Intimin Types , and Bind to Nucleolin With Equivalent ... · intestinal epithelium include...

Intimin Types α, β, and γ Bind to Nucleolin With Equivalent Affinity but Lower

Avidity Than to the Translocated Intimin Receptor

James F. Sinclair1 and Alison D. O’Brien1,*

1 Department of Microbiology and Immunology, Uniformed Services University of the Health

Sciences, 4301 Jones Bridge Rd., Bethesda, MD 20814

Running Title: Various Intimins Bind to Nucleolin and Tir

Key words: Intimin, Tir, Nucleolin, E. coli, Enteropathogenic, Citrobacter, Enterohemorrhagic,

O157:H7, EPEC, EHEC, adherence, adhesin

* Corresponding author: Alison D. O’Brien, Department of Microbiology and Immunology,

Uniformed Services University of the Health Sciences, 4301 Jones Bridge Rd., Bethesda, MD

20814; Phone 301-295-3419; Fax 301-295-3773; email [email protected]

JBC Papers in Press. Published on June 1, 2004 as Manuscript M401616200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on June 20, 2018http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

SUMMARY

The outer membrane adhesins of enteropathogenic Escherichia coli (EPEC), Citrobacter

rodentium, and enterohemorrhagic Escherichia coli (EHEC) O157:H7 that mediate attach and

efface intestinal lesions are classified as intimin alpha, beta, or gamma, respectively. Each of

these intimin types binds to its cognate, bacterially-encoded receptor (called Tir for Translocated

Intimin Receptor) to promote tight adherence of the organism to the host-cell plasma

membrane. We previously reported that gamma intimin of EHEC O157:H7 also bound to a

eucaryotic receptor that we determined was nucleolin. The objective of this study was to

investigate in vitro and in vivo the interactions of intimins alpha, beta, and gamma with nucleolin

in the presence of Tir from EHEC O157:H7. Protein binding experiments demonstrated that

intimin of types alpha, beta and gamma bound nucleolin with similar affinity. Moreover, all

three intimin types co-localized with regions of nucleolin expressed on the surface of HEp-2

cells. When intimin alpha, beta or gamma bound to Tir in vitro, the intimin interaction with

nucleolin was blocked. Both Tir and nucleolin accumulated beneath intimin-presenting bacteria

that had attached to the surface of HEp-2 cells. Taken together, these findings suggest that

nucleolin is involved in bacterial adherence promoted by all intimin types and that Tir and

nucleolin compete for intimin during adherence.

INTRODUCTION

Bacteria that produce characteristic attach and efface (A/E) 1 lesions during adherence to the host

intestinal epithelium include enterohemorrhagic E. coli (EHEC), enteropathogenic E. coli

(EPEC), and Citrobacter rodentium (1-3). EPEC and EHEC cause acute diarrhea in humans

________________________1 The abbreviations used are: EPEC, enteropathogenic E. coli; EHEC, enterohemorrhagic E. coli; A/E, attach and efface; Tir, translocated intimin receptor; LEE, locus of enterocyte effacement;

Various intimins bind to nucleolin and tir

2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

while C. rodentium infection of mice results in colonic hyperplasia. The induction of A/E lesions

by these organisms is dependent on the expression of the outer-membrane protein intimin. Each

intimin molecule has an amino-terminal periplasmic tail, a conserved porin-like transmembrane

domain, and a carboxyl-terminal extracellular domain (4). The extracellular domain interacts

with receptors on the host-cell surface and is essential for A/E lesion formation (5-8). The

extracellular domain sequence varies among members of the intimin family, a group that

includes 5 to 9 members, depending on the particular typing scheme employed (9,10). All such

schema place E. coli O157:H7 intimin as type gamma (γ), most human EPEC intimin as type

alpha (α) and C. rodentium intimin as type beta (β). These sequence differences among the

extracellular receptor-binding domains of the intimin types may contribute to both immune

system avoidance and tissue tropism of bacterial adherence (11-14).

All intimin types studied to date bind to an associated translocated intimin receptor, Tir (15-

18), that is produced by the bacteria and inserted into the host-cell membrane through a type III

secretion system (19,20). The interaction between intimin and Tir triggers actin condensation

beneath the bacterium and permits attachment to the host cell cytoskeleton (21,22). The genes

for intimin (eae) and Tir (tir) are contained in a pathogenicity island called the Locus of

Enteroctye Effacement (LEE) (23-25). All bacteria that display the A/E phenotype possess the

LEE genes.

Various intimin types bind to protein receptors expressed by eucaryotic cells (26-28), and the

extracellular domains of different intimin types can bind to tissue culture cells in the absence of

Tir (29). Frankel et al demonstrated that intimin-α binds to β1 integrin (30), as does invasin, a

closely related adhesin produced by some Yersinia species (31). We recently reported that

intimin-γ from E. coli O157:H7 binds to nucleolin that is localized to the plasma membrane of

HEp-2 cells (32). Nucleolin is a ubiquitous, conserved protein that is involved in cell

proliferation and is produced by all vertebrate species (33). The role in bacterial adherence of

the interaction of intimin with these eucaryotic receptors in animals remains unclear. However,


3


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

we have demonstrated that antiserum raised against nucleolin can inhibit the adherence of

enterohemorrhagic E. coli O157:H7 to HEp-2 cells. This result suggests that bacterial

interaction with nucleolin may contribute to the pathogenic process initiated by EHEC O157.

The goal of this research was to examine the association of different intimin types with both

Tir and nucleolin. Molecular structures obtained by nuclear magnetic resonance and X-ray

crystallography have been used to map the interaction of intimin-α with Tir (34,35). Tir binds

to a C-type lectin motif of intimin that is located at the carboxyl-terminus of the extracellular

domain. The intimin binding site for nucleolin is unknown. Reece et al reported that mutations

in intimin-α engineered by site-directed mutagenesis of the eae locus in the region encoding the

C-type lectin domain influenced EPEC colonization but had no affect on Tir binding (13). This

finding suggests that the eucaryotic receptor-binding site also resides in the lectin domain (36).

To better understand the role of each type of receptor in bacterial adherence, we used in vitro

methods as well as a tissue culture model to investigate the interactions of three intimin types

(alpha, beta and gamma) with human nucleolin and Tir from EHEC O157:H7.

EXPERIMENTAL PROCEDURES

Bacterial strains and plasmids:

EPEC O127:H6 strain E2348/69 that expresses intimin-α and plasmid pCVD438 that contains

the eae gene from E2348/69 were provided by Dr. Ann Jerse. Construction of pCVD438 has

been previously described (1). Citrobacter rodentium that expresses intimin-β was supplied by

Dr. James Kaper. EHEC O157:H7 strain 86-24 that expresses intimin-gamma was contributed

by Dr. Phillip Tarr. The plasmid pEB310 that contains the eae gene from EHEC O157:H7 was

previously described by McKee et al (8). E. coli strains BL21(DE3) (Novagen) and XL1-Blue

(Stratagene) were used for the expression of recombinant proteins.

