Escherichia coli enoyl -acyl carrier protein reductase ( FabI ) … · 4 70 These include E. coli...

1

Escherichia coli enoyl-acyl carrier protein reductase (FabI) supports efficient 1

operation of a functional reversal of the β-oxidation cycle 2

3

Jacob E. Vicka, James M. Clomburg

a, Matthew D. Blankschien

a,*, Alexander Chou

a, Seohyoung 4

Kima, and Ramon Gonzalez

a,b,# 5

6

a Department of Chemical and Biomolecular Engineering, Rice University, Houston, TX, USA 7

b Department of Bioengineering, Rice University, Houston, TX, USA 8

9

J.E.V. and J.M.C. contributed equally to this work

10

* Current Address: BASF Corporation, 500 White Plains Rd, Tarrytown, NY, 10591, USA

11

12

# To whom correspondence should be addressed: 13

Department of Chemical and Biomolecular Engineering, 14

Rice University, 6100 Main Street, MS-362, 15

Houston, TX 77005, USA. 16

Phone: (713)-348-4893, Fax: (713) 348-5478 17

email: [email protected] 18

19

Running Title: FabI supports a functional reversal of the β-oxidation cycle 20

21

Keywords: β-oxidation reversal; enoyl-acyl carrier protein reductases; metabolic engineering; 22

synthetic biology; fuels and chemicals23

AEM Accepts, published online ahead of print on 19 December 2014Appl. Environ. Microbiol. doi:10.1128/AEM.03521-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on January 21, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

2

ABSTRACT 24

We recently used a synthetic/bottom-up approach to establish the identity of the four 25

enzymes composing an engineered functional reversal of the β-oxidation cycle for fuel and 26

chemical production in Escherichia coli (Clomburg et al. 2012. ACS Synth. Biol. 1:541-554). 27

While native enzymes that catalyze the first three steps of the pathway were identified, the 28

identity of the native enzyme(s) acting as the trans-enoyl-CoA reductase(s) remained unknown, 29

limiting the amount of product synthesized (e.g. 0.34 g/L butyrate) and requiring the 30

overexpression of a foreign enzyme (Euglena gracilis trans-enoyl-CoA reductase (TER)) to 31

achieve high titers (e.g. 3.4 g/L butyrate). Here we examine several native E. coli enzymes 32

hypothesized to catalyze the reduction of enoyl-CoAs to acyl-CoAs. Our findings indicate that 33

FabI, the native enoyl-acyl carrier protein (enoyl-ACP) reductase (ENR) from type II fatty acid 34

biosynthesis, possesses sufficient NADH-dependent TER activity to support the efficient 35

operation of a β-oxidation reversal. Overexpression of FabI proved as effective as egTER for the 36

production of butyrate and longer-chain carboxylic acids. In order to further demonstrate the role 37

of FabI during a -oxidation reversal, we investigated whether bacterial ENRs from other 38

families were able to complement a fabI deletion without promiscuous reduction of crotonyl-39

CoA. These characteristics from Bacillus subtilis FabL enabled ΔfabI complementation 40

experiments that conclusively established that FabI encodes the native enoyl-CoA reductase 41

activity that supports the β-oxidation reversal in E. coli. 42

43

44

45

46


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3

INTRODUCTION 47

Recent advancements in synthetic biology and enzyme and metabolic engineering (1, 2) 48

are allowing for the development of an ever expanding array of microbial hosts for the 49

production of advanced fuels and industrially relevant chemicals (3, 4). Most efforts are now 50

focused on moving past the historically successful biofuels and industrial products, such as 51

ethanol (5), towards ‘drop-in’ fuels and additives that can be seamlessly incorporated into 52

existing infrastructure (4). The production of such molecules requires the synthesis of higher 53

chain length (C ≥ 4) products from 1-, 2- or 3-carbon metabolic intermediates and hence 54

pathways that can mediate the formation of carbon-carbon bonds. A variety of native and 55

engineered pathways have been utilized for this purpose, including the Clostridial n-butanol 56

pathway (6) isoprenoid biosynthesis (7, 8), the α-ketoacids pathway (9, 10) and fatty acid 57

biosynthesis (11, 12). 58

Among the aforementioned pathways, the bacterial type II fatty acid biosynthesis system 59

(FAB II) (13) is probably the most widely engineered and has been harnessed for the synthesis of 60

many products, including fatty acids (14), fatty acid methyl esters (15), fatty acid ethyl esters 61

(11, 16), fatty alcohols (11), and alkanes (12). At the core of the FAB II system is an elongation 62

cycle that uses discrete enzymes to catalyze each of its four steps. The cycle is initiated by the 63

condensation of malonyl-acyl carrier protein (ACP) with acyl-ACP, catalyzed by a 3-ketoacyl-64

ACP synthase. The resulting 3-ketoester is dehydrogenated by a 3-ketoacyl-ACP reductase 65

followed by the dehydration of the resulting 3-D-hydroxyacyl-ACP to trans-2-enoylacyl-ACP. 66

The enzymes catalyzing these three steps are relatively conserved among bacteria. However, at 67

least four different enoyl-ACP reductase (ENR) bacterial families (FabI, FabL, FabV, and FabK) 68

catalyze the last step of the cycle in which the trans-2-enoyl-ACP is reduced to an acyl-ACP. 69


.asm.org/

Dow

nloaded from

http://aem.asm.org/

4

These include E. coli FabI, Bacillus subtilis FabL, Vibrio cholerae FabV, and Enterococcus 70

faecalis FabK (17-20). Each elongation round uses malonyl-ACP as extender unit, and hence 71

requires the ATP dependent conversion of acetyl-CoA to malonyl-CoA. 72

As the FAB II system described above, the recently engineered functional reversal of the 73

β-oxidation cycle is based on an elongation cycle that includes condensation, dehydrogenation, 74

dehydration, and reduction steps (Fig. 1) (21, 22). However, the β-oxidation reversal operates 75

with coenzyme A (CoA) intermediates and directly uses acetyl-CoA for acyl-CoA chain 76

elongation through a non-decarboxylating condensation mechanism, characteristics that support 77

product synthesis at maximum carbon and energy efficiency. While the original implementation 78

of the -oxidation reversal required complex modifications to the regulatory network of the 79

metabolism of fatty acids and other global regulators (22), recent efforts have been successful in 80

using a synthetic approach to manipulate individual and defined components of the pathway 81

(21). This latter study was able to identify native enzymes that catalyze the first three steps of 82

the pathway (i.e. thiolases (AtoB and FadA), 3-hydroxyacyl-CoA dehydrogenase (FadB), and 83

enoyl-CoA hydratase (FadB)) whose overexpression lead to butyrate synthesis. However, the 84

identity of the native enzyme responsible for the reduction of enoyl-CoAs remained unknown 85

and improved product yields were only achieved when a foreign trans-enoyl-CoA reductase 86

(TER) was utilized, a family of enzymes not native to E. coli. The studies reported in this 87

manuscript examine several native E. coli enzymes that have the potential to catalyze the 88

reduction of enoyl-CoAs to acyl-CoAs and establish that FabI, the native ENR from FAB II, 89

encodes an NADH-dependent TER-like activity at levels that support the efficient operation of a 90

functional β-oxidation reversal. 91

92


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5

MATERIALS AND METHODS 93

Strains, plasmids, and genetic methods. Genomic DNA from Enterococcus faecalis V583 94

(ATCC 700802), Bacillus subtilis (Ehrenberg) Cohn (ATCC 23857), and Vibrio cholerae 95

N16961 (ATCC 39315), and Megasphaera elsdenii Rogosa strain were acquired from ATCC 96

(Manassas, Virginia). Escherichia coli genomic DNA from MG1655 (23) and M. elsdenii 97

Rogosa were purified using the Wizard Genomic DNA Purification Kit (Promega, Madison, 98

WI). E. gracilis TER was amplified from a plasmid harboring a codon-optimized egTER 99

synthesized by GenScript (Piscataway, NJ). All restriction enzymes were purchased from New 100

England Biolabs (Ipswich, MA). Plates were prepared using LB medium containing 1.5% agar, 101

and appropriate antibiotics were included at the following concentrations when required: 102

ampicillin (100 µg/mL), kanamycin (50 µg/mL), spectinomycin (50 µg/mL), chloramphenicol 103

(12.5 µg/mL chromosomal/ 34 µg/mL plasmids) and zeocin (25-50 µg/mL). 104

Gene overexpression was achieved by cloning the desired gene(s) into either pETDuet-1 105

or pCDFDuet-1 (Novagen, Darmstadt, Germany) digested with NcoI and EcoRI restriction 106

enzymes utilizing In-Fusion PCR cloning technology (Clontech Laboratories, Inc., Mountain 107

View, CA). Cloning inserts were created via PCR of ORFs of interest from their respective 108

genomic or codon-optimized DNA (primers listed in Table 2) with Phusion DNA polymerase 109

