brief communications

A new internal-ribosome-entry-site motif potentiates XIAP- mediated cytoprotection

Martin Holcik*, Charles Lefebvre†, Chiaoli Yeh‡, Terry Chow‡ and Robert G. Korneluk*†§¶*Solange Gauthier-Karsh Molecular Genetics Laboratory, Children’s Hospital of Eastern Ontario, 401 Smyth Road, Ottawa, Ontario K1H 8L1, Canada

†Apoptogen Inc., Ottawa, Ontario K1H 8M5, Canada‡Department of Oncology, McGill University, Montreal PQ H3G 1A4, Canada

§Department of Microbiology and Immunology, University of Ottawa, Ottawa, Ontario K1H 8M5, Canada¶e-mail: bob@mgcheo.med.uottawa.ca

rogrammed cell death (apoptosis) plays a critical part in regu-lating cell turnover during embryogenesis, metamorphosis,tissue homeostasis and viral infection1. Dysregulation of apop-

tosis occurs in such pathologies as cancer, autoimmunity, immun-odeficiency and neurodegeneration. Proteins of the inhibitor-of-apoptosis (IAP) family are intrinsic cellular suppressors of apopto-sis and are represented by highly conserved members found frominsect viruses to mammals2–4. The most potent mammalian IAP isthe X-linked IAP, or XIAP5, whose mechanism of action involvesdirect inhibition of caspases 3 and 7, key proteases of the apoptoticcascade6. Cellular control of XIAP expression should be fundamen-tal to a cell’s ability to modulate its responses to apoptotic stimuli.However, XIAP messenger RNA is expressed in most tissues andcells at fairly constant levels5, indicating that translational control ofXIAP levels may be an important regulatory mechanism. Here wecharacterize the primary genomic structure and function of XIAP,and show that XIAP expression is controlled at the translationallevel, specifically through an internal ribosome-entry site (IRES).

Several features of XIAP mRNA indicate that it may be transla-

tionally regulated, including an unusually long 5′ untranslatedregion (UTR) (>5.5 kilobases (kb) for murine and >1.6 kb forhuman XIAP transcripts) with predicted complex secondary struc-ture and numerous potential translation start sites upstream of theauthentic initiation codon. This UTR would be expected to presenta significant obstacle to efficient translation by conventional ribos-ome scanning7. An alternative mechanism of translation initiation,mediated through the IRES, has been identified in picornavirusesand in a few cellular mRNAs8. Thus we tested whether the 5′ UTRof XIAP mRNA could be involved in translation initiation fromreporter-based bicistronic mRNA transcripts encoding β-galactos-idase and chloramphenicol aceytyltransferase (CAT) (for example,see ref. 9). (Translation of β-galactosidase is driven by the 5′ mRNAmethylguanosine cap.) Both human and mouse XIAP 5′ UTRsdirected translation of the second cistron (encoding CAT) at 150-fold higher levels than those produced without the 5′ UTR or withthe 5′ UTR in reverse orientation, suggesting the presence of anIRES (Fig. 1a). No activity was detected when using the identicalDNA segments cloned into a promoterless construct, confirming

P

Figure 1 The 5′ UTR of mouse and human XIAP mRNA contains functional IRES elements. a, DNA segments corresponding to the indicated regions of the 5′ UTR of human (h) or mouse (m) XIAP transcripts were inserted (in the indicated directions) into the XhoI site of the linker region (LR) of the bicistronic plasmid pβgal/CAT (where βgal is β-galactosidase); HeLa cells were transfected with these plasmids (2 µg each). The promoterless CAT reporter plasmid pCATbasic/UTR was constructed by inserting the indicated 5′ UTR region into the pCATbasic vector, and in this case HeLa cells were co-transfected with both the pCATbasic/hUTR and the pCMVβ plasmids as described in Methods (only the construct with the human 5′ UTR is shown). After 24 h, cell extracts were prepared and the βgal12 and CAT13 activities were determined. Relative CAT activity was calculated by normalizing with βgal activity. Expression of the CAT cistron from the pβgal/CAT construct was set as 1.