The eae genes from EPEC, C. rodentium and EHEC O157 were each cloned into high-copy


4


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

plasmid vectors with eae under control of the T7 promoter. Plasmid pCDV438 (intimin-alpha)

was digested with the restriction enzymes NarI and HindIII to yield a DNA fragment that

contained the entire eae gene with some additional flanking sequence. This fragment was ligated

into pBluescriptKS-(Stratagene) cut with the restriction enzymes AccI and HindIII to produce

plasmid pInta939. The intimin-beta eae gene was amplified directly from C. rodentium genomic

DNA by PCR with primers derived from the published gene sequence. These primers,

ATTCCCGACAGATAATCCTAAC and TGCCGGGTTTATATGATTAGAC, annealed 338

bases upstream of the eae sequence and to the 3’ end of the gene, respectively. The PCR product

was ligated into the vector pCR2.1 (Invitrogen TA cloning kit) to give plasmid pIntb936.

Plasmid pEB310 (intimin-γ) was digested with the restriction enzymes BamHI and HindIII and

the eae gene was ligated into vector pBluescriptKS- cut with the same enzymes to yield plasmid

pIntg934.

For each intimin type, the portion of the eae gene that encodes the intimin extracellular

domain was cloned into the expression vector pQE32 (Qiagen) so as to place the truncated eae

gene immediately downstream from a sequence that encodes a 6-histidine-tag and under the

control of the lac promoter. Plasmid pCVD438 was digested with SalI to give a DNA fragment

that contained the 3’ 1157 nucleotides of the intimin-alpha eae gene. This fragment was ligated

into SalI-digested pQE32 to give plasmid p6his-Inta385. Plasmid pIntb936 was cut with the

restriction enzymes SalI and HindIII to produce a DNA fragment that contained the 3’ 1157

nucleotides of the intimin-beta eae gene. This fragment was ligated into vector pQE32 cut with

the same enzymes to produce plasmid p6his-Intb385. Plasmid pEB310 was digested with SalI

and HindIII to produce a DNA fragment with the 3’ 1143 nucleotide segment of the intimin-

gamma eae gene. This fragment was ligated into pQE32 that was then cut with the same

enzymes to produce plasmid p6his-Intg380.

The construction of pTir, a plasmid that contains the EHEC O157:H7 tir gene under control of

the T7 promoter, was previously described (32). A plasmid that expresses recombinant


5


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

nucleolin was constructed as follows. A cDNA clone (I.M.A.G.E. 591039) of the ncl gene from

a human pancreas adenocarcinoma was obtained from the American Type Culture Collection

(ATCC catalog number 749447). The entire ncl gene with some flanking sequence was

amplified by PCR with the DNA primer pair TCGGATCCACTTGTCCGCTTCACACTC and

AATCTGCAGTCAAAACCAACACG that incorporated restriction sites for BamHI and PstI,

respectively. After cutting the amplified product with these enzymes, the resultant DNA

fragment was ligated into the 6-histidine-tag expression vector pQE32 (Qiagen) in an attempt to

produce a recombinant histidine-tagged version of the nucleolin protein. This construct was

transformed into E. coli strain BL21 (Novagen), but no expression of the recombinant human

protein was observed. Therefore, the ncl gene, along with the sequence that encoded the amino-

terminal 6-histidine-tag, was cut from the pQE32 vector with the restriction enzymes XhoI and

NheI. This linear fragment was cloned into the yeast epitope tagging vector pESC-Trp

(Stratagene) that had been restricted with the enzymes SalI and NheI. This construct, designated

p6his-ncl, contained the tagged nucleolin gene behind a galactose inducible promoter as well as

the trp1 gene for tryptophan biosynthesis. The plasmid was electroporated into S. cerevisiae

strain YPH500 (Stratagene) that is auxotropic for several amino acids including tryptophan.

Yeast were selected and maintained on synthetic dextrose minimal medium without tryptophan.

Protein expression and purification.

Tir: All salts and chemicals used for protein purification were of reagent grade and were

purchased from Sigma-Aldrich Chemical Company unless otherwise noted. Plasmid pTir was

transformed into the E. coli strain BL21, and expression of the recombinant Tir protein was

induced from mid-log cultures with 2 mM Isopropyl-β-D-thiogalactopyranoside (IPTG).

Induced cells were lysed by sonication, and the cell lysate was subjected to a 20% ammonium

sulfate precipitation. The lysate supernatant was extensively dialyzed against phosphate buffered

saline (PBS). The dialyzed protein was centrifuged at 10,000 rpm to remove insoluble material.

Tir protein in the supernatant was purified from contaminating proteins by passage over a


6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

column of DEAE sepharose (Pharmacia) and eluted with a linear sodium chloride gradient.

Column fractions were assessed by Western blot with rabbit anti-Tir serum (32), and fractions

with the greatest reactivity were pooled. We refer to this recombinant Tir protein as TirO157 in

the text.

Nucleolin: Production of the recombinant nucleolin protein was induced by growth of the S.

cerevisiae strain YPH500 transformed with p6his-ncl at 30° C. for 36 hours in yeast synthetic

minimal medium with 2% galactose and without tryptophan (Bio101). Western blot analysis of

yeast whole cell lysate showed that the induced culture produced a protein with an apparent size

of 114 kDa that was recognized by rabbit anti-nucleolin antiserum (SantaCruz Biotechnology)

as well as mouse anti-his-tag antibody (Qiagen). We refer to this recombinant 6-histidine-

tagged human nucleolin protein as 6H-nucleolin in the text. Total cellular protein was extracted

from induced cells with a pH 8.0 denaturation buffer (100 mM sodium phosphate, 10 mM Tris, 6

M guanidinium hydrochloride and 0.2% Tween 20). The 6H-nucleolin was purified from the

cell lysate by nickel-affinity column chromatography (Qiagen). Guanidinium extracted proteins

were loaded onto the nickel affinity column, and contaminants were washed from the resin with

20 column volumes of pH 7 buffer (100 mM sodium phosphate, 10 mM Tris, 0.2% Tween 20).

Bound protein was eluted from the column with pH 4.5 buffer (10 mM sodium phosphate, 100

mM sodium chloride, 0.2% Tween 20).

Histidine-tagged intimin extracellular domains: E. coli XL1-Blue competent cells were

transformed with plasmids p6his-Inta385, p6his-Intb385, or p6his-Intg380. Transformed cells

were selected for ampicillin resistance. Mid-log phase LB cultures of the transformed cells

grown at 37° C were induced with 2 mM IPTG. These cells produced truncated intimin with an

amino-terminal 6-histidine-tag and the carboxyl-terminal 385 amino acids of intimin-alpha or

intimin-beta, or 380 amino acids of intimin-gamma. We refer to these molecules in the text as

intimin-α385, intimin-β385, and intimin-γ380, respectively. Purification of the his-tagged

intimins by nickel-affinity chromatography was accomplished as described above for 6H-


7


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

nucleolin.

