 40 mM Tris-acetate (pH 8.5). Mapping was carried out by partial restriction endonuclease digestion of end-labeled frag-

ments (Smith and Birnstiel, 1976). DNA sequences were deter- mined using the chemical cleavage method of Maxam and Gilbert (1977). A fifth sequencing reaction, for cleavage at adenines (and cytosines with lesser frequency), was carried out by heating the sample in 1.5 N NaOH, 1 mM EDTA for 6 min at 9O”C, followed by standard treatment with 0.5 M piperidine. Restriction endonucle- ases Hpa II, Hint II, Hind Ill, Alu I, Taq I, Hinf I, Hae III and Barn HI were purchased from New England Biolabs. Hpa II was also obtained from N. Grindley, Taq I from R. Young and Hae III from S. Weissman.

TrpC mRNA Isolation 32P-labeled mRNA was prepared from E. coli W3110trpALD702 by a modification of the method of Squires et al. (1976) as described elsewhere (Wu and Platt, 1978). To obtain the trpC fragment spanning the attachment region, this mRNA was hybridized to AtrpEDl I strand DNA. Hybrids were trapped on nitrocellulose filters, and unhybridized mRNA was digested with either T, or pancreatic ribonuclease. The protected mRNA fragment was then eluted from the filters, purified and digested with T, ribonuclease as described by Platt and Yanofsky (1975). The resulting oligonu- cleotides were subjected to two-dimensional separation on PEI thin-layer plates as described by Squires et al. (1976). Oligonucle- otide t29 was eluted from the PEI plate in 30% triethylamine- carbonate (pH IO). The solvent was removed by evaporation, and the RNA was taken up in 50 mM Tris-HCI (pH 8.19), 10 mM MgCI,. The sample was divided into two portions and treated with bacterial alkaline phosphatase and either 0.2 or 0.02 mg/ml snake venom phosphodiesterase in a total reaction volume of 10 ~1. Both samples were incubated at 37°C. and aliquots were removed and pooled at 1, IO and 20 min. The total pooled sample was then subjected to two-dimensional separation as described above.

Acknowledgments

We are extremely grateful to Charles Yanofsky and Art Landy for strains and helpful advice. This work was supported by a grant to T. P. from the USPHS; G. E. C. was a predoctoral trainee on a USPHS grant.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received October 12,1978; revised November 16,1978

References

Bidwell, K. and Landy, A. (1979). Structural features of h site- specific recombination at a secondary att site in ga/T. Cell 76, 397-406.

Bronson, M. J., Squires, C. and Yanofsky, C. (1973). Nucleotide sequences from tryptophan messenger RNA of Escherichia co/i: the sequence corresponding to the amino-terminal region of the first polypeptide specified by the operon. Proc. Nat. Acad. Sci. USA 70, 2335-2339.

Brown, K. D., Bennett, G. N., Lee, F., Schweingruber, M. E. and Yanofsky, C. (1978). RNA polymerase interaction at the promoter operator region of the tryptophan operon of Escherichia co/i and Salmonella typhiumurium. J. Mol. Biol. 721, 153-177.

Campbell, A. M. (1962). Episomes. Adv. Genet. 11, 101-145.

Christie, G. E. (1978). Regulatory sequences in the tryptophan operon of Escherichia co/i: the trpD-trpC junction. Ph.D. thesis, Yale University, New Haven, Connecticut.

Clarke, L. and Carbon, J. (1975). Biochemical construction and selection of hybrid plasmids containing specific segments of the Escherichia co/i genome. Proc. Nat. Acad. Sci. USA 72, 4361- 4365.

Davis, R. W. and Parkinson, J. S. (1971). Deletion mutants of

A Secondary Lambda att Site in trpC 413

bacteriophage lambda III. Physical structure of attm. J. Mol. Biol. 56,403-423.

Deeb, S. S., Okamoto, K. and Hall, B. D. (1967). Isolation and characterization of non-defective transducing elements of bacte- riophage 680. Virology 31, 289-295.

Dove, W. (1970). An energy-level hypothesis for A prophage insertion and excision. J. Mol. Biol.47, 585-589.

Gottesman, M. E. and Weisberg, R. A. (1971). Prophage insertion and excision. In The Bacteriophage Lambda, A. D. Hershey, ed. (New York: Cold Spring Harbor Laboratory), pp. 113-138.

Guerrini, F. (1969). On the asymmetry of A integration sites. J. Mol. Biol. 46, 523-542.

Helinski, D. R., Hershfield, V., Figurski, D. and Meyer, Ft. J. (1977). Construction and properties of plasmid cloning vehicles. In Tenth Miles International Symposium: Impact of Recombinant Molecules in Science and Society, R. F. Beers and E. A. Bassett, eds. (New York: Raven Press), pp. 151-165.