The bars represent the average ± s.d. of five independent transfections. Identical results were obtained with NIH3T3 cells (data not shown). b, Deletion and mutational analysis. DNA segments corresponding to indicated regions of the 5′ UTR of the human XIAP transcript were inserted into the XhoI site of the LR of the pβgal/CAT plasmid. The small black boxes indicate the position of the PPT. Plasmids with mutated PPT were constructed by PCR-directed mutagenesis. The sequence of the PPT is indicated for each construct; base substitutions are underlined. Monocistronic plasmids (pMONO) were constructed by deleting the βgal cistron (NotI site) from respective plasmids. Cell culture and determination of βgal and CAT activity were done as in a. The bars represent the average ± s.d. of three independent transfections. Py, pyrimidine substitution.

200 40 60 80 100 120 140 160Relative CAT activity

βgalCMV CAT polyA

polyA

LR

–1

–1395

–1395

–1007

–1007

–1007–1

–1

–1 (AUG)

–1 (AUG)

pβgal/CATβgalCMV CAT polyALR

pβgal/CAT

pβgal/hUTR/CAT

pβgal/mUTR/CAT

pβgal/hRTU/CAT

pβgal/mRTU/CATCAThUTR

pCATbasic/hUTR

Xhol

a b

–34–1007pβgal/3'(–34)/CAT

–1007 AAUUCUCUUUUUAGAAGAGAAAAA

–1007 UGAACUCUUUUU–1007 UGUUAACUUUUU–1007 UGUUCUAAUUUU–1007 UGUUCUCUAAUU–1007 UGUUCUCUUUAA

–1007pβgal/Py-Pu/CATpβgal/Py(–46,45AA)/CATpβgal/Py(–44,43AA)/CATpβgal/Py(–42,41AA)/CATpβgal/Py(–40,39AA)/CATpβgal/Py(–38,37AA)/CATpβgal/Py(–36,35AA)/CAT

–47–1007pβgal/3'(–47)/CAT

–1–162pβgal/5'(–162)/CAT–1–83pβgal/5'(–83)/CAT

–34–1007pβgal/∆(–162;–47)/CAT

–1(AUG)–1007

UGUUCUCUUUUU

pβgal/hUTR/CAT

polyA

polyA

polyA

polyA

CAT

CAT

CAT

CAT

pCMV/CAT

–1007

–1007

–1

–1

hUTR

hUTR

hRTU

MONO/hUTR/CAT

MONO/hRTU/CAT

MONO/Py(–42,41AA)/CAT–1007 –1

hUTR

Xhol

X

0 20 40 60 80 100 120Relative CAT activity

© 1999 Macmillan Magazines Ltd

190 NATURE CELL BIOLOGY | VOL 1 | JULY 1999 | cellbio.nature.com

brief communications

that the 5′ UTR regions do not contain cryptic promoters. To determine which part of the 5′ UTR is responsible for trans-

lation initiation, we generated constructs containing deletions ofthe human XIAP 5′ UTR (Fig. 1b). The region that retained fullIRES activity was the nucleotide segment –162 to –1 upstream ofthe initiation codon; this segment was as effective as the larger 5′UTR. The smallest construct contained only 83 nucleotides of the 5′UTR, but its activity was 25% that of the full-length UTR, being 30-fold higher than that of the bicistronic reporter containing no IRES.In monocistronic plasmids, the 5′ UTR in the sense orientation didnot reduce translation of the reporter gene. However, when theIRES was in the antisense orientation or was mutated (see below),expression was substantially reduced, indicating that XIAP transla-tion may be fully dependent on the IRES (Fig. 1b).