Full-length intimin: Plasmids pInta939, pIntb936, or pIntg934 were transformed into E. coli

strain BL21(DE3), and cells with the plasmids were selected for ampicillin resistance. These

cells produced full-length intimin molecules of 939, 936, and 934 amino acids of type alpha,

beta, or gamma, respectively. In the text we refer to these recombinant molecules as intimin-

α939, intimin-β936, and intimin-γ934. Full-length intimin was expressed in the outer-membrane of

transformed bacteria as demonstrated by reactivity of whole cells with rabbit anti-intimin serum

and by the capacity of these bacteria to adhere to HEp-2 cells that had been preinfected with Tir.

Protein binding experiments.

Purified intimin- α385, intimin- β385, and intimin- γ380 (1 mg/ml) were biotin-labeled by

reaction with 2 µg of biotinamidocaproate N-hydroxysuccinimide ester (Sigma) in 0.1 M

sodium borate buffer, pH 9.0, for 4 hours at room temperature. Unreacted ester was quenched by

the addition of 5 mM ammonium chloride, and the samples were dialyzed against PBS.

Polyvinylchloride microtiter plates (96 well format) were coated for 3 hours at room temperature

with 50 µl of a 20 µg/ml solution of either TirO157 or 6H-nucleolin. Nonspecific binding sites in

the wells were blocked with 3% Bovine Serum Albumin ( Sigma) in PBS incubated in the wells

overnight at 4° C. A two-fold dilution series was made for each biotinylated intimin sample.

These dilution series were incubated with the immobilized receptor proteins in a binding buffer

that contained PBS with 3% bovine serum albumin and 0.2% Tween-20. After 1 hour

incubation at room temperature, intimin that had not bound to the immobilized receptors was

rinsed from the wells with three washes of PBS. The amount of intimin bound nonspecifically to

the wells was estimated from two-fold dilutions added to wells that contained only bovine serum

albumin. Bound intimin was incubated with streptavidin-conjugated horseradish peroxidase

(Amersham Life Science) diluted 1 to 1000 in binding buffer. The intimin-peroxidase

complexes were detected by the enzyme-catalyzed color change of 3,3’,5,5’-

tetramethylbenzidine (TMB) using the TMB Peroxidase EIA Substrate Kit (BioRad). The bound


8


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

intimin concentration was estimated from the change in absorbance at 450 nm of the solution in

each well, measured with an Elx800 Universal Microplate reader (Bio-Tek Instruments). These

values were corrected for nonspecific binding by subtraction of the absorbance reading in wells

that contained bovine serum albumin only. In a separate experiment designed to test the affect

of Tir on the intimin interaction with nucleolin, various concentrations of TirO157 were mixed

with an intimin- γ380 dilution series in binding buffer. The intimin-Tir mixtures were incubated

with nucleolin that had been immobilized on a microtiter plate. After incubation for 1 hour at

room temperature, intimin-γ380 that had bound to 6H-nucleolin was detected as described.

HEp-2 cell binding assay.

HEp-2 (ATCC CCL23) human laryngeal epithelial cell cultures were maintained in EMEM

(BioWhittaker) supplemented with 10% fetal calf serum, 20 mM L-glutamine, 100 µg/ml

gentamicin, 10 units/ml penicillin G, and 10 µg/ml streptomycin. Confluent cells grown at 37°

C in an atmosphere of 5% CO2 were released from the culture flasks by treatment with trypsin,

and then 0.3 ml of cell suspension was seeded into 8-well chamber slides (Lab-Tek) at a cell

density of 6x104 cells/ml. The chamber slides were then incubated for 24 hours at 37° C in an

atmosphere of 5% CO2. Protein binding buffer consisted of RPMI 1640 (Bio Whittaker) medium

with 200 mM HEPES buffer and 0.5% bovine serum albumin. Purified samples of histidine-

tagged intimin-α385, intimin-β385, and intimin-γ380 were diluted into 200 µl of protein binding

buffer to a final concentration of 10 µg/ml. HEp-2 cell monolayers were incubated with the

protein samples for 1 hour at 37° C, and then unbound intimin was rinsed from the cells by 3

washes with PBS. Bound intimin was immunolabeled with Penta-His Alexa Fluor 555

Conjugate (Qiagen) monoclonal antibody directed against the 6-histidine tag. The HEp-2 cell

monolayer was fixed with PBS-buffered 3% formaldehyde. Nucleolin on the surface of the

fixed cells was detected with primary rabbit anti-nucleolin serum (Santa Cruz Biotechnology)

followed with secondary goat anti-rabbit-IgG serum conjugated to Alexa Fluor 488 (Molecular


9


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Probes), both of which were diluted in PBS that contained 3% bovine serum albumin. In a

separate experiment, cell monolayers were infected with EHEC strain 86-24 eae∆10 to insert the

bacterially encoded Tir receptor into the HEp-2 cell plasma membrane. Samples of the purified

histidine-tagged intimin (0.5 µg/ml) in protein binding buffer were incubated with these infected

cells. Cell-surface-bound intimin was immunolabeled as described. Nucleolin was stained by

the addition of primary rabbit antiserum labeled with Zenon Alexa Fluor 488 (Molecular

Probes). Primary rabbit antiserum raised against Tir was covalently labeled with Alexa Fluor

350 using a Molecular Probes protein labeling kit following the manufactures directions.

Infected and uninfected cells were stained for Tir by the addition of the labeled anti-Tir serum.

Both labeled anti-nucleolin and anti-Tir sera were diluted in PBS that contained 3% bovine

serum albumin and were precleared of antibodies against bacterial proteins by reaction with

formaldehyde-fixed preparations of E. coli strain BL21.

Bacterial adherence assay.

HEp-2 cell monolayers were grown in 8-well chamber slides as described for the cell- binding

assay. EHEC O157:H7 strain 86-24, strain 86-24eae∆10, and EPEC strain E2348/69 were

grown overnight at 37° C in static cultures of EMEM. Cultures of E. coli strain BL21(DE3) that

expressed intimin-α939, intimin-β936, or intimin-γ934 were grown overnight with agitation in

LB supplemented with 0.1 mg/ml ampicillin to maintain selection for the intimin plasmids.

HEp-2 cells were infected with 8 µl of overnight cultures inoculated into 300 µl of EMEM and

incubated at 37° C. After a 4-hour infection period, the liquid on the cells was gently aspirated

with a pipette to minimize the disturbance of bacteria that had adhered to the cell surface. The

infected cells were fixed for 20 min. in 2% formaldehyde, washed with PBS, permeabilized with

0.1% Tween-20 for four minutes and then washed again with PBS. Nucleolin and Tir were

stained by primary antiserum labeled with Alexa Fluor 488 and Alexa Fluor 350, respectively, as

described. Polymerized actin was visualized with Alexa Fluor 594 phalloidin (Molecular

Probes). All immunostaining procedures were carried out in PBS that contained 3% bovine


10


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

serum albumin.