(Thermo Scientific, Waltham, MA). The resulting In-Fusion products were used to transform E. 110

coli Stellar cells (Clontech Laboratories, Inc., Mountain View, CA) and PCR identified clones 111

were confirmed by DNA sequencing. All resulting plasmids used in this study are listed in Table 112

1. 113

Strain JC01 (MG1655 ldhA poxB pta adhE frdA) (21), a derivative of wild-type 114

K12 Escherichia coli strain MG1655, was used as the host for all genetic modifications. 115


.asm.org/

Dow

nloaded from

http://aem.asm.org/

6

JC01(DE3) was constructed from JC01 using a λDE3 Lysogenization Kit (Novagen, Darmstadt, 116

Germany) to allow the expression of genes under the T7 lac promoter. Gene knockouts were 117

introduced in JC01(DE3) and its derivatives by P1 phage transduction (24, 25). Single gene 118

knockout mutants from the National BioResource Project (NIG, Japan) (26) were used as donors 119

of specific mutations with the exception of fabI. ΔfabI was first constructed in strain HME45 120

(27) harboring pCA24N-fabI from the ASKA collection (28) and 10 µM Isopropyl β-D-1-121

thiogalactopyranoside (IPTG) to ensure expression of FabI from the vector. FRT-Kan-FRT with 122

homology to FabI was amplified from the pKD4 plasmid (29) and transformed into HME45 123

[pCA24N-fabI] selecting on kanamycin or chloramphenicol plates with 10 µM IPTG for gene 124

expression. The resulting HME45 ΔfabI::FRT-Kan-FRT [pCA24N-fabI] was then used for P1 125

phage transduction to produce ΔfabI strains. All mutations were confirmed by polymerase chain 126

reaction and the disruption of multiple genes in a common host was achieved as previously 127

described (25). All resulting strains used in this study are listed in Table 1. 128

Strain JC01(DE3) was further modified to allow for cumate inducible control (30) from 129

the genome. To enable this, the construction of pUCBB-pCT5-ntH6-eGFP (Sequence and Map 130

in Supplementary Figure S1 and Table S1) was first completed based on previous BioBrickTM

131

vector designs (31). E. coli atoB and fadB genes were PCR amplified and digested with BglII 132

and NotI and ligated by T4 ligase (Invitrogen, Carlsbad, CA) into pUCBB-PCT5

-ntH6-eGFP that 133

was previously digested with BglII and NotI to produce pUCBB- PCT5

-atoB and pUCBB- PCT5

-134

fadB. The resulting ligation products were used to transform E. coli DH5α (Invitrogen, 135

Carlsbad, CA) and positive clones identified by PCR were confirmed by DNA sequencing. To 136

integrate the cumate-controlled atoB and fadB constructs onto the chromosome, first the cumate 137

repressor (cymR), promoter/operator regions (PCT5

), and respective ORFs were PCR amplified, 138


.asm.org/

Dow

nloaded from

http://aem.asm.org/

7

as well as kanamycin or chloramphenicol drug constructs (respectively via pKD4 and pKD3 139

(29)). These respective products were linked together via overlap extension PCR to create a final 140

chromosomal targeting construct. Integration of the cumate-controlled constructs was achieved 141

via standard recombineering protocols using strain HME45 and selecting on respective LB drug 142

plates (32). The fadA gene was separately deleted via recombineering in the HME45 derivative 143

harboring the cumate-controlled fadBA construct by replacement of the fadA ORF with a zeocin-144

resistance marker amplified from pKDzeo (33). All constructs were verified via PCR and 145

sequencing. All construction primers are listed in Table 2. 146

147

Culture medium and cultivation conditions. The medium designed by Neidhardt et al. (34), 148

with 125 mM MOPS and Na2HPO4 in place of K2HPO4, supplemented with 20 g/L glycerol, 10 149

g/L tryptone, 5 g/L yeast extract, 100 µM FeSO4, 5 mM calcium pantothenate, 1.48 mM 150

Na2HPO4, 5 mM (NH4)2SO4, and 30 mM NH4Cl was used for all fermentations. Antibiotics (50 151

µg/mL carbenicillin and 50 µg/mL spectinomycin) and inducers (5 µM Isopropyl β-D-1-152

thiogalactopyranoside and 0.1 mM cumate) were included when appropriate. All chemicals were 153

obtained from Fisher Scientific Co. (Pittsburg, PA) and Sigma-Aldrich Co. (St. Louis, MO). 154

Fermentations were conducted under microaerobic conditions similar to those used in 155

previous studies (21, 22, 35). 25 mL Pyrex Erlenmeyer flasks (narrow mouth/heavy duty rim, 156

Corning Inc., Corning, NY) were filled with 20 mL of the above culture medium and sealed with 157

foam plugs filling the necks. A single colony of the desired strain was cultivated overnight (14-158

16 hrs) in LB medium with appropriate antibiotics and used as the inoculum (1%) for all 159

fermentations. After inoculation, flasks were incubated at 37°C and 200 rpm in an NBS C24 160

Benchtop Incubator Shaker (New Brunswick Scientific Co., Inc., Edison, NJ) until an optical 161


.asm.org/

Dow

nloaded from

http://aem.asm.org/

8

density of ~0.3-0.5 was reached, at which point IPTG and cumate were added. Flasks were then 162

incubated under the same conditions for 48 hrs post-induction unless otherwise stated. 163

164

Enzymatic characterization and assays. For measurement of enzymatic activities from 165

fermentation samples, cells were disrupted using glass beads as previously reported (22). HIS 166

Tagged FabI protein was harvested from BL21(DE3) cells (New England Biolabs, Ipswitch, 167

MA) containing pCA24N-fabI, induced with 0.1 mM IPTG at an OD600nm ~0.4 and grown 168

overnight at room temperature in LB medium. Purification was conducted as previously reported 169

using Talon Metal Affinity Resin (Clontech Laboratories, Inc., Mountain View, CA) (21). 170

For AtoB and FadB, thiolase activity and β-hydroxybutyryl-CoA dehydrogenase activity 171

were monitored as previously described (21). Trans-enoyl-CoA reductase activity for egTER, 172

FabI, bsFabL, efFabK and vcFabV was monitored by loss of NADH at 340 nm as previously 173

described (21, 36). For the kinetic characterization of FabI, crotonyl-CoA concentrations 174

ranging from 100 to 7500 µM were utilized. Acyl-CoA dehydrogenase activity was monitored 175

by measuring the reduction of Methyl-thiazolyl blue (MTT) coupled to the oxidation of butyryl-176

CoA (37) in cellular extracts disrupted as above with the addition of 5 µM flavin adenine 177

dinucleotide (FAD). Reaction conditions were as follows: 25 mM Tris pH 7.5, 240 µM MTT, 1.7 178

mM phenazine methosulfate (PMS), 15 mM sodium cyanide, and 250 µM butyryl-CoA in a final 179

volume of 200 µL at 30 °C. All substrates and chemicals for enzyme assays were obtained from 180

Fisher Scientific Co. (Pittsburg, PA) and Sigma-Aldrich Co. (St. Louis, MO). 181

182

Analytical methods. Determination of cell growth, quantification of glycerol and metabolic 183

products by high-performance liquid chromatography (HPLC), quantification of carboxylic acids 184


.asm.org/

Dow

nloaded from

http://aem.asm.org/

9

by HPLC (C4, C5, C6) and Gas Chromatography-Flame Ionization Detection (GC-FID) (C7-185

C14) were performed as previously described (21). For quantification purposes of odd-chain 186

carboxylic acids, samples were run with and without the C13 carboxylic acid internal standard, 187

verifying that C13 was not produced. Propionic (C3:0), valeric (C5:0), enanthic (C7:0), pelargonic 188

(C9:0) and undecyclic (C11:0) acid (Sigma Chemical Co., St. Louis, MO) standards were used to 189

calibrate HPLC and GC-FID analysis. 190

High performance liquid chromatography-mass spectrometry (HPLC-MS) was performed 191

on a Bruker MicroTOP ESI (Fremont, CA) with an Agilent 1200 HPLC System (Santa Clara, 192

CA). Enzymatic reactions were quenched with 10 % of 1N HCl and diluted 10 fold with dH2O, 2 193

µL of which was used for injection. HPLC-MS assays were performed using a Shimadzu Shim-194

pack XR-ODS II column (2.0 mm I,d. x 75 mm) (Tokyo, Japan) at a flow rate of 0.15 mL/min 195

with a maximum pressure of 380 bar at room temperature. Liquid chromatography was 196

performed with 40 mM ammonium acetate (Buffer A) and methanol (Buffer B). The time course 197

was as follows: 0 min – 2.5% methanol, linear gradient to 70% methanol at 7 min, hold at 70% 198

methanol to 12 min, linear gradient to 2.5% methanol at 12.1 min, hold at 2.5% methanol to 24 199

min. 200

201

RESULTS 202

Chromosomal overexpression of the first three steps of the β-oxidation reversal: thiolase, 3-203

hydroxyacyl-CoA dehydrogenase and enoyl-CoA dehydratase. Previously, the identification 204

and overexpression of native thiolase (AtoB) and 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA 205

hydratase (FadB) components resulted in the ability to produce small amounts of butyrate 206

through a one-turn -oxidation reversal (21). In order to establish a clean, vector-free platform 207


