Up-regulation of integrin α6β4 expression by mitogensinvolved in dairy cow mammary development

Feng Zhao & Chang Liu & Yu-Meng Hao & Bo Qu &

Ying-Jun Cui & Na Zhang & Xue-Jun Gao &

Qing-Zhang Li

Received: 24 June 2014 /Accepted: 16 September 2014 / Editor: T. Okamoto# The Society for In Vitro Biology 2014

Abstract In dairy cows, the extracellular microenvironmentvaries significantly from the virgin state to lactation. Thefunction of integrin α6β4 is dependent on cell type andextracellular microenvironment, and the precise expressionprofile of α6β4 and its effects on mammary developmentremain to be determined. In the present study, real-time PCRand immunohistochemistry were used to analyze the expres-sion and localization of integrin α6β4 in Holstein dairy cowmammary glands. The effects of integrin α6β4 on the prolif-eration induced by mammogenic mitogens were identified byblocking integrin function in purified dairy cow mammaryepithelial cells (DCMECs). The results showed that the local-ization of β4 subunit and its exclusive partner the α6 subunitwere not consistent but were co-localized in basal luminalcells and myoepithelial cells, appearing to prefer the basalsurface of the plasma membrane. Moreover, α6 and β4 sub-unit messenger RNA (mRNA) levels changed throughout thestages of dairy cow mammary development, reflected well byprotein levels, and remained higher in the virgin and pregnan-cy states, with duct/alveolus morphogenesis and active cellproliferation, than during lactation, when growth arrest isessential for mammary epithelial cell differentiation. Finally,the upregulation of integrin expression by both mammogenicgrowth hormone and insulin-like growth factor-1 and theinhibited growth of DCMECs by function-blocking integrinantibodies confirmed that integrin α6β4 was indeed involvedin dairy cow mammary development.

Keywords Dairy cow .Mammary development . Integrinα6β4 . Serum-free culture . Cell proliferation

Introduction

Integrins are heterodimers consisting of α and β subunits.They are an important class of cell surface receptor mediatingadhesion to the extracellular matrix (ECM) and special cell–ECM interactions, allowing the microenvironment to helpregulate intracellular signaling events (Giancotti andRuoslahti 1999; Hynes 2002; Taddei et al. 2003).

The integrin β4 subunit and its exclusive partner α6 sub-unit known at present (integrin α6β4), referred to as “β4integrin,” is found predominantly in epithelial cells as a cellsurface adhesion receptor for all of the known laminins (Shaw1999; Hynes 2002; Gabarra et al. 2010; Gerson et al. 2012).Integrin α6β4 and its ligand laminin-5 (laminin-332) areorganized into multiprotein cytoplasmic plaques calledhemidesmosomes that anchor cells in the basal layer of epi-thelial tissues to the basement membrane (Taddei et al. 2003;Werner et al. 2007). Moreover, hemidesmosomes via integrinα6β4 are attached to the cytokeratin intermediate filamentnetwork, whereas other integrins are attached to actin micro-filaments (Jones et al. 1998; Nievers et al. 1999; Weaver et al.2002; Werner et al. 2007; Hopkinson et al. 2014).

Earlier immunohistochemical studies performed with hu-man, rat, and mouse mammary tissue have revealed integrinα2β1, α3β1, α5β1, α6β1, and α6β4 in luminal andmyoepithelial cells of the ducts and alveoli, α1β1 specificallyin the myoepithelium (Shaw 1999; Woodward et al. 2001). Inthe cell, α1β1 and α2β1 act as collagen receptors; α3β1,α6β1, andα6β4 are major laminin receptors; andα5β1 bindsto fibronectin (Lambert et al. 2012; Raymond et al. 2012).Notably, integrin α6β4 and other hemidesmosome compo-nents are also co-localized in bovine mammary epithelial cells

Feng Zhao and Chang Liu contributed equally to this work.