Deconvolution microscopy

All images were obtained with an Olympus BX60 system microscope with a BX-FLA reflected

light fluorescence attachment. Images were captured with a SPOT RT CCD digital camera

(Diagnostic Instrument, Inc.) in 8-bit gray-scale format. For each microscopic field shown, 4

images were obtained with red, green and blue filters through sequential focal planes separated

by 1 µm increments. These images were processed into stacks by the public domain program

ImageJ (developed at the U.S. National Institutes of Health and available on the Internet at the

web address rsb.info.nih.gov/ij/). Out of focus light was removed from the stacks through the

process of deconvolution. The point-spread function for deconvolution was modeled by the

radial symmetric equation A*exp(-r2/2*k1)*cos(2πr/θ)2 + B*exp(-r2/2*k2)*sin(2πr/φ)2 where

the variables A and B represent the contributions of the cos and sin functions; k1 and k2 the

decay of the functions; and θ and φ the period of the functions at distance r from the center. The

ImageJ module DeconvolutionJ, written by N. Linnenbrügger, accomplished deconvolution of

image stacks. DeconvolutionJ uses a regularized Wiener filter to deconvolve in-focus light from

low-frequency out-of-focus light. One or two image stack sections were selected for

presentation, with the maximal intensity from each slice added to the final z-section. For each

image, a background value was subtracted and the signal intensity was normalized between the

values of 0 and 255. Images were colored red, green, or blue, and overlaid and annotated in the

final figures with the program Adobe Photoshop.

Colocalization correlation determination

To evaluate the colocalization between intimin and nucleolin on the surface of HEp-2 cells a

cross-correlation analysis was performed. Intimin and nucleolin were immunostained with the

fluorescent dyes Alexa Fluor-555 and Alexa Fluor-480, respectively. Images obtained through

the red and green filter sets were deconvolved and normalized as described above. Numerical

values of the pixel intensities for the separate images were converted to text strings by the


11


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

program ImageJ. The intensity of staining was compared at each X-Y coordinate pair of the

separate images. For the intimin-stained images, pixels with intensity values greater than 50

were considered valid for inclusion in the correlation analysis. The Pearson correlation

coefficient, r = n(ΣXY)-(ΣX)(ΣY)/((nΣX 2-(ΣX)2)(nΣY2-(ΣY)2)½ , was evaluated by the

program Microsoft Excel from valid X-Y intensity pairs. The significance of the correlation

value was determined from a two-tailed paired t-test.

RESULTS

Intimin types alpha, beta and gamma bound to nucleolin with similar affinity.

Previously we demonstrated that intimin-γ of EHEC O157:H7 binds to nucleolin isolated from

HEp-2 cells (32). One purpose of the present study was to determine if other intimin types

interact with nucleolin. To answer this question, recombinant versions of nucleolin and various

intimin extracellular domains were purified and used in an in vitro binding assay. Recombinant

6H-nucleolin was absorbed onto the wells of a microtiter plate. To measure the affinity of

intimin for nucleolin, a series of two-fold dilutions of biotinylated intimin-α385, intimin-β385,

and intimin-γ380 were incubated with the immobilized 6H-nucleolin. The amount of intimin

that bound in each well was estimated by a change in solution color catalyzed by streptavidin-

peroxidase used to detect the biotin label. The results of this experiment are shown in Fig. 1.

The intimin types tested (alpha, beta and gamma) all bound to human nucleolin. A Scatchard

analysis of each titration was done to estimate the equilibrium dissociation constant (Kd) for the

interaction of intimin with nucleolin. The average Kd values from three separate determinations

are presented in Table 2. These results show that the affinity for nucleolin of all three intimin

types was on the order of 100 nm. Marginal amounts of recombinant intimin bound


12


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

nonspecifically to wells coated only with bovine serum albumin (Fig. 1). The binding data

presented in Fig. 1 have been corrected for the nonspecific background values. Binding of

biotinylated intimin to immobilized 6H-nucleolin was almost completely blocked by the

addition of 10-fold excess of unlabeled recombinant intimin (data not shown), a finding that

demonstrates the specificity of the binding reaction.

Intimin types alpha, beta and gamma bound to TirO157 with similar affinity.

Several reports have shown that different intimin types are able to bind the same Tir molecule,

i.e. that the intimin-binding domain of Tir is functionally interchangeable between organisms

(17,37,38). Because the interaction between intimin and Tir has been well documented, we used

the association between the different intimin types and TirO157 as a positive control for the

protein binding titration. Purified TirO157 was absorbed onto the wells of a PVC microtiter plate.

Serial two-fold dilutions of intimin-α385, intimin-β385, and intimin-γ380 were incubated with

immobilized TirO157. Biotin-labeled intimin that had bound in the wells was detected as

described. The results of this experiment, corrected for nonspecific background binding, are

presented in Fig. 1. Scatchard analysis of the titrations gave equilibrium dissociations from the

binding data. The average Kd value from three separate determinations is shown in Table 2.

This experiment confirms that the three different intimin types had comparable equilibrium

binding constants for TirO157.

Tir blocks the association between intimin and nucleolin.

One objective of this research was to observe the simultaneous interactions between intimin, Tir

and nucleolin. If intimin has separate, distinct binding sites for Tir and nucleolin, than both

molecules should bind concurrently to intimin. On the other hand, if the binding sites for the

receptors are overlapping or in close proximity then steric hindrance would prevent both


13


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

molecules from binding to intimin simultaneously. To test these possibilities we examined the

competition between TirO157 and 6H-nucleolin for a limited number of intimin binding sites.

The recombinant protein 6H-nucleolin was absorbed onto the wells of a microtiter plate.

Intimin-γ380 was incubated with immobilized nucleolin in a solution containing various

concentrations of TirO157. After equilibrium had been established, intimin not bound to

nucleolin was washed from the wells, and bound intimin was detected as described. The results

of this experiment are shown in Fig. 2A. With increasing concentrations of TirO157, the amount

of intimin-γ380 bound to 6H-nucleolin was diminished. There was no association between

TirO157 and immobilized 6H-nucleolin as measured by anti-Tir Enzyme-Linked Immunoassay (data

not shown). This observation ruled out the possibility that intimin adherence was blocked by

TirO157 that had bound nucleolin. The fraction of intimin-γ380 that was bound to 6H-nucleolin as a

function of TirO157 concentration is presented in Fig. 2B. These data were consistent with a

simple competition between the receptors in which one molecule of Tir was able to block one

molecule of intimin from binding to nucleolin. TirO157 was also able to block the interaction

between 6H-nucleolin and intimin-α385 and intimin-β385 (data not shown).