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10

to identify the unknown native enzyme(s) that catalyze the final step of the -oxidation reversal, 208

we constructed a strain with tunable chromosomal expression of AtoB and FadB by engineering 209

their native chromosomal loci. Using an in-house developed expression system based on a 210

cumate-inducible promoter (30) adapted into a BioBrick vector system (31) (Supplemental 211

Information Figure S1, Table S1), genomic expression of the atoB and fadBA operons was 212

altered to be cumate-controlled. Both native promoters were replaced by the T5 promoter 213

controlled by the CymR operator (CT5) and an upstream constitutive expression system for 214

CymR. Prior to these modifications, strain JC01 was modified to include the DE3 cassette to 215

allow the use of Novagen’s Duet vector system for the expression of candidate enzymes. The 216

resulting strain will be referred to throughout the manuscript as JC01(DE3) atoBCT5

fadBACT5

. A 217

second strain, JC01(DE3) atoBCT5

fadBCT5

ΔfadA, was created by deleting fadA from the fadBA 218

operon. Since fadA encodes a long-chain thiolase, its deletion prevented operation of multiple 219

turns of the -oxidation reversal. This, in turn, enabled the use of butyrate production as proxy 220

for flux through a single turn reversal of the β-oxidation cycle in strain JC01(DE3) atoBCT5

221

fadBCT5

ΔfadA, facilitating the identification of native enzyme(s) responsible for the reduction of 222

crotonyl-CoA. 223

In order to verify that chromosomal expression of the thiolase (AtoB), 3-hydroxyacyl-224

CoA dehydrogenase (FadB), and enoyl-CoA dehydratase (FadB) supports product synthesis 225

from a β-oxidation reversal, enzyme activities and fermentation profiles of JC01(DE3) atoBCT5

226

fadBCT5

ΔfadA were compared to those of the vector-based expression system in strain 227

JC01(DE3) [pETDuet-atoB pCDFDuet-fadB]. The chromosomal expression strain produced 228

more butyrate (0.63 ± 0.01 g/L) and 3-hydroxybutyrate (4.33 ± 0.04 g/L) than the vector based 229

system (butyrate = 0.42 ± 0.03 g/L, 3-hydroxybutyrate = 3.23 ±0.07 g/L) (data not shown). The 230


.asm.org/

Dow

nloaded from

http://aem.asm.org/

11

chromosomal strain had similar 3-hydroxybutyryl-CoA dehydrogenase activity (2.2 ± 0.7 231

µmol/mg/min) to that of pCDFDuet-fadB (1.7 ± 0.7 µmol/mg/min) while thiolase activity was 232

greater from pETDuet-atoB (25.0 ± 3.2 µmol/mg/min) in comparison to atoB expression from 233

the chromosome (3.8 ± 0.3 µmol/mg/min). The higher product yield from JC01(DE3) atoBCT5

234

fadBCT5

ΔfadA indicates that adequate amounts of thiolase and 3-hydroxybutryl-CoA 235

dehydrogenase activities are produced by chromosomal expression. 236

237

Identification of native enzyme(s) responsible for conversion of crotonyl-CoA to butyryl-238

CoA in strain JC01(DE3) atoBCT5

fadBCT5

fadA. Multiple enzymes in E. coli have the 239

potential to reduce a 2,3-trans-enoyl-CoA (e.g. crotonyl-CoA) to the corresponding acyl-CoA 240

(e.g. butyryl-CoA). These include two acyl-CoA dehydrogenases (ACDH) from β-oxidation 241

pathways, FadE and YdiO. FadE is the aerobic ACDH (37, 38) while YdiO appears to be a 242

member of a butyryl-CoA dehydrogenase (BCD) electron transfer protein (Etf) complex 243

(BCD/EtfBA) necessary for growth on fatty acids under anaerobic conditions (39). Two other 244

ACDHs could reduce crotonyl-CoA as a promiscuous substrate; the crotonobetaine reductase 245

complex CaiAB (40, 41) and AidB, the isovaleryl-CoA dehydrogenase (42, 43). 246

The genes encoding the aforementioned ACDHs were deleted and overexpressed in strain 247

JC01(DE3) atoBCT5

fadBCT5

ΔfadA and their effect on butyrate production assessed. The 248

deletions had little impact on either butyrate or 3-hydroxybutyrate production levels and did not 249

impair growth (Fig. 2). The only ACDH over-expression that affected butyrate yield was FadE, 250

which resulted in a 44% increase in comparison to a control with the pETDuet vector alone (Fig. 251

2). Similarly, only the overexpression of FadE resulted in a change in measurable 252

dehydrogenase activity on butyryl-CoA with a specific activity of 0.019 ± 0.0017 µmol/mg/min, 253


.asm.org/

Dow

nloaded from

http://aem.asm.org/

12

which is an order of magnitude greater than any other tested (Table 3). Since deletion or 254

overexpression of ACDHs did not result in significant changes to butyrate levels when combined 255

with AtoB and FadB overexpression, alternative candidates for enzymes catalyzing the 256

conversion of crotonyl-CoA to butyryl-CoA were explored. 257

Given its reported ability to reduce crotonyl-CoA to butyryl-CoA, FabI, the essential 258

enoyl-ACP reductase (ENR) from the fatty acid biosynthesis pathway (44-46) was investigated. 259

When crude extracts from JC01(DE3) atoBCT5

fadBCT5

ΔfadA were assayed for NAD(P)H-260

dependent reduction of crotonyl-CoA, no detectable activity was measured (Table 3). This is not 261

necessarily an unexpected result, as FabI only reduces crotonyl-CoA as a promiscuous substrate 262

with a reported KM (2.7 mM) (17), which is roughly 30-fold higher than the concentration of 263

crotonyl-CoA (80 µM) used in the standard trans-enoyl-CoA reductase assay (21, 36). In assays 264

using 1 mM crotonyl-CoA, NADH-dependent crotonyl-CoA reduction activities of 0.100 ± 265

0.001 µmol/mg/min and 0.080 ± 0.007 µmol/mg/min were observed in crude cell extracts from 266

fermentation samples of JC01(DE3) atoBCT5

fadBCT5

ΔfadA harvested at 8 and 48 hours, 267

respectively (Table 3). These results suggested potential involvement of an NADH-dependent 268

TER-like enzyme in butyrate production from a one-turn reversal of the -oxidation cycle, which 269

based on previous studies, could be encoded by fabI. 270

To further investigate the potential role of FabI, vectors containing fabI or egTER were 271

constructed and transformed into JC01(DE3) atoBCT5

fadBCT5

ΔfadA to assess butyrate 272

production from a one-turn -oxidation reversal. As seen in Fig. 2, FabI over-expression resulted 273

in significant increase in butyrate production compared to that with only AtoB and FadB 274

expression. Even more surprising, the overexpression of FabI resulted in butyrate production at 275

levels comparable to egTER overexpression (3.66 g/L and 3.64 g/L, respectively), while also 276


.asm.org/

Dow

nloaded from

http://aem.asm.org/

13

showing similar reduction in 3-hydroxybutyrate levels (to 0.9 and 0.5 g/L respectively) (Fig. 2). 277

When comparing the trans-enoyl-CoA reductase activities of these fermentations samples (using 278

the standard 80 µM crotonyl-CoA), fabI-overexpressing cultures showed an activity which is six 279

times lower than the activity observed upon egTER-overexpression (Table 3). Despite these 280

lower levels of activity, the comparable levels of butyrate production with either fabI or egTER 281

overexpression demonstrates the potential of an enoyl-ACP reductase from the type II fatty acid 282

biosynthesis pathway to function with CoA intermediates in the context of a reversal of the -283

oxidation cycle. 284

In order to provide further evidence that promiscuous crotonyl-CoA reduction by FabI is 285

involved in a native -oxidation reversal, fabI deletion is required. Given the essential nature of 286

FabI (this enzyme is the only ENR in E. coli), construction of a ΔfabI strain requires 287

complementation with another trans-enoyl-ACP activity. Moreover, to verify the hypothesis that 288

FabI indeed functions as the enoyl-CoA reductase of the -oxidation reversal, the 289

complementing enoyl-ACP reductase should not promiscuously reduce crotonyl-CoA as well. 290

Since no enoyl-ACP reductase has been reported with these explicit characteristics, we 291

investigated the following representative members of bacterial ENR families for their lack of 292

crotonyl-CoA reductase activity: Bacillus subtilis FabL (bsFabL) (19), Enterococcus faecalis 293

FabK (efFabK) (18, 47), and Vibrio cholerae FabV (vcFabV) (20). 294

Genes encoding each of the aforementioned ENRs were cloned into pETDuet and the 295

resulting vectors transformed into JC01(DE3) atoBCT5

fadBCT5

ΔfadA, and the resulting strains 296

assayed for crotonyl-CoA reductase activity using 80 µM crotonyl-CoA. While detectable 297

activity was measured for cells with efFabK or vcFabV, no activity was detected for the cells 298

overexpressing bsFabL (Table 3). Even when assayed with 1 mM crotonyl-CoA, the levels of 299