F. Zhao :C. Liu :Y.<M. Hao :B. Qu :Y.<J. Cui :N. Zhang :X.<J. Gao :Q.<Z. Li (*)Key laboratory of Dairy Science of Education Ministry, NortheastAgricultural University, Harbin 150030, Heilongjiang, Chinae-mail: qingzhang_li@126.com

In Vitro Cell.Dev.Biol.—AnimalDOI 10.1007/s11626-014-9827-1

(BMGE+H/BMGE-H), and their localization is distinct fromthat of focal adhesions (FAs). Moreover, the integrin α6β4complex was proven to function as an adhesion molecule inthese cells because laminin rapidly induced cell adhesion andspreading, but not in the presence of antibodies againstintegrin α6 or β4 (Uematsu et al. 1994).

Upon ligation of the integrin by laminins, the integrinα6β4 becomes phosphorylated on tyrosine residues and com-bines sequentially with the adaptor molecules Shc and Grb2,linking to the ras pathway, and with cytoskeletal elements ofhemidesmosomes. With phosphorylation of multiple distincttyrosine residues, α6β4 signaling can also mediate cell mi-gration toward laminins, independent of hemidesmosome ad-hesive structures (Mainiero et al. 1996). In addition, squa-mous carcinoma cells endowed with high proliferative poten-tial often express elevated levels of α6β4, and in anotherresearch, keratinocytes detached from the ECM (rich in lam-inin 5) withdraw from the cell cycle to differentiate (Giancotti1996). Together, the correlation between expression of α6β4and cell proliferation revealed by these observations suggeststhat this integrin may provide epithelial cells with a signalimportant for cell cycle progression (Giancotti 1996).

In normal adherent cells, induction of proliferation in re-sponse to growth factor stimulation occurs only if cells inter-act with the ECM. The intracellular signaling pathways stim-ulated by integrins are coupled to those triggered by solublegrowth factors. Therefore, integrin-growth factor receptorcrosstalk is important for many growth factor receptor-mediated functions, including cell proliferation, survival, mo-tility, and invasion (Miyamoto et al. 1996; Schwartz andGinsberg 2002), which is emphasized by the fact that cooper-ative signaling between integrin α6β4 and receptor tyrosinekinases such as ErbB2/ErbB3 and EGFR can enhance PI3Kactivation suggesting a link between α6β4 and growth factorsignaling (Falcioni et al. 1997; Gambaletta et al. 2000; Guoet al. 2006; Yoon et al. 2006; Folgiero et al. 2007; Gabarraet al. 2010). Furthermore, insulin-like growth factor-1 (IGF-1)was recently reported to directly bind integrin α6β4, inducingternary complex formation (integrin/IGF-1/IGF-1 receptor),while the integrin binding-defective mutant of IGF-1 wasdefective in signaling and ternary complex formation (Fujitaet al. 2013).

Integrin-mediated adhesion to ECM substrates is essentialfor cell survival which is known as anchorage dependence(Schwartz and Assoian 2001). After several days of primaryculture, mammary epithelial cells grown on collagen I under-go apoptosis, whereas those cultured on Matrigel in the pres-ence of insulin or insulin-like growth factors (but not prolactinor hydrocortisone) do not (Farrelly et al. 1999). Protectionfrom apoptosis requires the availability of both integrin β1and α6 subunits under these conditions. The former regulatesthe formation of polarized three-dimensional structures andthe latter, as α6β4, is involved in the formation of

hemidesmosomes, tissue polarity, and the activation of NFκB(Weaver et al. 2002; Taddei et al. 2003). Expression ofintegrin β4 that lacks the hemidesmosome targeting domaininterferes with tissue polarity and NFκB activation and per-mits apoptosis (Weaver et al. 2002). The role ofhemidesmosomes has been identified in branching morpho-genesis of human mammary epithelial cells (MCF-10A) byusing antibodies which inhibit the activities of both laminin-5and integrin α6β4 (Stahl et al. 1997).