Intimin of types alpha, beta and gamma associated with endogenous nucleolin and Tir on the

surface of HEp-2 cells.

In an earlier report, we showed by immunofluorescent staining that recombinant intimin-γ of

EHEC O157 binds to the surface of HEp-2 cells in regions that contain nucleolin (32). In the

present study, we investigated the association of the three different intimin types with native

nucleolin in the presence or absence of translocated Tir. Intimin-α385, intimin-β385, and

intimin-γ380 were added to the supernatant of HEp-2 cell monolayers. Intimin bound to the cell

surface was detected with a labeled antibody directed against the amino-terminal histidine tag.


14


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Native nucleolin expressed by the cells and localized to the plasma membrane was detected with

the appropriate primary and secondary anti-sera. Fig. 3A shows that the staining pattern for

each intimin type (stained red) demonstrated overlap with the staining pattern for cell surface-

localized nucleolin (stained green) as revealed by the orange/yellow color in the merged images.

A typical cross-correlation plot of the staining intensity for nucleolin compared with that of

intimin is presented in Fig. 4A. Values of the Pearson product moment correlation coefficient

were determined to be 0.38, 0.42 and 0.40, all with p < 0.0005, for intimin-α385, intimin-β385,

and intimin-γ380 respectively. These results demonstrate that there was a statistically significant

co-localization between intimin and nucleolin. The intimin deletion mutant EHEC O157:H7

86-24eae∆10 was used to insert Tir into the HEp-2 cell plasma membrane. Because this mutant

bacterium did not express a functional intimin, it was unable to adhere to the infected cells by

means of Tir. HEp-2 cells with both nucleolin and Tir on the surface showed a distinctly

different pattern for binding of recombinant intimin. Fig. 3B illustrates that in cells with Tir in

the plasma membrane, there was an increase in the amount of intimin-α385 bound to the cell

surface, and there was not extensive overlap between the intimin and nucleolin staining patterns.

Tir (stained blue) localization did overlap with regions of increased intimin binding as denoted

by the purple color in the merged image. When Tir was present, the association between intimin

and nucleolin decreased, and there were clearly regions of intimin staining without nucleolin.

Figure 4B shows a typical cross-correlation plot for the intimin and nucleolin staining intensity

on cells with Tir inserted into the plasma membrane. There was no significant correlation

between intimin and nucleolin staining intensity on these cells, with the Pearson correlation

coefficients calculated to be 0.06, 0.06 and 0.04 (all with p>0.25) for intimin-α385, intimin-

β385, and intimin-γ380 respectively.

Nucleolin and polymerized actin segregate beneath intimin-expressing bacteria.


15


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

HEp-2 cell monolayers were co-infected with EHEC O157:H7 strain 86-24eae∆10 (to insert

Tir) and E. coli K12 strains that produced intimin-α939, intimin-β936,or intimin- γ934. These

K12 transformants were used to analyze bacterial adherence promoted by the various intimin

types without the confounding influences of other adherence factors produced by the different

wild-type pathogenic strains. Following a 4-hour infection period with the intimin-expressing

E. coli K12 strains, the HEp2 cells were fluorescently stained for Tir, nucleolin, and actin.

Photomicrographs of these stained cells are presented in Fig. 5. Although most adherent bacteria

stained for Tir (blue) and actin (red), a subset of bacteria also displayed intense nucleolin

immunostaining (green) at the site of adherence. Little to no nucleolin stain was observed in

regions with actin polymerized beneath the adherent bacteria. These observations suggest that

nucleolin was excluded from the regions of Tir-mediated intimate adherence promoted by all

intimin types. To observe the association of nucleolin with wild-type bacteria that express

intimin, HEp-2 cells were infected with EPEC O126:H6 or EHEC O157:H7. The cells were

stained for Tir, nucleolin, and actin following bacterial infection (Fig. 5). Actin and Tir were

evident beneath the wild-type bacteria, but nucleolin appeared to be excluded from those regions

directly under the bacteria where polymerization of actin was evident. We surmise that such

actin engagement indicates tight bacterial adherence. That nucleolin clustered around the sites of

bacterial association with the HEp-2 cells suggests that the intimin-expressing bacteria bound

nucleolin at the initial contact of the organism with the host cell but that these intimin-nucleolin

interactions were displaced by the Tir-driven formation of the actin-rich pedestal.

DISCUSSION

In this investigation, we attempted to analyze the interactions between intimin and two receptors,

bacterially-encoded Tir and host-cell expressed nucleolin. We found that intimin of types

alpha, beta, and gamma each bound to nucleolin with similar dissociation constants that were on

the order of 100 nM. We previously reported (32) that purified intimin-γ binds to the surface of


16


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

HEp-2 cells with a dissociation constant of approximately 90 nM, a value close to that which we

obtained for the interaction with purified nucleolin. Frankel et al. (29) first demonstrated that the

extracellular domain of these different intimin types bound in a punctate distribution to HEp-2

cells. Our data extends this observation to show that the different intimin types each bind to cells

in regions that contained nucleolin. The binding data and immunofluorescence experiments

support the hypothesis that nucleolin is the primary intimin receptor on uninfected tissue culture

cells. Differences in sequence between the various intimin types were previously shown to

influence the site of bacterial adherence in the host intestine (13,14,38,39). Our finding that the

three types of intimin had similar affinity for nucleolin suggests that this interaction is not

involved in intimin-mediated tissue tropism. The association between intimin and nucleolin

may represent a common host-cell adherence mechanism exhibited by all A/E lesion-forming

pathogens.

The interaction of intimin-gamma with Tir produced by EHEC O157:H7 was reported by

DeVinney et. al (17) to have a dissociation constant of approximately 10 nM. We measured

intimin-Tir dissociation constants of approximately 20 nM. These values are relatively close,

and the discrepancy between them may be attributed to different experimental methods. From

these data, we can conclude that the affinity of intimin for Tir is 5 to 10 times stronger than the

affinity for nucleolin. When Tir and nucleolin were presented simultaneously, we found that Tir

blocks intimin from adhering to nucleolin. This observation indicates that either nucleolin and

Tir have overlapping binding sites on the C-type lectin domain of intimin, or that Tir binding

induces a conformational change in intimin that precludes nucleolin association. There is no

apparent sequence homology between Tir and human nucleolin so we feel it is unlikely that

nucleolin acts as a Tir mimic. Although we do not understand the exact mechanism by which Tir

blocks nucleolin binding, the affinity results would suggest that Tir is the preferred receptor for

intimin. Nevertheless, when endogenous nucleolin and Tir were presented simultaneously in the

milieu of the plasma membrane, we found that recombinant intimin bound to both receptors.