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14

crotonyl-CoA reductase activity shown by cell extracts of JC01(DE3) atoBCT5

fadBCT5

ΔfadA 300

ΔfabI [pETDuet-bsfabL] are similar to the background levels measured for JC01(DE3) atoBCT5

301

fadBCT5

ΔfadA [pETDuet], making bsfabL an ideal candidate to complement a fabI deletion 302

without also providing the ability to promiscuously reduce crotonyl-CoA. As such, JC01(DE3) 303

atoBCT5

fadBCT5

ΔfadA ΔfabI strains were constructed in the presence of either pETDuet-fabI or 304

pETDuet-bsfabL. These vectors complemented the fabI deletion equally well, as evidenced by 305

the isolation of viable transductions as well as the similar growth of both strains during 306

fermentations (Fig. 2). However, significant differences in butyrate production (Fig. 2) and 307

enoyl-CoA reductase activity (Table 3) were observed between the two strains. JC01(DE3) 308

atoBCT5

fadBCT5

ΔfadA ΔfabI [pETDuet-fabI] still produced large amounts of butyrate and 309

exhibited enoyl-CoA reductase activity, characteristics not observed with JC01(DE3) atoBCT5

310

fadBCT5

ΔfadA ΔfabI [pETDuet-bsfabL]. These results strongly support the hypothesis that FabI 311

is the unknown enzyme responsible for enoyl-CoA reduction in the experiments discussed above 312

and as such could also have played a role in product synthesis through previously engineered -313

oxidation reversal in E. coli (21, 22). 314

315

Kinetic characterization of FabI-encoded trans-enoyl-CoA reductase. The low catalytic 316

efficiency reported for FabI on crotonyl-CoA (kcat/KM = 8.52 x 101 M

-1 s

-1) is not only several 317

orders of magnitude lower than that reported with crotonyl-ACP (kcat/KM = 1.91 x 106

M-1

s-1

) 318

(17), but also contrasts with our observation that this enzyme supports butyrate synthesis fluxes 319

as high as those supported by egTER, an enzyme with a high catalytic efficiency on crotonyl-320

CoA (kcat/KM = 1.2 ± 0.1 M4 sec

-1) (21). A comparison of crotonyl-CoA reduction activity 321

observed in crude extracts of our cultures to the expected activity based on reported FabI kinetic 322


.asm.org/

Dow

nloaded from

http://aem.asm.org/

15

parameters (17) revealed an interesting picture. For example, after 8 hours of cultivation, strain 323

JC01(DE3) atoBCT5

fadBCT5

ΔfadA exhibited an NADH-dependent crotonyl-CoA reduction 324

activity (with 1 mM crotonyl-CoA) of 0.100 ± 0.001 µmol/mg/min, which corresponds to an 325

observed rate of 4.88 x 10-8

M s-1

. The total protein concentration of the same culture was 2.94 326

mg/mL, from which the concentration of FabI is estimated to be between 6.83 x 10-8

M and 6.83 327

x 10-12

M (48). Considering this concentration of FabI in the crude protein extract, the reported 328

kcat (0.23 s-1

) and KM (2.7 mM) (17), and the 1 mM crotonyl-CoA concentration utilized in the 329

measurement of the specific activities, the expected rate of crotonyl-CoA reduction by FabI in 330

the crude protein extract was calculated to be between 7.86 x 10-13

M s-1

and 7.86 x 10-9

M s-1

. 331

These calculations indicate that the expected rate obtained from reported kinetic parameters is 332

only a very small fraction of the rate observed in our cultures, which warrants re-evaluation of 333

the kinetic parameters of FabI using crotonyl-CoA as the substrate. 334

N-terminal His-tagged FabI was purified from BL21(DE3) containing an ASKA 335

collection vector expressing fabI (29). The purified enzyme had a KM (4.6 ± 0.6 mM) quite 336

similar to the reported KM of 2.7 mM (17), but our measurement of kcat was 5.3 ± 0.6 s-1

in 337

comparison to the previously reported 0.23 s-1

, resulting in a 13-fold improvement of catalytic 338

efficiency (kcat/KM) from 8.52 x 101 M

-1 s

-1 to 1.15 x 10

3. This change in kcat increases the 339

expected rate of crotonyl-CoA reduction by FabI to a value between 1.02 x 10-7

M s-1

and 7.86 x 340

10-11

M s-1

, which is in agreement with the rate observed in our cultures. 341

To verify that FabI is utilizing NADH to convert crotonyl-CoA to butyryl-CoA, the 342

reaction was monitored via HPLC-MS, which confirmed that FabI converts crotonyl-CoA almost 343

completely to butyryl-CoA (Fig. 3A). Factors such as the presence of Mg2+

during our 344

purification as well as Tris-HCl vs. phosphate based buffer systems had marginal effect on 345


.asm.org/

Dow

nloaded from

http://aem.asm.org/

16

activity levels (data not shown). The most likely cause for the discrepancy in measured kcat is that 346

previous studies (17) used a maximum of approximately 1.25 mM crotonyl-CoA, which is less 347

than their reported KM indicating that there was not an accurate estimation of Vmax during their 348

measurements. 349

As an essential gene for fatty acid biosynthesis, FabI is inhibited when large amounts of 350

palmitic acid (C16) are present (Ki of 5.4 µM towards palmitoyl-ACP and 20 µM towards 351

palmitoyl-CoA), but this inhibition is quickly lost for shorter fatty acids as the Ki for decanoyl-352

CoA is approximately 900 µM (45). In order to understand the potential of utilizing FabI for a 353

functional reversal of β-oxidation in E. coli, we examined the effect of key CoA thioester 354

intermediates of the -oxidation reversal as well as a broad range of acyl-CoAs on FabI activity 355

(Fig. 3C). As expected, palmitoyl-CoA demonstrated close to 50% inhibition at 20 µM, while 356

myristoyl-CoA (C14) had the highest percent inhibition at 200 µM. The shorter-chain and -357

functionalized acyl-CoAs thioesters, acetoacetyl-CoA and 3-hydroxybutyryl-CoA demonstrated 358

minimal inhibitory effects. The pH range for FabI activity was also examined for comparison to 359

the reported profile for crotonyl-ACP (46) (Fig. 3B). Using crotonyl-CoA, FabI shows activity 360

over a broad range of pH (4.75 to 9.5). This range is not dissimilar to the reported pH range with 361

crotonyl-ACP, although the optimal pH switched to pH 8.5 and the enzyme remained active at 362

higher pHs. 363

364

FabI supports the synthesis of longer-chain (C>4) carboxylic acids. As previously 365

mentioned, employing AtoB as the thiolase in the -oxidation reversal limits the operation of the 366

pathway to one cycle and product synthesis to 4-C molecules. By including FadA, which has 367

longer chain length specificity, the production of longer chain products is possible. When fabI is 368


.asm.org/

Dow

nloaded from

http://aem.asm.org/

17

overexpressed from pETDuet in JC01(DE3) atoBCT5

fadBACT5

, the production of extracellular 369

longer chain length carboxylic acids is observed (Fig. 4A). The most abundant longer chain 370

produced is C6 (0.53 ± 0.03 g/L), while C8, C10 and C12 carboxylic acids are produced at 57.8 371

± 4.7, 56.8 ± 4.4 and 11.5 ± 0.3 mg/L, respectively (Fig. 4A). 372

The deletion of fadD, encoding an acyl-CoA synthetase, has been utilized in numerous 373

studies to facilitate the accumulation of longer chain carboxylic acids by preventing the 374

uptake/activation of free fatty acids (14). Under these conditions, the deletion of fadD in 375

JC01(DE3) atoBCT5

fadBACT5

with pETDuet-fabI resulted in the extracellular production of 19.4 376

± 0.1 mg/L tetradecanoic acid (C14) and a slight increase in dodecanoic acid (C12), with 377

minimal impact on the levels of C4-C10 carboxylic acids produced (Fig. 4A). In order to alter 378

the product profile away from C4 and C6 carboxylic acids, yciA, encoding a thioesterase 379

previously shown to have a marked effect on short chain product profiles (21), was also deleted. 380

This resulted in significant increases to C8 (97.4 ± 1.9 mg/L) and C10 (102.5 ± 8.0 mg/L) 381

carboxylic acids while greatly reducing the amount of butyrate (0.47 ± 0.01 g/L) (Fig. 4A). 382