Hoess, R. H. and Landy, A. (1978). Structure of the A attachment sites generated by int-dependent deletions. Proc. Nat. Acad. Sci. USA 75, 5437-5441.

Kaiser, A. P. and Wu, R. (1968). Structure and function of DNA cohesive ends. Cold Spring Harbor Symp. Quant. Biol. 33, 729- 734.

Kikuchi, Y. and Nash, H. A. (1978). Purification and properties of a protein involved in genetic recombination: the bacteriophage A int gene product. J. Biol. Chem.253, 7149-7157.

Landy, A. and Ross, W. (1977). Viral integration and excision: structure of the lambdaatt sites. Science 797, 1147-1160.

Lee, C. S., Davis, R. W. and Davidson, N. (1970). A physical study by electron microscopy of the terminally repetitious, circularly permuted DNA from the coliphage particles of Escherichia co/i 15. J. Mol. Biol. 48, l-22.

Maxam, A. M. and Gilbert, W. (1977). A new method for sequenc- ing DNA. Proc. Nat. Acad. Sci. USA 74, 560-564.

Miller, H. I. and Friedman, D. I. (1977). Isolation of Escherichia co/i mutants unable to support lambda integrative recombination. In Plasmids, DNA Insertion Elements, and Episomes, J. Shapiro, A. Bukhari and S. Adyha, eds. (New York: Cold Spring Harbor Laboratory), pp. 349-356.

Nash, H. A. (1974). AattB - attf, a A derivative containing both sites involved in integrative recombination. Virology57, 207-216.

Nash, H. A. (1977). Integration and excision of bacteriophage A. Curr. Topics Microbial. Immunol. 78, 171-199.

Platt, T. and Yanofsky, C. (1975). An intercistronic region and ribosome-binding site in bacterial messenger RNA. Proc. Nat. Acad. Sci USA 72, 2399-2403.

Rose, J. K., Squires, C. L., Yanofsky, C., Yang, H.-L. and Zubay, G. (1973). Regulation of in vitro transcription of the tryptophan operon by purified RNA polymerase in the presence of partially purified repressor and tryptophan. Nature New Biol. 245, 133- 137.

Shimada, K., Weisberg, R. A. and Gottesman, M. E. (1972). Prophage lambda at unusual chromosomal locations. I. Location of the secondary attachment sites and the properties of the lysogens. J. Mol. Biol. 63, 483-503.

Shimada, K., Weisberg, R. A. and Gottesman, M. E. (1973). Prophage lambda at unusual chromosomal locations. II. Muta- tions induced by bacteriophage lambda in Escherichia co/i K12. J. Mol. Biol. 80, 297-314.

Shimada, K., Weisberg, R. A. and Gottesman, M. E. (1975). Prophage lambda at unusual chromosomal locations. Ill. The components of the secondary attachment sites. J. Mol. Biol. 93, 415-429.

Shulman, M. and Gottesman, M. (1973). Attachment site mutants of bacteriophage lambda. J. Mol. Biol. 81, 461-482.

Shulman. M. J., Mizuuchi, K. and Gottesman, M. E. (1976). New att mutants of phage h. Virology 72, 13-22.

Smith, H. 0. and Birnstiel, M. L. (1976). Asimple method for DNA restriction site Mapping. Nucl. Acids Res. 3, 2387-2398.

Squires, C. L., Lee, F. D. and Yanofsky, C. (1975). Interaction of the trp repressor and RNA polymerase with thetrp operon. J. Mol. Biol. 92, 93-l 11.

Squires, C., Lee, F., Bertrand, K., Squires, C. L., Bronson, M. J. and Yanofsky, C. (1976). Nucleotide sequence of the 5’ end of tryptophan messenger RNA of E. co/i. J. Mol. Biol. 103, 351-381,

Thompson, B. J., Camien, M. N. and Warner, R. C. (1976). Kinetics of branch migration in double-stranded DNA. Proc. Nat. Acad. Sci. USA 73, 2299-2303.

Weisberg, R. A., Gottesman, S. and Gottesman, M. E. (1977). Bacteriophage A: the lysogenic pathway. In Comprehensive Virol- ogy, 8, H. Fraenkel-Conrat and R. Wagner, eds. (New York: Plenum Press), pp. 197-258.

Williams, J. G. K., Wulff, D. L. and Nash, H. A. (1977). A mutant of Escherichia co/i deficient in a host function required for phage lambda integration and excision. In Plasmids, DNA Insertion Elements, and Episomes, J. Shapiro, A. Bukhari and S. Adyha, eds. (New York: Cold Spring Harbor Laboratory), pp. 357-361.

Wu, A. M. and Platt, T. (1978). Transcription termination: nucleo- tide sequence at the 3’ end of the tryptophan operon in E. co/i. Proc. Nat. Acad. Sci. USA 75, 5442-5446.