A polypyrimidine tract (PPT) is located 34 nucleotides upstreamof the XIAP mRNA initiation codon. IRES elements of picornaviruscontain a similarly positioned PPT but this sequence has not beenfound in the cellular IRES motifs described so far. Therefore, we

determined whether the PPT is important for XIAP IRES function.Although the sequence between the initiation codon and the PPT isdispensable for XIAP IRES function, deletion of this tract abolishedIRES activity completely (Fig. 1b). A similar result was found forpicornavirus IRES elements, where the PPT is essential for ribos-ome binding10. We next deleted the –162 to –47 nucleotide segmentto determine whether the PPT itself is sufficient for IRES function.This deletion, however, completely abolished IRES activity, show-ing that although the PPT sequence is necessary, it is not sufficientfor internal translation initiation. To study the sequence specificityof the PPT, we tested several base-substitution mutants (Fig. 1b).The substitution of purines for pyrimidines markedly reduced IRESactivity, indicating the need for the PPT. Thus a specific sequencewithin the PPT may be critical for XIAP activity. Significantly, theXIAP IRES is the first cellular IRES to be shown to possess a func-tional PPT.

We then studied the physiological relevance of IRES-mediatedXIAP translation under different cellular stresses. Low-dose irradi-ation resulted in a 3.5-fold upregulation of XIAP protein amountsin the non-small-cell lung carcinoma cell line H661, whereas thelevel of XIAP mRNA remained unchanged (Fig. 2a). The expressionpattern of other IAP genes (HIAP1, HIAP, and NAIP) did notchange (data not shown). We proposed that XIAP expression istranslationally upregulated through the IRES after low-dose irradi-ation. To test this hypothesis, we transfected H661 cells with thebicistronic reporter and measured the translation of both cistronsafter irradiation. The expression of β-galactosidase was reduced to51% of that in non-irradiated cells, but the expression of the IRES-driven CAT reporter was increased (Fig. 2b), indicating that, in theirradiated cells, the upregulation of endogenous XIAP is mediatedby the IRES sequence.

Other cellular stresses, such as poliovirus infection, growtharrest, hypoxia or heat shock, also inhibit cap-dependent, but notIRES-dependent, translation11. We determined whether the XIAPIRES element is functional during overexpression of viral protease2A or serum withdrawal (Fig. 2b). In both cases, the translation ofthe cap-dependent reporter was reduced whereas the translation ofthe XIAP-IRES-driven reporter remained unchanged. Overexpres-sion of XIAP protects cells against apoptosis triggered by various

0

1

2

3

4

mRNA

Protein

0

50

100

150

200

1.0 Gy

Serum

Serumstarvation starvation

pCMV2AControl

HeLa H661

CAT

0 0.5 1.0

0 24 48 720

20

40

60

80

100 LacZ IRES.XIAP

Rel

ativ

e am

ount

of p

rote

in o

r m

RN

A

Act

ivity

of r

epor

ter

rela

tive

to c

ontr

ol

Sur

viva

l (pe

r ce

nt o

f con

trol

)

0 0.5 1.0

βgal XIAP

Time of serum deprivation (h)

a b c

Dose (Gy)

Figure 2 XIAP-IRES-directed translation is resistant to cellular stress. a, XIAP mRNA and protein levels in the non-small-cell lung carcinoma cell line H661 were analysed by northern and western blot analysis following low-dose γ-irradiation. Inset shows representative blots. Changes in XIAP levels were analysed densitometrically and normalized for levels of GAPDH (mRNA) or total protein loaded (average ± s.d. of three experiments). b, HeLa cells were co-transfected with plasmids pβgal/5′(-268)/CAT (2 µg) together with pCMV2A (2 µg) or with the control plasmid pcDNA3 (2 µg), and the βgal and CAT activities were determined 48 h post-transfection. For the irradiation experiment, H661 cells were transfected with plasmid pβgal/5′(-268)/CAT (5 µg). After the transfection procedure, the cells were incubated for 12 h and then irradiated with 60Co γ-rays (1.0 Gy). The βgal and CAT activities were determined