In order to investigate the potential for FabI to be used in the production odd-chain 383

carboxylic acids, strain JC01(DE3) atoBCT5

fadBACT5

ΔfadD ΔyciA was further complemented 384

with the propionate CoA transferase (PCT) from M. elsdenii (49), which has been used to 385

successfully produce a variety of C5 carboxylic acid molecules (50). mePCT was cloned into the 386

pCDFDuet vector to facilitate co-expression with pETDuet-fabI. JC01 (DE3) atoBCT5

fadBACT5

387

ΔfadD ΔyciA was co-transformed with these two vectors to determine odd chain carboxylic acid 388

production in the presence of 15 mM propionate. This strain produced odd chain carboxylic 389

acids ranging from 187 ± 4 mg/L of valerate (C5) to a maximum chain length of C11 at 30.9 ± 390

0.6 mg/L (Fig. 4B). 391


.asm.org/

Dow

nloaded from

http://aem.asm.org/

18

392

FabI enables product synthesis via a functional reversal of the β-oxidation cycle not the 393

type II fatty acid biosynthesis pathway. Considering the use of an enzyme from the type II 394

fatty acid biosynthesis pathway, it stands to reason that product synthesis (e.g. butyrate and other 395

products) could proceed through this pathway, instead of a -oxidation reversal. Fortunately, the 396

condensation reactions responsible for carbon chain elongation in these two pathways are very 397

different, providing an opportunity to clearly distinguish them. The -oxidation reversal uses 398

thiolases, which employ acetyl-CoA as the extender unit and a non-decarboxylating 399

condensation mechanism (51, 52). The fatty acid biosynthesis pathway uses keto-acyl-ACP 400

synthases, which employ a decarboxylating condensation mechanism and malonyl-ACP as the 401

extender unit (53). 402

Overexpression of FabI in strain JC01(DE3) resulted predominantly in the production of 403

acetate, a fermentation profile essentially undistinguishable from that of JC01(DE3) carrying the 404

empty pETDuet vector (Fig. 5). In fact, butyrate production with FabI expression was only 405

observed when a thiolase (AtoB or FadA) was used in conjunction with FadB (Fig. 5). The 406

requirement of a non-decarboxylating condensation enzyme (e.g. thiolases AtoB or FadA), as 407

well as the β-oxidation enzyme FadB to observe the synthesis of butyrate indicates that FabI is 408

facilitating a reversal of the β-oxidation cycle despite being an enzyme of the type II fatty acid 409

biosynthesis pathway. 410

411

DISCUSSION 412

While we previously identified native enzymes responsible for the thiolase (AtoB, FadA), 413

3-hydroxyacyl-CoA dehydrogenase (FadB), and enoyl-CoA dehydratase (FadB) components of a 414


.asm.org/

Dow

nloaded from

http://aem.asm.org/

19

functional reversal of the -oxidation cycle in E. coli, the identity of the enoyl-CoA reductase 415

component remained elusive (21). Here, FabI, the fatty acid type II enoyl-ACP reductase, was 416

identified as the primary enzyme responsible for enoyl-CoA reduction. FabI, though being less 417

kinetically efficient than egTER for the NADH dependent reduction of crotonyl-CoA, enabled -418

oxidation reversal fluxes similar to those supported by egTER. FabI also facilitated the 419

production of longer chain carboxylic acids when a second longer chain specific thiolase, FadA, 420

was present, and with the inclusion of propionyl-CoA transferase to synthesize the odd-chain 421

priming molecule propionyl-CoA, odd-chain carboxylic acids could also be produced. 422

In addition to providing a defined set of native enzymes that facilitate the functional 423

reversal of the -oxidation cycle, the use of an NADH-dependent enzyme as the enoyl-CoA 424

reductase has clear advantages for product synthesis. When comparing the standard free energies 425

resulting from full one-turn reversal, the cofactor utilized for electron transfer by the enoyl-CoA 426

reductase has a pronounced impact on the overall favorability of the pathway (Fig. 1). For 427

example, with the use of an enzyme dependent on ubiquinone for electron transfer, such as FadE, 428

the overall reversal of the pathway is unfavorable from a free energy standpoint. On the other 429

hand, with the use of either a ferredoxin- or NADH-dependent enzyme for the enoyl-CoA 430

reduction, operation of the β-oxidation pathway in the reverse direction becomes favorable under 431

standard conditions. These principles can help explain our results indicating that while slight 432

increases to butyrate production are observed upon overexpression of fadE with atoB and fadB, 433

the use of an NADH-dependent enzyme (e.g. FabI or egTER) results in dramatic increases in 434

product formation resulting from a full one-turn β-oxidation reversal (Fig. 2). While a 435

ferredoxin-dependent enzyme, such as YdiO, also has the potential to improve the overall 436

thermodynamics of the pathway, the paucity of ferredoxin-dependent reactions in E. coli results 437


.asm.org/

Dow

nloaded from

http://aem.asm.org/

20

in an effectively coupled reaction step. Unlike the use of NADH, which can be regenerated 438

through numerous metabolic reactions, the regeneration of a reduced ferredoxin requires the use 439

of a pyruvate ferredoxin oxidoreductase (54) during the conversion of pyruvate to acetyl-CoA. 440

This can have a pronounced impact on overall redox balance, as the requirement for the 441

generation of an additional reducing equivalent through this step can lead to an accumulation of 442

reducing equivalents during the synthesis of certain products (55). Thus, un-coupling the enoyl-443

CoA reduction from both thermodynamic and stoichiometric constraints through the use of an 444

NADH-dependent enzyme, such as FabI, can greatly increase the ability of a functional reversal 445

of the β-oxidation cycle to produce all potential products at a higher theoretical yield. 446

Despite the lower catalytic efficiency and specific activitiy of crotonyl-CoA reduction 447

with the use of FabI in comparison to egTER, the titers and yields of carboxylic acids produced 448

from a -oxidation reversal were similar with either enzyme. Based on this evidence, it is likely 449

that further improvements to pathway efficiency and product synthesis can achieved through 450

identifying potential bottlenecks at other pathway nodes. One key area that has not been 451

explored in detail is the role termination pathways play in product synthesis, as the production of 452

carboxylic acids in this case relies on endogenous enzymes for the conversion of acyl-CoA 453

intermediates into acid products. Considering the impact the deletion of yciA has on short and 454

medium chain carboxylic acid production, the manipulation of additional thioesterases is 455

envisioned as a means to improve not only product titers and yields, but also the selectivity of 456

product chain length. A similar approach with additional types of termination pathways, such as 457

acyl-CoA reductases for alcohol production, can also be utilized to diversify product synthesis. 458

In addition to the production of carboxylic acids and n-alcohols through the tailoring of 459

termination pathways, the promiscuous nature of ENRs can potentially be further exploited 460


.asm.org/

Dow

nloaded from

http://aem.asm.org/

21

within the context of a β-oxidation reversal through the use of various priming molecules, which 461

can lead to the synthesis of a diverse set of products with a wide range of functional groups (55). 462

463

ACKNOWLEDGEMENTS 464

This work was supported by grants from the U.S. National Science Foundation (EEC-0813570, 465

CBET-1134541, CBET-1067565). 466

467

FIGURE CAPTIONS 468

Figure 1. Engineered functional reversal of the β-oxidation cycle. Core enzymes consist of 469

thiolases (AtoB, FadA), hydroxyacyl-CoA dehydrogenase (FadB), enoyl-CoA hydratase (FadB), 470

and enoyl-CoA reductase (FabI, FadE). Enoyl-CoA reductase step highlighted in gray. 471

Thioesterases are shown as an example of termination enzymes that can act on CoA thioester 472

intermediates of the core pathway to generate carboxylic acids as the products. Free energies 473

were calculated as previously described (22) and assuming different redox partners for the enoyl-474

CoA reductase reaction. ΔGr values calculated assuming standard conditions (298.15 K, pH 7) 475

with minimum and maximum values (in parenthesis) calculated using minimum and maximum 476

metabolite concentrations set to 0.00001 M and 0.02 M, respectively. 477

478

Figure 2. Impact of deletion and over-expression of genes encoding enzymes potentially 479

responsible for the reduction of crotonyl-CoA on cell growth and product synthesis by strain 480

JC01(DE3) atoBCT5

fadBCT5

ΔfadA. Chromosomal gene deletions (“gene”) or plasmid based 481

(vector pETDuet) gene overexpression are indicated. Strain JC01 is a fermentation-deficient 482


.asm.org/

Dow

nloaded from

http://aem.asm.org/

22

derivate of E. coli MG1655 containing the following gene deletions: ldhA, poxB, pta, 483

adhE, and frdA. 484

485

Figure 3. Characterization of crotonyl-CoA reduction to butyryl-CoA by FabI. A. Mass 486

spectrum analysis of FabI reduction of crotonyl-CoA to butyryl-CoA. (i) Controls of crotonyl-487

CoA (836.3 m/z – gray) and butyryl-CoA (838.3 m/z – black). (ii) Reaction mixture without 488

FabI. (iii) Reaction mixture with FabI. B. pH activity profile of FabI with crotonyl-CoA and 489