Integrin α6β4 exhibits multiple biological functions, suchas regulating the development of many tissues, including themammary gland, the cell type-dependent and ECM-relatedactivation, or inactivation of regulatory signals direct cellproliferation, apoptosis, survival andmigration, among others.However, data concerning integrin expression and its reg-ulation in dairy cow mammary epithelium remain un-known. In this paper, we attempt to determine the involve-ment of integrin α6β4 in dairy cow mammary develop-ment associated with mammogenic growth hormone (GH)and IGF-1.

Materials and Methods

Animals and mammary tissue preparation. Fourteen healthHolstein dairy cows were divided into virgin (V), pregnancy(P), lactation (L), and dry period (involution, I) groups. Im-mediately after cows were killed, samples of mammary pa-renchyma from each mammary quarter were taken. Tissuesamples were taken from the dorsolateral portion of the gland(deep parenchyma) at a depth of 4 cm following previousdescriptions (Nickerson et al. 1992). Tissues were then cutinto small pieces (∼50 mg per piece for RNA extraction, ∼1 gper piece for immunohistochemistry, and Western blotting),snap frozen, and stored at −80°C until use.

Cell culture. Dairy cow mammary epithelial cells (DCMECs)were cultured according to a method used in and published byour lab, as reported by Lu et al. (2012). Tissue samples wereminced to 1–5 mm3 pieces, rinsed several times with Hank’sbuffer to remove milk and blood, and placed into a flaskcontaining 250 ml of digest mixture (Hank’s buffer with0.5 mg/ml collagenase IV, 100 μg/ml penicillin G,100 μg/ml streptomycin, and 2.5 μg/ml Fungizone). Thedigestion proceeded for 3 h (37°C, 100 rpm). Cells were thenpassed through a filter with a 1-mm pore size and centrifugedfor 5 min at 1500×g. The cell pellet was resuspended in 1/2volume of Hank’s buffer and passed through a filter with a0.5-mm pore size then subsequently passed through a filterwith 100-μm pore size and centrifuged for 5 min at 40×g(Motyl et al. 2011). Cells were resuspended in completemedium (Dulbecco’s modified Eagle medium: nutrient mix-ture F-12 (DMEM/F12), 10% fetal calf serum (FBS),

ZHAO ETAL.

100 μg/ml penicillin G, 100 μg/ml streptomycin, 5 μg/mlFungizone). Cells were plated on 6-well culture dishes(37°C, 5% CO2) and digested by trypsin to purify mammaryepithelial cells. All enzymes were purchased from Sigma-Aldrich. DMEM/F12 and fetal calf serum and all antibioticswere purchased from Life Technologies, Invitrogen, Carlsbad,CA. The mammary epithelial cells were reseeded in 96-well(1.0×104 cells/well, for integrin function-blocking assay andreal-time PCR) or 6-well (1.0×105 cells /well, for immunocy-tochemistry) plates in complete medium. In the presence of100 ng/ml recombinant bovine growth hormone (rBGH;CYT-636, ProSpec, St. Louis, MO) or 100 ng/ml recombinanthuman IGF-1 analog (LONG®R3 IGF-1; I1271, Sigma-Al-drich, St. Louis, MO), the monolayer cells were lysed after 72-h incubation, and RNAwas extracted for downstream integrinmessenger RNA (mRNA) profile analysis via real-time RT-PCR (qRT-PCR).