17


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

For A/E lesion-forming bacteria, intimin-mediated adherence occurs in conjunction with

many other adherence factors (40-42). To focus on potential differences in adherence caused by

the different intimin types, the eae genes were cloned from the wild-type bacteria and expressed

in an E. coli K12 background. Previous work showed that K12 strains that express intimin, or

latex beads coated with intimin can induce pedestal formation when Tir is inserted into the

plasma membrane by an intimin-deletion strain (15,37). Immunofluorescent staining showed

nucleolin accumulation beneath adherent bacteria only in regions where there was no Tir-

induced actin polymerization. This observation supports the idea that intimin on the bacterial

surface can bind to the bacterial receptor or the eucaryotic receptor but can not adhere

simultaneously through both. When HEp-2 cells were infected by EPEC or EHEC, only Tir and

polymerized actin staining were observed directly beneath the adherent bacteria. Nucleolin

staining was observed in proximity to the site of attachment, but significant accumulation did not

appear directly beneath the bacteria. The difference in nucleolin staining observed between the

E. coli K12 strains that express intimin and the wild-type A/E pathogens may be due to the fact

that the K12 strains express significantly more intimin than the pathogens (verified by Western

blot analysis).

The data that we have presented suggests that intimin-mediated bacterial adherence involves

competition between Tir and nucleolin. How does this competition relate to the process of

infection by these pathogenic microorganisms? Our current understanding of the infection

process is that the host ingests the bacteria, which then pass through the stomach and into the

large intestine. Once in the intestine these bacteria move through the mucus layer and come into

contact with the luminal mucusol epithelium were Tir is inserted into host cell membranes. The

role of Tir in linking the bacterium to the host-cell cytoskeleton is well established. The

observation that Tir interaction with intimin appeared to dominate the later stages of adherence

to tissue culture cells implies that any interactions between intimin and nucleolin must occur

prior to the insertion of Tir and the formation of actin-rich pedestals. The interaction between


18


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

intimin and nucleolin is not sufficient to promote bacterial attachment, and for that reason it is

unlikely that nucleolin is acting solely as a passive receptor for intimin. One characteristic of C.

rodentium infection in mice is the induction of colonic hyperplasia. Higgins et al have shown

that intimin alone is able to produce a similar hyperplasia in mice, and have proposed that

intimin interactions with some host-cell receptor produce this response (43). The interaction

between intimin and nucleolin may play role in the proinflammatory response induced in host

cells during infection by the A/E lesion forming pathogens. Adherence of these bacteria has

been reported to induce the mitogen-activated protein (MAP) kinase cascade, leading to the

production of proinflammatory cytokines (44-47). Activation of the MAP-kinases has been

reported to be both intimin dependant and independent (44,48). Nucleolin is one target of

several MAP-kinases including p38 (49), extracellular-regulated kinase (50), and casein kinase

2 (51,52). Of particular note is the recent work of Savkovic et al who showed that protein kinase

C (PKC)-zeta is involved in EPEC induced inflammatory responses of infected cells (53).

Nucleolin is a PKC-zeta substrate and has been shown to be involved in cell-surface signaling

(54). One possible result of the competition between nucleolin and Tir is that the initial contacts

between intimin and the host cell may trigger the extracellular signaling cascade that promotes

bacterial dissemination while the later contacts with Tir promote tight adherence. Although we

do not yet fully understand the role of nucleolin in intimin-mediated bacterial adherence, these

data in aggregate support a model in which intimin interactions with nucleolin are distinct from

the interactions with Tir that occur during adherence.

ACKNOWLEDGMENTS

This work was supported by National Institutes of Health grant AI 20148-21 (A.O.B).

We gratefully acknowledge Dr. James Kaper for providing Citrobacter rodentium as our source


19


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

of intimin-β, and Dr. Louise Teel for her careful reading and advice on this manuscript.


20


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

REFERENCES1. Jerse, A. E. and Kaper, J. B. (1991) Infect.Immun. 59, 4302-4309

2. Yu, J. and Kaper, J. B. (1992) Mol.Microbiol. 6, 411-417

3. Schauer, D. B. and Falkow, S. (1993) Infect.Immun. 61, 2486-2492

4. McGraw, E. A., Li, J., Selander, R. K., and Whittam, T. S. (1999) Mol.Biol.Evol. 16, 12-22

5. Donnenberg, M. S., Tacket, C. O., James, S. P., Losonsky, G., Nataro, J. P., Wasserman, S. S., Kaper, J. B., and Levine, M. M. (1993) J.Clin.Invest 92, 1412-1417

6. Donnenberg, M. S., Tzipori, S., McKee, M. L., O’Brien, A. D., Alroy, J., and Kaper, J. B. (1993) J.Clin.Invest 92, 1418-1424

7. Schauer, D. B. and Falkow, S. (1993) Infect.Immun. 61, 4654-4661

8. McKee, M. L., Melton-Celsa, A. R., Moxley, R. A., Francis, D. H., and O’Brien, A. D. (1995) Infect.Immun. 63, 3739-3744

9. Tarr, C. L. and Whittam, T. S. (2002) J.Bacteriol. 184, 479-487

10. Ramachandran, V., Brett, K., Hornitzky, M. A., Dowton, M., Bettelheim, K. A., Walker, M. J., and Djordjevic, S. P. (2003) J.Clin.Microbiol. 41, 5022-5032

11. Frankel, G., Philips, A. D., Novakova, M., Batchelor, M., Hicks, S., and Dougan, G. (1998) Mol.Microbiol. 29, 559-570

12. Phillips, A. D. and Frankel, G. (2000) J.Infect.Dis. 181, 1496-1500

13. Reece, S., Simmons, C. P., Fitzhenry, R. J., Matthews, S., Phillips, A. D., Dougan, G., and Frankel, G. (2001) Mol.Microbiol. 40, 86-98

14. Fitzhenry, R. J., Pickard, D. J., Hartland, E. L., Reece, S., Dougan, G., Phillips, A. D., and Frankel, G. (2002) Gut 50, 180-185

15. Rosenshine, I., Ruschkowski, S., Stein, M., Reinscheid, D. J., Mills, S. D., and Finlay, B. B. (1996) EMBO J. 15, 2613-2624

16. Kenny, B., DeVinney, R., Stein, M., Reinscheid, D. J., Frey, E. A., and Finlay, B. B. (1997) Cell 91, 511-520

17. DeVinney, R., Stein, M., Reinscheid, D., Abe, A., Ruschkowski, S., and Finlay, B. B.


21


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(1999) Infect.Immun. 67, 2389-2398

18. Deng, W., Vallance, B. A., Li, Y., Puente, J. L., and Finlay, B. B. (2003) Mol.Microbiol. 48, 95-115

19. Jarvis, K. G., Giron, J. A., Jerse, A. E., McDaniel, T. K., Donnenberg, M. S., and Kaper, J. B. (1995) Proc.Natl.Acad.Sci.U.S.A 92, 7996-8000

20. Knutton, S., Rosenshine, I., Pallen, M. J., Nisan, I., Neves, B. C., Bain, C., Wolff, C., Dougan, G., and Frankel, G. (1998) EMBO J. 17, 2166-2176