NADH relative to pH 7.5 (1.0). C. Inhibition profile of crotonyl-CoA reduction activity for FabI 490

with the indicated CoA thioesters at either 20 or 200 µM relative to activity in absence of 491

inhibitor (100%). 492

493

Figure 4. Synthesis of longer chain carboxylic acids via multiple turns of a functional β-494

oxidation reversal using FabI as the enoyl-CoA reductase. A. Both short-chain (AtoB) and long-495

chain (FadA) thiolases were activated in strain JC01(DE3) atoBCT5

fadBACT5

to facilitate 496

operation of several turns of the β-oxidation reversal. The impact of deletion of fadD and yciA 497

on product synthesis is also shown. Gene deletion represented by “gene”. All strains included 498

either pETDuet or pETDuet-fabI (indicated by fabI+) vector. B. Production of odd chain 499

carboxylic acids is facilitated in strain JC01(DE3) atoBCT5

fadBACT5

ΔfadD ΔyciA pETDuet-fabI 500

when mePCT is co-expressed from pCDFDuet and the medium is supplemented with 15 mM 501

propionic acid. All strains and plasmids described in Table 1. 502

503

Figure 5. Cell growth and product synthesis for strain JC01(DE3) and its derivatives 504

demonstrating the FabI-mediated production of carboxylic acids proceeds through a functional 505


.asm.org/

Dow

nloaded from

http://aem.asm.org/

23

reversal of the β-oxidation cycle. Modifications to JC01(DE3) are indicated by either a gene 506

deletion (“gene”) or overexpression (chromosome or vector pETDuet). 507

508

509

510

511

512

513

514

515

516

517

518

519

520

521

522

523

524

525

526

527

528


.asm.org/

Dow

nloaded from

http://aem.asm.org/

24

TABLES 529

Table 1. Strains and plasmids used in this study 530

Strain/Plasmid Description/Genotype Source

MG1655 F- - ilvG- rfb-50 rph-1 (23)

HME45 W3110 ΔlacU169 c1857 Δ(cro-bioA) (27)

HME45 ΔfabI pCA24N-fabI ‘HME45’ Δfabi::FRT-Kan-FRT pCA24N-fabI This Study

JC01 ‘MG1655’, ldhA::FRT poxB::FRT pta::FRT adhE::FRT frdA::FRT

sequential deletion of ldhA, poxB, pta, adhE, and frdA (21)

JC01 (DE3) JC01 harboring a λDE3 Lysogen This Study

JC01 (DE3) atoBCT5 ‘JC01 (DE3)’ FRT-cymR-PCT5-atoB This Study

JC01 (DE3) fadBACT5 ‘JC01 (DE3)’ FRT-cymR-PCT5-fadBA This Study

JC01 (DE3) fadBCT5 ΔfadA ‘JC01 (DE3)’ FRT-cymR-PCT5-fadB fadA::zeo This Study

JC01 (DE3) atoBCT5 fadBACT5 ‘JC01 (DE3) fadBACT5 ’ FRT-cymR-PCT5-atoB This Study

JC01 (DE3) atoBCT5 fadBCT5 ΔfadA 'JC01 (DE3) fadBCT5 ΔfadA’ FRT-cymR-PCT5-atoB This Study

JC01 (DE3) atoBCT5 fadBCT5 ΔfadA ΔfabI

pETDuet-P1-fabI

‘JC01 (DE3) atoBCT5 fadBCT5 ΔfadA’ ΔfabI::FRT-Kan-FRT pETDuet-P1-

fabI This Study

JC01 (DE3) atoBCT5 fadBCT5 ΔfadA ΔfabI

pETDuet-P1-bsfabL

‘JC01 (DE3) atoBCT5 fadBCT5 ΔfadA’ ΔfabI::FRT-Kan-FRT pETDuet-P1-

bsfabL This Study

JC01 (DE3) atoBCT5 fadBCT5 ΔfadA ΔfadE ‘JC01 (DE3) atoBCT5fadBCT5 ΔfadA’ ΔfadE::FRT-Kan-FRT This Study

JC01 (DE3) atoBCT5 fadBCT5 ΔfadA ΔydiO ‘JC01 (DE3) atoBct5 fadBct5 ΔfadA’ ΔydiO::FRT-Kan-FRT This Study

JC01 (DE3) atoBCT5 fadBCT5 ΔfadA ΔcaiA ‘JC01 (DE3) atoBct5 fadBct5 ΔfadA’ ΔcaiA::FRT-Kan-FRT This Study

JC01 (DE3) atoBCT5 fadBCT5 ΔfadA ΔaidB ‘JC01 (DE3) atoBct5 fadBct5 ΔfadA’ ΔaidB::FRT-Kan-FRT This Study

JC01 (DE3) atoBCT5 fadBACT5 ΔfadD ‘JC01 (DE3) atoBCT5 fadBACT5’ fadD::FRT This Study

JC01 (DE3) atoBCT5 fadBACT5 ΔfadD ΔyciA ‘JC01 (DE3) atoBCT5 fadBACT5 ΔfadD’ yciA::FRT This Study

pCA24N-fabI pBR322-derived derived vector, oriR f1, cat ,lacIq, E coli fabI under T5lac

promoter (28)

pETDuet pETDuet-1 (pBR322-derived), oriR f1, lacI, bla Novagen

pETDuet-P1-egTER Euglena gracilis TER gene under T7lac promoter and lacI control This Study

pETDuet-P1-fabI E. coli fabI gene under T7lac promoter and lacI control This Study

pETDuet-P1-fadE E. coli fadE gene under T7lac promoter and lacI control This Study

pETDuet-P1-caiA E. coli caiA gene under T7lac promoter and lacI control This Study

pETDuet-P1-ydiO E. coli ydiO gene under T7lac promoter and lacI control This Study

pETDuet-P1-effadK E. faecalis V583 (ATCC 700802) fabK gene under T7lac promoter and lacI

control This Study

pETDuet-P1-bsfabL B. subtilis (ATCC 23857) fabL gene under T7lac promoter and lacI control This Study

pETDuet-P1-vcfabV V. cholerae (ATCC 39315) fabV gene under T7lac promoter and lacI control This Study

pCDFDuet pCDFDuet-1 (CloDF13-derived), oriR CDF, lacI, SmR Novagen

pCDFDuet-P1-mePCT M. elsdenii PCT gene under T7lac promoter and lacI control This Study

pCDFDuet-P1-fadB E. coli fadB gene under T7lac promoter and lacI control This Study

pUCBB- PCT5-ntH6-eGFP pUCBB-ntH6-eGFP derived vector eGFP gene under T5 promoter with an N-

Terminal His-Tag and cymR control This Study

pUCBB- PCT5-atoB E. coli atoB gene under T5 promoter and cymR control This Study

pUCBB- PCT5-fadB E. coli fadB gene under T5 promoter and cymR control This Study


.asm.org/

Dow

nloaded from

http://aem.asm.org/

25

Table 2. Primers used in this study for plasmid construction or chromosomal integrations. For 531

further details, see Materials and Methods section. 532

533

534

535

Constructs Primer Primer Sequences (5’-3’)

Plasmid

pETDuet-P1-egTER pNova-P1-egTER-L aggagatataccatggcaatgtttaccacgac

pNova-P1-egTER-R cgccgagctcgaattcttattgctgtgctgcggac

pETDuet-P1-fabI fabIFusNcoI5p aggagatataccatgggttttctttccggtaagcgcattctg

fabIFusEcoRI3p cgccgagctcgaattcttatttcagttcgagttcgttcattgc

pETDuet -P1-fadE fadEfus5p aggagatataccatgatgatgattttgagtattctcgctacg

fadEfusEcorRI3p cgccgagctcgaattcttacgcggcttcaactttccgcactttc

pETDuet -P1-caiA pNOVA-P1-caiA-L aggagatataccatggattttaatttaaatgatgagcag

pNOVA-P1-caiA-R cgccgagctcgaattccggacttagcggtattgctt

pETDuet-P1-effadK effabkncoduetfus5p aggagatataccatgaagtgtacttatcttagaactaaaggacg

effabkecorduetfus3p cgccgagctcgaattcttagccccaacgctgattcatcttatgtac

pETDuet-P1-bsfabL bsFabLfusNCO5p aggagatataccatggaacaaaataaatgtgcactcg

bsFabLfusECOR3p gccgagctcgaattcgttaaacgagcagtgagcgtccgcc

pETDuet-P1-vcfabV vcFabVfus5p aggagatataccatgatcatcaaacctaaaattcgtgg

vcFabVfusECO3p gccgagctcgaattcgttactcgatatcaatcacatcaaattcgacttctggattgacg

pCDFDuet-P1-mePCT pNova-P1-mePCT-L aggagatataccatgagaaaagtagaaatcattacagct

pNova-P1-mePCT-R cgccgagctcgaattcttattttttcagtcccatggg

pCDFDuet-P1-fadB pNova-P1-fadB-L aggagatataccatgctttacaaaggcgacacc

pNova-P1-fadB-R cgccgagctcgaattcttaagccgttttcaggtcgc

Chromosomal

FRT-cat-FRT-cymR-PCT5-

fadBA cat-homPepQ-L gcacatcgttcatccagagcgtgatttctgccgagcgtgatcagatcggcgtgtaggctggagctgcttcg