Integrin function-blocking assay. Cell proliferation wasassessed using MTT detection as described previously(Baratta et al. 2000). In brief, an equal number of cells wereseeded in a 96-well plate at a density of 1.0×104 cells/well.After 24 h, attached cells were first serum-starved for another24 h and then induced to proliferate under different cultureconditions (see Table 1) with the addition of 100 ng/ml rBGHor 100 ng/ml IGF-1. Then 50 μl laminin solution (30 μg/ml insterile water) was used to coat individual wells of the 96-wellplates before cell seeding according to the manufacturer’sprotocol (L2020, Sigma-Aldrich, St. Louis, MO). Twentymicroliters of MTT solution (5 mg/ml MTT in PBS) wasadded to individual wells of the 96-well plates and cells wereincubated for 4 h at 37°C. The culture medium was thenremoved, and 200 μL dimethyl sulfoxide (DMSO) was addedper well. After 5 min of incubation at 37°C, the optical density(OD) values at a wavelength of 490 nm were read on amicrotiter plate reader (Bio-Tek, Shoreline, WA).

Total RNA extraction and real-time PCR. Total RNA wasextracted from the mammary gland samples and DCMECsusing TRIZOL reagent according to the manufacturer’s pro-tocol (Invitrogen). Subsequently, RNA samples were identi-fied by agarose gel electrophoresis. Total RNA samples wereused to perform qRT-PCR following a previously publishedprotocol (Huang et al. 2012). Briefly, 2 μg total RNA wastreated with DNase and reverse transcribed into first-strandcomplementary DNA (cDNA) using SYBR® Premix ExTaqTM (DRR041A, Takara Biotechnology, Dalian, China)according to the manufacturer’s instructions. Analysis wasconducted using the ABI PRISM®7500 Real-Time PCR Sys-tem (Applied Biosystems, Foster City, CA). Integrin α6 andβ4 subunit mRNAwas amplified using gene-specific forwardand reverse primers (see Table 2). β-actin was used as theinternal control gene following standard curve analyses across

several samples. Primers were designed by Primer Premier 5.0and/or Oligo 6 software. The 2-△△CT method was used tocalculate relative expression.

Immunohistochemistry and immunocytochemistry. Mammarytissues were cut into serial 10 μm sections on a Cryostat(Leica CM1850) and mounted onto slides. Frozen tissue sec-tions fixed with acetone were immersed in goat serum (10% inPBS/T) for 1 h at room temperature to block nonspecificbinding. Following three phosphate-buffered saline withTween (PBS/T) washes of 5 min each, tissue sections wereincubated with integrin β4 rabbit polyclonal antibody (sc-9090; dilution 1:100, Santa Cruz Biotechnology, Santa Cruz,CA) and integrin α6 rat monoclonal antibody-FITC(ab21259; dilution, 1:20; Abcam, Cambridge, UK) in PBScontaining 1% bovine serum albumin (BSA) for 1 h at roomtemperature. Following three more PBS/T washes of 5 mineach, sections were incubated with goat anti-rabbit secondaryantibody-TRITC (ab7087; dilution, 1:200, Abcam, Cambridge,UK) in PBS at room temperature in the dark for 1 h. Sectionswere again washed three times in PBS/T for 5 min each, stainedwith Hoechst33258 (1 μg/ml; Sigma-AldrichSt, Louis, MO) inPBS for 10 min, and then washed twice in PBS/T for 5 mineach. Finally, 90% glycerol-PBS containing DABCOmountingmedium was added to slides prior to a coverslip, and immuno-fluorescence was observed with a Leica TCS SP2 Laser Scan-ning Microscope. Mammary epithelial cells were seeded onculture slides in 6-well plates and allowed to grow to 80%confluence. After two PBS washes, culture slides were coveredwith 1 ml of methanol pre-cooled for 10 min at 4°C. Cells werethen immersed in 5%BSA in Tris-buffered saline (TBS) for 1 hat 37°C followed by incubation with mouse anti-cytokeratin18-FITC (ab52459; dilution, 1:50, Abcam, Cambridge, UK),integrin β4 rabbit polyclonal antibody (sc-9090; dilution,1:100, Santa Cruz Biotechnology, Santa Cruz, CA) and integrinα6 rat monoclonal antibody-FITC (Ab21259; dilution, 1:20,Abcam, Cambridge, UK) in TBS for 1 h at 37°C. Lastly, cellswere washed three times in TBS for 5 min each. PBS or TBSwere used instead of primary antibody as the control.