21. Knutton, S., Baldwin, T., Williams, P. H., and McNeish, A. S. (1989) Infect.Immun. 57, 1290-1298

22. Celli, J., Deng, W., and Finlay, B. B. (2000) Cell Microbiol. 2, 1-9

23. McDaniel, T. K., Jarvis, K. G., Donnenberg, M. S., and Kaper, J. B. (1995) Proc.Natl.Acad.Sci.U.S.A 92, 1664-1668

24. Jerse, A. E., Yu, J., Tall, B. D., and Kaper, J. B. (1990) Proc.Natl.Acad.Sci.U.S.A 87, 7839-7843

25. Deng, W., Li, Y., Vallance, B. A., and Finlay, B. B. (2001) Infect.Immun. 69, 6323-6335

26. Frankel, G., Candy, D. C., Fabiani, E., Adu-Bobie, J., Gil, S., Novakova, M., Phillips, A. D., and Dougan, G. (1995) Infect.Immun. 63, 4323-4328

27. Hartland, E. L., Batchelor, M., Delahay, R. M., Hale, C., Matthews, S., Dougan, G., Knutton, S., Connerton, I., and Frankel, G. (1999) Mol.Microbiol. 32, 151-158

28. Phillips, A. D., Giron, J., Hicks, S., Dougan, G., and Frankel, G. (2000) Microbiology 146, 1333-1344

29. Frankel, G., Candy, D. C., Everest, P., and Dougan, G. (1994) Infect.Immun. 62, 1835-1842

30. Frankel, G., Lider, O., Hershkoviz, R., Mould, A. P., Kachalsky, S. G., Candy, D. C., Cahalon, L., Humphries, M. J., and Dougan, G. (1996) J.Biol.Chem. 271, 20359-20364

31. Isberg, R. R. and Leong, J. M. (1990) Cell 60, 861-871

32. Sinclair, J. F. and O’Brien, A. D. (2002) J.Biol.Chem. 277, 2876-2885

33. Srivastava, M. and Pollard, H. B. (1999) FASEB J. 13, 1911-1922


22


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

34. Batchelor, M., Prasannan, S., Daniell, S., Reece, S., Connerton, I., Bloomberg, G., Dougan, G., Frankel, G., and Matthews, S. (2000) EMBO J. 19, 2452-2464

35. Luo, Y., Frey, E. A., Pfuetzner, R. A., Creagh, A. L., Knoechel, D. G., Haynes, C. A., Finlay, B. B., and Strynadka, N. C. (2000) Nature 405, 1073-1077

36. Reece, S., Simmons, C. P., Fitzhenry, R. J., Ghaem-Maghami, M., Mundy, R., Hale, C., Matthews, S., Dougan, G., Phillips, A. D., and Frankel, G. (2002) Microbes.Infect. 4, 1389-1399

37. Liu, H., Magoun, L., Luperchio, S., Schauer, D. B., and Leong, J. M. (1999) Mol.Microbiol. 34, 67-81

38. Hartland, E. L., Huter, V., Higgins, L. M., Goncalves, N. S., Dougan, G., Phillips, A. D., MacDonald, T. T., and Frankel, G. (2000) Infect.Immun. 68, 4637-4646

39. Tzipori, S., Gunzer, F., Donnenberg, M. S., de Montigny, L., Kaper, J. B., and Donohue-Rolfe, A. (1995) Infect.Immun. 63, 3621-3627

40. Giron, J. A., Ho, A. S., and Schoolnik, G. K. (1991) Science 254, 710-713

41. Torres, A. G. and Kaper, J. B. (2003) Infect.Immun. 71, 4985-4995

42. Hicks, S., Frankel, G., Kaper, J. B., Dougan, G., and Phillips, A. D. (1998) Infect.Immun. 66, 1570-1578

43. Higgins, L. M., Frankel, G., Connerton, I., Goncalves, N. S., Dougan, G., and MacDonald, T. T. (1999) Science 285, 588-591

44. Czerucka, D., Dahan, S., Mograbi, B., Rossi, B., and Rampal, P. (2001) Infect.Immun. 69, 1298-1305

45. Savkovic, S. D., Ramaswamy, A., Koutsouris, A., and Hecht, G. (2001) Am.J.Physiol Gastrointest.Liver Physiol 281, G890-G898

46. De Grado, M., Rosenberger, C. M., Gauthier, A., Vallance, B. A., and Finlay, B. B. (2001) Infect.Immun. 69, 6217-6224

47. Dahan, S., Busuttil, V., Imbert, V., Peyron, J. F., Rampal, P., and Czerucka, D. (2002) Infect.Immun. 70, 2304-2310

48. Berin, M. C., Darfeuille-Michaud, A., Egan, L. J., Miyamoto, Y., and Kagnoff, M. F. (2002) Cell Microbiol. 4, 635-648


23


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

49. Yang, C., Maiguel, D. A., and Carrier, F. (2002) Nucleic Acids Res. 30, 2251-2260

50. Westmark, C. J. and Malter, J. S. (2001) J.Biol.Chem. 276, 1119-1126

51. Schneider, H. R. and Issinger, O. G. (1988) Biochem.Biophys.Res.Commun. 156, 1390-1397

52. Dumler, I., Stepanova, V., Jerke, U., Mayboroda, O. A., Vogel, F., Bouvet, P., Tkachuk, V., Haller, H., and Gulba, D. C. (1999) Curr.Biol. 9, 1468-1476

53. Savkovic, S. D., Koutsouris, A., and Hecht, G. (2003) Am.J.Physiol Cell Physiol 285, C512-C521

54. Zhou, G., Seibenhener, M. L., and Wooten, M. W. (1997) J.Biol.Chem. 272, 31130-31137

55. Levine, M. M., Bergquist, E. J., Nalin, D. R., Waterman, D. H., Hornick, R. B., Young, C. R., and Sotman, S. (1978) Lancet 1, 1119-1122

56. Barthold, S. W., Coleman, G. L., Bhatt, P. N., Osbaldiston, G. W., and Jonas, A. M. (1976) Lab Anim Sci. 26, 889-894

57. Ostroff, S. M., Griffin, P. M., Tauxe, R. V., Shipman, L. D., Greene, K. D., Wells, J. G., Lewis, J. H., Blake, P. A., and Kobayashi, J. M. (1990) Am.J.Epidemiol. 132, 239-247


24


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

FIGURE LEGENDS

Fig. 1. Protein titration of the intimin extracellular domain bound to 6H-nucleolin or TirO157. A

range of concentrations of purified intimin-α385 (squares), intimin-β385 (diamonds) or intimin-

γ380 (circles) were added to microtiter plate wells that contained purified TirO157 (open symbols)

or 6H-nucleolin (closed symbols). The fraction of receptor with intimin bound (y-axis) was

determined for each intimin concentration (x-axis) as described in experimental procedures.