12 h post-irradiation. For the serum-deprivation experiment, HeLa cells were transfected with plasmid pβgal/5′(-268)/CAT (2 µg). The transfected cells were deprived of serum for 24 h and the βgal and CAT activities determined. Expression of each reporter cistron assayed in the control transfection was set at 100% in each case. Bars represent the average ± s.d. of three independent transfections. c, HeLa cells were transfected with 2 µg of plasmid pCI-LacZ, pCI-XIAP or pCI-IRES/XIAP. After 24 h, cells were washed with PBS and grown in fresh serum-free media. The viability of the cells at different time intervals was assessed by a colorimetric assay (see Methods). Bars represent the percentage of surviving cells ± s.d. of three independent experiments done in triplicate.

Table 1 Relative levels of XIAP protein and mRNA in response to stress Relative levels of XIAP*

* Endogenous levels of XIAP protein (western blot) and mRNA (northern blot or ribonucleaseprotection assay) were analysed following either 1.0 Gy ionizing irradiation or serum withdrawal(SW) for 72 h. Changes in XIAP levels were analysed densitometrically, normalized to levels ofGAPDH (mRNA) or total protein loaded, and compared with untreated controls which were set as1 (average ± s.d.).

Cell line Stress trigger Protein mRNA

H661 (non-small-cell carcinoma, lung) 1.0 Gy 3.33±0.05 0.85±0.07H460 (non-small-cell carcinoma, lung) 1.0 Gy 0.34±0.14 0.76±0.11H520 (squamous carcinoma, lung) 1.0 Gy 1.41±0.25 0.76±0.06SKOV3 (adenocarcinoma, ovary) 1.0 Gy 0.73±0.07 0.83±0.19

HeLa (cervical carcinoma) 72 h SW 2.03±0.10 0.91±0.07293 (human embryonic kidney) 72 h SW 2.17±0.32 0.80±0.16HEL299 (human embryonic lung) 72 h SW 1.95±0.04 0.83±0.09SH-SY5Y (neuroblastoma) 72 h SW 1.75±0.32 0.78±0.16

© 1999 Macmillan Magazines Ltd

NATURE CELL BIOLOGY | VOL 1 | JULY 1999 | cellbio.nature.com 191

brief communications

stimuli, including serum withdrawal4. In these experiments, how-ever, only the coding region of the XIAP transcript was used. Wereasoned that if the translation of XIAP is mediated by the IRES ele-ment located within its 5′ UTR, the overexpression of transcriptcontaining IRES should offer greater protection than that seen withthe XIAP coding complementary DNA alone. Indeed, at all timepoints following transfection and serum starvation of HeLa cells,the XIAP IRES protected cells from apoptosis more efficiently thandid the XIAP coding region alone (Fig. 2c). The amount of XIAPprotein produced from the XIAP IRES construct during serum star-vation exceeded that of the construct with XIAP coding regionalone, although the levels of XIAP mRNA transcribed from bothplasmids were the same (data not shown).

What is the biological significance of the internal initiation oftranslation of XIAP? To address this issue, we tested several cell linesfor their ability to upregulate the translation of XIAP mRNA inresponse to cellular stress. IRES-mediated translational upregula-tion of endogenous XIAP without concomitant upregulation ofXIAP mRNA varied in response to different triggers of cellularstress in different cell lines (Table 1). Serum deprivation upregu-lated XIAP protein in all cell lines tested, but low-dose irradiationinduced XIAP translation in only one (H661), possibly two (H520),lines. H661 was the most resistant of the four cell lines to radiation-induced apoptosis (data not shown). A general cellular response toapoptotic stress is the shut-off of cap-dependent protein synthesis.The presence of the IRES would allow for the continuous produc-tion of XIAP, even under stress conditions. The degree of respon-siveness of the IRES element would dictate the cellular threshold ofresponsiveness to apoptotic stimuli. This threshold would be setaccording to the cell’s intrinsic properties or could be manipulatedby external stimulation of IRES-mediated XIAP translation. Ineither case, the induction of XIAP protein might be beneficial to thecell’s survival under acute but transient apoptotic conditions. h