cat-ovcymfadB-R tctgaaattctgcctcgtgacatatgaatatcctcctta

cym-pCTC-fadB-ovcat-L taaggaggatattcatatgtcacgaggcagaatttcaga

fadBhom-R ttaactgaacctggggcatc

FRT-Kan-FRT-cymR-

PCT5-atoB kan-homatoE-L ttggtttaacgctgttctgacggcacccctacaaacagaaggaatataaacatatgaatatcctcctta

kan-ovcymatoB-R tctgaaattctgcctcgtgagtgtaggctggagctgcttcg

cym-pCTC-atoB-ovkan-L cgaagcagctccagcctacactcacgaggcagaatttcaga

atoBintrecomb-R gccagcccgctttttaac

ΔfabI::FRT-Kan-FRT deltaFabI-L cgcctgattttcaggcacaacaagcatcaacaataaggattaaagctatggtgtaggctggagctgcttcg

deltaFabI-R aacgccgcccatctttaccaacagaacgattatttcagttcgagttcgttcatatgaatatcctcctta

fadA::zeo deltafadAzeo-L ttgagccagcccgtccggttggcgacctgaaaacggcttaaggagtcacaatggccaagttgaccagtg

deltafadAzeo -R ttaaacccgctcaaacaccgtcgcaataccctgacccagaccgatacacatcagtcctgctcctctgc


.asm.org/

Dow

nloaded from

http://aem.asm.org/

26

Table 3. Impact of deletion/overexpression of acyl-CoA dehydrogenase or trans-enoyl-CoA 536

reductase encoding genes on respective enzymatic activities. 537

Strain Vector

Enzyme activity (μmol/mg protein/min)a

Acyl-CoA dehydrogenase NADH-Dependent

Trans-enoyl-CoA reductase

Crotonyl-CoA concentrationb

80 µM 1 mM

JC01(DE3) atoBCT5 fadBCT5 ΔfadA pETDuet (8 hours) 0.0034 ± .0001 n.d.c 0.10 ± .001

pETDuet (48 hours) 0.0020 ± .0002 n.d.c 0.080 ± .007

JC01(DE3) atoBCT5 fadBCT5 ΔfadA ΔfadE pETDuet 0.0016 ± .00002 -- --

JC01(DE3) atoBCT5 fadBCT5 ΔfadA ΔydiO pETDuet 0.0018 ± .0001 -- --

JC01(DE3) atoBCT5 fadBCT5 ΔfadA ΔcaiA pETDuet 0.0011 ± .0001 -- --

JC01(DE3) atoBCT5 fadBCT5 ΔfadA ΔaidB pETDuet 0.0026 ± .00003 -- --

JC01(DE3) atoBCT5 fadBCT5 ΔfadA pETDuet-fadE 0.019 ± .002 -- --

pETDuet-ydiO 0.0031 ± .0003 -- --

pETDuet-caiA 0.0014 ± .0002 -- --

pETDuet-egTER -- 3.1 ± 0.4 --

pETDuet-fabI -- 0.5 ± 0.05 3.4 ± .27

pETDuet-effabK -- 0.05 ± .010 0.14 ± .01

pETDuet-bsfabL -- n.d.c 0.019 ± .006

pETDuet-vcfabV -- 0.053 ± .010 4.3 ± 1.6

JC01(DE3) atoBCT5 fadBCT5 ΔfadA ΔfabI pETDuet-fabI 0.0010 ± .0032 0.14 ± .006 1.8 ± .10

pETDuet-bsfabL 0.0020 ± .0002 n.d. n.d.

aUnless indicated, all activities measured from 48 hr fermentation samples. 538

bConcentration of crotonyl-CoA used in enzymatic assay. 539

c No NADPH dependent trans-enoyl-CoA reductase activity detected. 540

‘--‘ Not Measured. ‘n.d’ Not Detected. 541

542

543

544

545

546


.asm.org/

Dow

nloaded from

http://aem.asm.org/

27

REFERENCES 547

1. Lee JW, Na D, Park JM, Lee J, Choi S, Lee SY. 2012. Systems metabolic engineering of 548

microorganisms for natural and non-natural chemicals. Nat. Chem. Biol. 8:536-546. 549

2. Quin MB, Schmidt-Dannert C. 2014. Designer microbes for biosynthesis. Curr. Opin. 550

Biotechnol. 29:55-61. 551

3. Peralta-Yahya PP, Zhang F, del Cardayre SB, Keasling JD. 2012. Microbial engineering 552

for the production of advanced biofuels. Nature 488:320-328. 553

4. Wen M, Bond-Watts BB, Chang MCY. 2013. Production of advanced biofuels in 554

engineered E. coli. Curr. Opin. Chem. Biol. 17:472-479. 555

5. Buchholz K, Collins J. 2013. The roots-a short history of industrial microbiology and 556

biotechnology. Appl. Microbiol. Biotechnol. 97:3747-3762. 557

6. Atsumi S, Cann AF, Connor MR, Shen CR, Smith KM, Brynildsen MP, Chou KJY, 558

Hanai T, Liao JC. 2008. Metabolic engineering of Escherichia coli for 1-butanol 559

production. Metab. Eng. 10:305–311. 560

7. Leonard E, Ajikumar PK, Thayer K, Xiao WH, Mo JD, Tidor B, Stephanopoulos G, 561

Prather KLJ. 2010. Combining metabolic and protein engineering of a terpenoid 562

biosynthetic pathway for overproduction and selectivity control. Proc. Natl. Acad. Sci. 563

U.S.A. 107:13654-13659. 564

8. Westfall PJ, Pitera DJ, Lenihan JR, Eng D, Woolard FX, Regentin R, Horning T, 565

Tsuruta H, Melis DJ, Owens A, Fickes S, Diola D, Benjamin KR, Keasling JD, Leavell 566

MD, McPhee DJ, Renninger NS, Newman JD, Paddon CJ. 2012. Production of 567

amorphadiene in yeast, and its conversion to dihydroartemisinic acid, precursor to the 568

antimalarial agent artemisinin. Proc. Natl. Acad. Sci. U.S.A. 109:111-118. 569


.asm.org/

Dow

nloaded from

http://aem.asm.org/

28

9. Atsumi S, Hanai T, Liao JC. 2008. Non-fermentative pathways for synthesis of branched-570

chain higher alcohols as biofuels. Nature 451:86-U13. 571

10. Zhang KC, Sawaya MR, Eisenberg DS, Liao JC. 2008. Expanding metabolism for 572

biosynthesis of nonnatural alcohols. Proc. Natl. Acad. Sci. U.S.A. 105:20653-20658. 573

11. Steen EJ, Kang YS, Bokinsky G, Hu ZH, Schirmer A, McClure A, del Cardayre SB, 574

Keasling JD. 2010. Microbial production of fatty-acid-derived fuels and chemicals from 575

plant biomass. Nature 463:559-U182. 576

12. Schirmer A, Rude MA, Li XZ, Popova E, del Cardayre SB. 2010. Microbial Biosynthesis 577

of Alkanes. Science 329:559-562. 578

13. Janßen HJ, Steinbüchel A. 2014. Fatty acid synthesis in Escherichia coli and its 579

applications towards the production of fatty acid based biofuels. Biotechnol. Biofuels 7:26. 580

14. Lennen RM, Pfleger BF. 2012. Engineering Escherichia coli to synthesize free fatty acids. 581

Trends Biotechnol. 30:659-667. 582

15. Nawabi P, Bauer S, Kyrpides N, Lykidis A. 2011. Engineering Escherichia coli for 583

Biodiesel Production Utilizing a Bacterial Fatty Acid Methyltransferase. Appl. Environ. 584

Microbiol. 77:8052-8061. 585

16. Zhang FZ, Carothers JM, Keasling JD. 2012. Design of a dynamic sensor-regulator 586

system for production of chemicals and fuels derived from fatty acids. Nat. Biotechnol. 587

30:354-U166. 588

17. Bergler H, Wallner P, Ebeling A, Leitinger B, Fuchsbichler S, Aschauer H, Kollenz G, 589

Hogenauer G, Turnowsky F. 1994. Protein EnvM is the NADH-depdendent enoyl-ACP 590

reductase (FabI) of Escherichia coli. J. Biol. Chem. 269:5493-5496. 591


.asm.org/

Dow

nloaded from

http://aem.asm.org/

29

18. Bi HK, Zhu L, Wang HH, Cronan JE. 2014. Inefficient Translation Renders the 592

Enterococcus faecalis fabK Enoyl-Acyl Carrier Protein Reductase Phenotypically Cryptic. J. 593

Bacteriol. 196:170-179. 594

19. Heath RJ, Su N, Murphy CK, Rock CO. 2000. The enoyl- acyl-carrier-protein reductases 595

FabI and FabL from Bacillus subtilis. J. Biol. Chem. 275:40128-40133. 596

20. Massengo-Tiasse RP, Cronan JE. 2008. Vibrio cholerae FabV defines a new class of 597

enoyl-acyl carrier protein reductase. J. Biol. Chem. 283:1308-1316. 598

21. Clomburg JM, Vick JE, Blankschien MD, Rodriguez-Moya M, Gonzalez R. 2012. A 599

Synthetic Biology Approach to Engineer a Functional Reversal of the β-Oxidation Cycle. 600