The solid line through each data set is a theoretical binding curve calculated from the equilibrium

constants listed in Table 2. Each data point represents the average of three repeats. The error

bars that bracket each symbol approximate the standard error of the mean of three replicate

determinations. Each data set was corrected for nonspecific background intimin binding.

Representative background measurements are shown for intimin bound in wells coated with

bovine serum albumin (x and *).

Fig. 2. Binding competition for the interaction of intimin-γ380 with TirO157 and 6H-nucleolin.

Panel A: 6H-nucleolin was immobilized in the wells of a PVC microtiter plate. Intimin-γ380

titrations (x-axis) were performed in the presence of TirO157 at concentrations of 1 µM (+), 500

nM (triangle), 250 nM (-), 125 nM (diamond), 62 nM (square), 16 nM (X) and without TirO157

(circle). The fraction of immobilized 6H-nucleolin with intimin bound (y-axis) was measured

as described in experimental procedures. TirO157 in solution with the recombinant intimin

blocked binding to 6H-nucleolin in a concentration dependant manner. The data in panel A

were corrected for non-specific binding of intimin-γ380 to control wells coated with bovine

serum albumin. The solid line through each data set is calculated from a simple two-state

binding equilibrium. Panel B: The fraction of immobilized nucleolin with intimin-γ380 bound


25


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(y-axis) is shown for one inimin-γ380 concentration of 250 nM and various TirO157

concentrations (x-axis). The solid line is a theoretical fit to the data for a competitive inhibition

models for two ligands with equilibrium dissociation constants of 20 and 100 nM. The error bars

approximate the average standard error of the mean between replicate determinations.


26


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 3. HEp-2 cell binding assay for various types or recombinant intimin. Panel A: Solutions

of intimin-α385 (top), intimin-β385 (middle) or intimin-γ380 (bottom) were incubated with sub-

confluent HEp-2 cell monolayers. Intimin (red) and nucleolin (green) were immunostained with

the appropriate primary and secondary antiserum as described in experimental procedures.

Merged fluorescence micrographs (right column) of the two stains demonstrate a strong

correlation between the location of bound intimin and nucleolin for each intimin type.

Panel B: Subconfluent HEP-2 cell monolayers were infected with intimin deletion strain EHEC

86-24eae∆10 to insert Tir into the HEp-2 plasma membrane. Intimin-α385 (red), nucleolin

(green) and Tir (blue) were stained with labeled primary immunoserum as described. A merged

fluorescence micrograph of the three stains demonstrates that in preinfected cells the

recombinant intimin associates with both Tir and nucleolin while in uninfected cells intimin only

associates with regions of nucleolin expression. All micrographs were obtained at 40X original

magnification.

Fig. 4. An evaluation of the correlation between intimin and nucleolin immunostains, in the

absence and presence of Tir. Intimin and nucleolin were stained red and green, respectively, as

depicted in figure 3. Pixel intensity values were obtained at each X-Y coordinate for the

fluorescence images. The pixel intensity from the nucleolin (green) stain is plotted on the y-axis

as a function of the intensity of the intimin (red) stain on the x-axis for HEp-2 cells (panel A)

and HEp-2 cells with Tir inserted into the plasma membrane (Panel B). The solid line is a linear

fit of the X-Y coordinate intensity pairs. For all three intimin types, typical Pearson correlation

coefficients were calculated to be 0.4 in the absence of Tir and 0.06 in the presence of Tir.

Fig. 5. Nucleolin, Tir and actin staining observed at sites of intimin-mediated bacterial

adherence. HEp-2 cell monolayers were co-infected with the intimin deletion strain EHEC 86-

24eae∆10 and with E. coli K12 strains that expressed full-length intimin-α939, intimin-β936 or


27


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

intimin-γ934. After a 4-hour infection the bacteria and cells were fixed with buffered 2%

formaldehyde and then permeabilized with 0.1% Tween-20. Tir and nucleolin were stained with

labeled primary immunoserum as described in the experimental procedures. Polymerized actin

was stained with labeled phalloidin. In addition HEp-2 monolayers were infected with wild-

type EPEC O126:H6 or EHEC O157:H7 for 4 hours and the cells were stained in the same

manner as the co-infection. Fluorescence photomicrographs (original magnification of 100x) of

the staining patterns for Tir (blue), nucleolin (green) and actin (red) are presented for the bacteria

shown in the phase contrast images in the column to the right. Images in the top three rows are

bacteria that expressed intimin types alpha, beta and gamma. Micrographs of cells infected with

the pathogenic bacteria are presented in the bottom two rows. Merged pictures of the three-

color staining revealed that regions of nucleolin accumulation were distinct from regions of Tir-

induced actin polymerization beneath the adherent bacteria.


28


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

TABLE 1: Bacterial strains and recombinant proteins used for this study

_______________________________________________________________________

EPEC O127:H6 strain E2348/69:

Isolated from a patient in Taunton, England (55). Produces intimin type alpha

Citrobacter rodentium:

Isolated from laboratory mice (56). Produces intimin type beta

EHEC O157:H7 strain 86-24:

Isolated in 1986 from a patient in Seattle, Wash (57). Produces intimin type gamma.

BL21(DE3):

E. coli K12 strain used for the expression of recombinant intimin

Intimin-α939: Full-length intimin alpha

Intimin-β936: Full-length intimin beta

Intimin-γ934: Full-length intimin gamma

Intimin-α385: Histidine-tagged extracellular domain of intimin alpha

Intimin-β385: Histidine-tagged extracellular domain of intimin beta

Intimin-γ385: Histidine-tagged extracellular domain of intimin gamma

TirO157: Full-length Tir from EHEC O157:H7

6H-nucleolin: Histidine-tagged human nucleolin

______________________________________________________________________


29


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

TABLE 2: Equilibrium dissociation constants obtained from Scatchard analysis of intiminbinding to nucleolin or Tir. Intimin fragment 6H-nucleolin

dissociation constant aTirO157

dissociation constant a

Intimin-α385 120.3 (+/-10.0) 22.1 (+/-1.4)

Intimin-β385 88.0 (+/-10.0) 17.5 (+/-1.1)

Intimin-γ380 100.0 ( +/-3.3) 17.0 (+/-1.2)

a The reported constants represent the average of three separate determinations obtained onthree different occasions. The values in parentheses are the average of the standard errorvalues from the three determinations.


30


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

James F. Sinclair and Alison D. O'Brienlower avidity than to the translocated intimin receptor

Intimin types alpha, beta, and gamma bind to nucleolin with equivalent affinity but

published online June 1, 2004J. Biol. Chem.

10.1074/jbc.M401616200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M401616200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M401616200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/06/01/jbc.M401616200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/06/01/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/06/01/jbc.M401616200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Intimin Types , and Bind to Nucleolin With Equivalent ... · intestinal epithelium include...

Documents

Transcript of Intimin Types , and Bind to Nucleolin With Equivalent ... · intestinal epithelium include...