MethodsPlasmid construction.The basic bicistronic vector pβgal/CAT was constructed by inserting the β-galactosidase gene (NotI

fragment) from plasmid pCMVβ (Clontech) and CAT gene (XbaI–BamHI fragment) from plasmid

pCATbasic (Promega) into the linker region of plasmid pcDNA3 (Invitrogen). Two cistrons are

separated by 100 base pairs of the intercistronic linker region containing a unique XhoI site. The

expression of bicistronic mRNA is driven by a cytomegalovirus (CMV) promoter. Monocistronic

plasmids were constructed by deleting the βgal cistron (NotI fragment) from respective plasmids. The

promoterless CAT reporter plasmid pCATbasic/UTR was constructed by inserting the indicated 5 ′ UTR

into the pCATbasic vector. The expression plasmid pCI-IRES/XIAP was constructed by inserting the 1-

kb 5′ UTR of XIAP in front of the XIAP coding region in the plasmid pCI (Invitrogen). The XIAP 5′ UTR

elements of human and mouse XIAP were obtained by reverse transcription with polymerase chain

reaction using human and mouse fetal liver Marathon-Ready cDNAs (Clontech) and XIAP primers

containing a XhoI site. 5′ UTR clones were inserted into the XhoI site of the intercistronic linker region

of plasmid pβgal/CAT. Plasmids with a mutated PPT were constructed by PCR-directed mutagenesis.

The orientation and the proper sequence of the 5′ UTR fragments were confirmed by sequencing.

Cell culture and transient DNA transfections.NIH3T3, HeLa, HEL299, 293 and SH-SY5Y cells were cultivated in DMEM medium; H460, H520, H661

and SKOV3 cells were grown in RMPI medium. All media were supplemented with 10% fetal calf serum

(FCS) and antibiotics. Transient DNA transfections were done using lipofectamine reagent (Gibco; HeLa

and NIH3T3 cells) or the SuperFect transfection reagent (Qiagen; H661 cells) and the manufacturers’

recommended procedures. Briefly, cells were seeded at a density of 1 × 105 per 35-mm well and

transfected 24 h later in serum-free OPTI-MEM medium with 2 µg DNA and 10 µl lipofectamine or

30 µl SuperFect per well. The transfection mixture was replaced 4 h later with DMEM supplemented with

10% FCS. For serum-deprivation experiments, the cells were washed with PBS 24 h post-transfection and

serum-free DMEM was used for subsequent growth. Cells were collected 48 h post-transfection and the

cell extracts analysed for βgal and CAT activities. For the irradiation experiment, the cells were incubated

for 12 h after transfection and then irradiated with 60Co γ-rays at a dose rate of ~1.5 Gy min–1; the βgal

and CAT activities were determined 12 h post-irradiation.

Northern and western blot analysis.Total RNA was prepared by guanidine isothiocyanate/phenol-chloroform extraction using the TRIzol

reagent (Gibco) according to the manufacturer’s protocol. RNA was denatured in formamide and

separated on 0.8% agarose gel. RNA was then transferred onto a nylon membrane (Biodyne) and

hybridized with a XIAP DNA probe labelled with 32P using the Rediprime random primer labelling kit

(Amersham). Membranes were exposed onto an X-ray film (Kodak) overnight using an intensifying

screen (Amersham). Total cell protein extracts were prepared in 20 mM Tris-Cl (pH 7.5), 5 mM EDTA

and 1 mM phenylmethylsulphonyl fluoride (PMSF) by sonication and were cleared by centrifugation at

10,000g for 10 min. The supernatants were loaded onto nitrocellulose membrane using the Bio-Rad slot

blot apparatus. Membranes were probed with the rabbit polyclonal anti-human-XIAP antibody.