ACS Synth. Biol. 1:541-554. 601

22. Dellomonaco C, Clomburg JM, Miller EN, Gonzalez R. 2011. Engineered reversal of the 602

β-oxidation cycle for the synthesis of fuels and chemicals. Nature 476:355-U131. 603

23. Kang YS, Durfee T, Glasner JD, Qiu Y, Frisch D, Winterberg KM, Blattner FR. 2004. 604

Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186:8548-8548. 605

24. Miller JH. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, 606

Cold Spring Harbor, NY. 607

25. Yazdani SS, Gonzalez R. 2008. Engineering Escherichia coli for the efficient conversion of 608

glycerol to ethanol and co-products. Metab. Eng. 10:340-351. 609

26. Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, 610

Wanner BL, Mori H. 2006. Construction of Escherichia coli K-12 in-frame, single-gene 611

knockout mutants: the Keio collection. Mol. Syst. Biol. 2:11. 612


.asm.org/

Dow

nloaded from

http://aem.asm.org/

30

27. Yu DG, Ellis HM, Lee EC, Jenkins NA, Copeland NG, Court DL. 2000. An efficient 613

recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. 614

Sci. U.S.A. 97:5978-5983. 615

28. Kitagawa M, Ara T, Arifuzzaman M, Ioka-Nakamichi T, Inamoto E, Toyonaga H, Mori 616

H. 2005. Complete set of ORF clones of Escherichia coli ASKA library (A complete Set of 617

E. coli K-12 ORF archive): Unique resources for biological research. DNA Res. 12:291-299. 618

29. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in 619

Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97:6640-6645. 620

30. Choi YJ, Morel L, Le Francois T, Bourque D, Bourget L, Groleau D, Massie B, Miguez 621

CB. 2010. Novel, Versatile, and Tightly Regulated Expression System for Escherichia coli 622

Strains. Appl. Environ. Microbiol. 76:5058-5066. 623

31. Vick JE, Johnson ET, Choudhary S, Bloch SE, Lopez-Gallego F, Srivastava P, Tikh IB, 624

Wawrzyn GT, Schmidt-Dannert C. 2011. Optimized compatible set of BioBrick (TM) 625

vectors for metabolic pathway engineering. Appl. Microbiol. Biotechnol. 92:1275-1286. 626

32. Thomason L, Court DL, Bubunenko M, Costantino N, Wilson H, Datta S, Oppenheim 627

A. 2007. Recombineering: genetic engineering in bacteria using homologous recombination, 628

Curr. Protoc. Mol. Biol. Chapter 1:Unit 1.16. 629

33. Magner DB, Blankschien MD, Lee JA, Pennington JM, Lupski JR, Rosenberg SM. 630

2007. RecQ promotes toxic recombination in cells lacking recombination intermediate-631

removal proteins. Mol. Cell 26:273-286. 632

34. Neidhardt FC, Bloch PL, Smith DF. 1974. Culture Medium for Enterobacteria. J. 633

Bacteriol. 119:736-747. 634


.asm.org/

Dow

nloaded from

http://aem.asm.org/

31

35. Mazumdar S, Blankschien MD, Clomburg JM, Gonzalez R. 2013. Efficient synthesis of 635

L-lactic acid from glycerol by metabolically engineered Escherichia coli. Microb. Cell Fact. 636

12:7. 637

36. Bond-Watts BB, Bellerose RJ, Chang MCY. 2011. Enzyme mechanism as a kinetic control 638

element for designing synthetic biofuel pathways. Nat. Chem. Biol. 7:222-227. 639

37. O’Brien WJ, Frerman FE. 1977. Evidence for a complex of 3 β-oxidation enzymes in 640

Escherichia coli- Induction and localization. J. Bacteriol. 132:532-540. 641

38. Campbell JW, Cronan JE. 2002. The enigmatic Escherichia coli fadE gene is yafH. J. 642

Bacteriol. 184:3759-3764. 643

39. Campbell JW, Morgan-Kiss RM, Cronan JE. 2003. A new Escherichia coli metabolic 644

competency: growth on fatty acids by a novel anaerobic β-oxidation pathway. Mol. 645

Microbiol. 47:793-805. 646

40. Preusser A, Wagner U, Elssner T, Kleber HP. 1999. Crotonobetaine reductase from 647

Escherichia coli consists of two proteins. Biochim. Biophys. Acta. 1431:166-178. 648

41. Elssner T, Hennig L, Frauendorf H, Haferburg D, Kleber HP. 2000. Isolation, 649

identification, and synthesis of gamma-butyrobetainyl-CoA and crotonobetainyl-CoA, 650

compounds involved in carnitine metabolism of E. coli. Biochemistry 39:10761-10769. 651

42. Landini P, Hajec LI, Volkert MR. 1994. Structure and transcriptional regulation of the 652

Escherichia coli adaptive response gene aidB. J. Bacteriol. 176:6583-6589. 653

43. Rohankhedkar MS, Mulrooney SB, Wedemeyer WJ, Hausinger RP. 2006. The AidB 654

component of the Escherichia coli adaptive response to alkylating agents is a flavin-655

containing, DNA-binding protein. J. Bacteriol. 188:223-230. 656


.asm.org/

Dow

nloaded from

http://aem.asm.org/

32

44. Heath RJ, Rock CO. 1995. Enoyl-acyl carrier protein reductase (FabI) plays a determinant 657

role in completing cycles of fatty acid elongation in Escherichia coli. J. Biol. Chem. 658

270:26538-26542. 659

45. Bergler H, Fuchsbichler S, Hogenauer G, Turnowsky F. 1996. The enoyl- acyl-carrier-660

protein reductase (FabI) of Escherichia coli, which catalyzes a key regulatory step in fatty 661

acid biosynthesis, accepts NADH and NADPH as cofactors and is inhibited by palmitoyl-662

CoA. Eur. J. Biochem. 242:689-694. 663

46. Weeks G, Wakil SJ. 1968. Studies on mechanism of fatty acid synthesis: Preparation and 664

general properties of enoyl acyl carrier protein reductases from Escherichia coli. J. Biol. 665

Chem. 243:1180-9. 666

47. Zhu L, Bi HK, Ma JC, Hu Z, Zhang WB, Cronan JE, Wang HH. 2013. The Two 667

Functional Enoyl-Acyl Carrier Protein Reductases of Enterococcus faecalis Do Not Mediate 668

Triclosan Resistance. MBio 4:10. 669

48. Ishihama Y, Schmidt T, Rappsilber J, Mann M, Hartl FU, Kerner MJ, Frishman D. 670

2008. Protein abundance profiling of the Escherichia coli cytosol. BMC Genomics 9:17. 671

49. Taguchi S, Yamadaa M, Matsumoto K, Tajima K, Satoh Y, Munekata M, Ohno K, 672

Kohda K, Shimamura T, Kambe H, Obata S. 2008. A microbial factory for lactate-based 673

polyesters using a lactate-polymerizing enzyme. Proc. Natl. Acad. Sci. U.S.A. 105:17323-674

17327. 675

50. Tseng HC, Prather KLJ. 2012. Controlled biosynthesis of odd-chain fuels and chemicals 676

via engineered modular metabolic pathways. Proc. Natl. Acad. Sci. U.S.A. 109:17925-677

17930. 678


.asm.org/

Dow

nloaded from

http://aem.asm.org/

33

51. Binstock JF, Schulz H. 1981. Fatty acid oxidation complex from Escherichia coli. Methods 679

Enzymol. 71 Pt C:403-411. 680

52. Jenkins LS, Nunn WD. 1987. Genetic and molecular characterization of the genes involved 681

in short-chain fatty-acid degradation in Escherichia coli: The ato system. J. Bacteriol. 682

169:42-52. 683

53. White SW, Zheng J, Zhang YM, Rock CO. 2005. The structural biology of type II fatty 684

acid biosynthesis, p. 791-831, Annual Review of Biochemistry, vol. 74. Annual Reviews, 685

Palo Alto. 686

54. Akhtar MK, Jones PR. 2009. Construction of a synthetic YdbK-dependent pyruvate:H-2 687

pathway in Escherichia coli BL21(DE3). Metab. Eng. 11:139-147. 688

55. Cintolesi A, Clomburg JM, Gonzalez R. 2014. In silico assessment of the metabolic 689

capabilities of an engineered functional reversal of the beta-oxidation cycle for the synthesis 690

of longer-chain (C >= 4) products. Metab. Eng. 23:100-115. 691 on January 21, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Escherichia coli enoyl -acyl carrier protein reductase ( FabI ) … · 4 70 These include E. coli...

Documents

Transcript of Escherichia coli enoyl -acyl carrier protein reductase ( FabI ) … · 4 70 These include E. coli...