ββββ-Galactosidase and CAT analysis.Transiently transfected cells were collected in PBS 48 h post-transfection and cell extracts were prepared

by the freeze–thaw method as described12. βGal enzymatic activity in cell extracts was determined by a

spectrophotometric assay using o-nitrophenol-β-D-galactoside12; CAT activity was determined by a

liquid scintillation method as described13.

Cell-death and cell-survival assays.HeLa cells were seeded at a density of 3 × 105 cells per 35-mm well and transfected as described above. 24

h after transfection, cells were trypsinized and plated on 96-well plates at a density of 3 × 103 cells per well.

Cells were washed with serum-free DMEM 24 h post-trypsinization and were subsequently grown in

serum-free DMEM. Viability of the cells at different time intervals was assessed by the colorimetric assay

based on the cleavage of the tetrazolium salt WST-1 (Boehringer Mannheim) by mitochondrial

dehydrogenases in viable cells, using the manufacturer’s protocol. The fractions of surviving cells were

calculated from three separate experiments done in triplicate.

RECEIVED 12 FEBRUARY 1999; REVISED 22 APRIL 1999; ACCEPTED 5 MAY 1999; PUBLISHED 18 JUNE 1999.

1. White, E. Genes Dev. 10, 1–15 (1996).

2. Deveraux, Q. L. & Reed, J. C. Genes Dev. 13, 239–252 (1999).

3. LaCasse, E. C., Baird, S., Korneluk, R. G. & MacKenzie, A. E. Oncogene 17, 3247–3259 (1998).

4. Liston, P., Young, S. S., Mackenzie, A. E. & Korneluk, R. G. Apoptosis 2, 423–441 (1997).

5. Liston, P. et al. Nature 379, 349–353 (1996).

6. Deveraux, Q. L., Takahashi, R., Salvesen, G. S. & Reed, J. C. Nature 388, 300–304 (1997).

7. Merrick, W. C. & Hershey, J. W. B. in Translational Control (eds Hershey, J. W. B., Mathews,

M. B. & Sonenberg, N.) 31–69 (Cold Spring Harb. Lab. Press, Cold Spring Harbor, 1996).

8. Sachs, A. B., Sarnow, P. & Hentze, M. W. Cell 89, 831–838 (1997).

9. Pelletier, J. & Sonenberg, N. Nature 334, 320–325 (1988).

10. Ehrenfeld, E. in Translational Control (eds Hershey, J. W. B., Mathews, M. B. & Sonenberg, N.)

549–573 (Cold Spring Harb. Lab. Press, Cold Spring Harbor, 1996).

11. Sonenberg, N. in Translational Control (eds Hershey, J. W. B., Mathews, M. B. & Sonenberg, N.)

245–269 (Cold Spring Harb. Lab. Press, Cold Spring Harbor, 1996).

12. MacGregor, G. R., Nolan, G. P., Fiering, S., Roederer, M. & Herzenberg, L. A. in Methods in Molecular

Biology (eds Murray, E. J. & Walker, J. M.) 217–235 (Humana, Clifton, New Jersey, 1991).

13. Seed, B. & Sheen, J. Y. Gene 67, 271–277 (1988).

ACKNOWLEDGEMENTS

We thank G. Belsham and P. Liston for plasmids pCMV-2A and pCI-lacZ; J.-Y. Xuan and C. Neville for

sequencing; and R. Farahani and M. Legace for the mouse and human XIAP genomic clones. We

acknowledge support from the Medical Research Council (MRC) of Canada, the Canadian Networks of

Centers of Excellence and the Howard Hughes Medical Institute (HHMI). M.H. is a recipient of an MRC

Postdoctoral Fellowship. R.G.K. is a recipient of an MRC Senior Scientist Award, a Fellow of the Royal

Society of Canada, and an HHMI International Research Scholar.

Correspondence and requests for materials should be addressed to R.G.K.

© 1999 Macmillan Magazines Ltd

192 NATURE CELL BIOLOGY | VOL 1 | JULY 1999 | cellbio.nature.com