Western blotting. Frozen mammary tissues and cell pelletswere homogenized with RIPA buffer (10 mM Na2HPO4, pH7.2, 150 mMNaCl, 2 mMEDTA, 1% Triton X-100, 1% SDS,1% sodium deoxycholic acid) to which protease inhibitors hadbeen added (2mMPMSF, 2 mMNa3VO4, 1 mMNaF, 10mMleupeptin, 2 μg/ml aprotinin) as previously described (Wood-ward et al. 1998). The samples were ground or sonicated,normalized for protein content using a bicinchoninic acid(BCA) protein assay (Bio-Rad Laboratories, Inc., Berkeley,CA), and then subjected to SDS-PAGE. Equal amounts ofprotein were loaded on the gel (8% SDS-PAGE gel forintegrin α6 and 6% SDS-PAGE gel for integrin β4) andtransferred to a nitrocellulose filter membrane (NC

INTEGRIN Α6Β4 IN DAIRY COW MAMMARY DEVELOPMENT

membrane). After blocking with 5% non-fat milk in TBS/T(containing 0.1% Tween-20), NC membranes were incubatedwith primary antibodies againstβ-actin (sc-47778, Santa CruzBiotechnology, Santa Cruz, CA), integrin α6 (ab97760,Abcam, Cambridge, UK), or integrin β4 (sc-9090, SantaCruz Biotechnology, Santa Cruz, CA) and subsequently incu-bated with HRP-conjugated secondary antibodies. Proteinswere visualized by fluorography using an enhanced chemilu-minescence system and analyzed against a 10–230 Ku pre-stained protein ladder (P7710, New England Biolabs, Hitchin,UK).

Statistical analysis. Each experiment was repeated threetimes. Within each experiment, three replicates were usedfor each treatment. Numerical data are presented as means±SD. Statistical analyses were performed with SPSS 17.0. Themeans of different hormone treatments and different mRNAor protein expression levels were compared with ANOVA andthe Student’s t test was used for comparing individual means.A P value of P<0.05 (*) was considered statisticallysignificant.

Results

Integrin α6 and β4 distribution in dairy cow mammary glandtissue. The mammary epithelium consists of two layers: aluminal layer of secretory cells and a basal layer ofmyoepithelial cells. Using immunohistochemistry, we foundthat both integrin α6 and β4 subunits were detected in basallayer cells including basal ductal/alveolar epithelial cells andmyoepithelial cells toward the basement membrane in Hol-stein cow mammary tissue slices (Fig. 1). As expected, thetwo integrin subunits were present at sites of cell–ECM

interaction, on the basal surface of myoepithelial cells andon mammary luminal epithelial cells. However, the detectionof integrin β4 chains on the apical and lateral surfaces of theductal/alveolar epithelial cells, where ECM proteins are notdetected in normal mammary epithelium, even in integrin α6-negative cells, was unexpected. The activation status, poten-tial ligands (if any), and functions of the integrins present onlateral cell surfaces or the apical surfaces of the luminal cellsare not known. Notably, little or noβ4 protein was detected inmammary luminal epithelial or myoepithelial cells duringlactation or dry periods (Fig. 1f–g).

Integrin α6 and β4 mRNA expression profiles in dairy cowmammary gland tissue. Using qRT-PCR, the expression ofintegrin α6 and β4 chain mRNA transcripts during each stageof mammary development was assessed (Fig. 2). Expressionprofiles of each integrin varied with the physiological state,and each integrin had its own distinct expression profile(Fig. 2). As shown in Fig. 2a, integrin α6 mRNA levelspeaked at 6 mo during pregnancy (P6m), being fourfoldhigher (P<0.05) than in the virgin group, then a rapid declineemerged during late pregnancy, and a low expression wasmaintained throughout lactation and dry periods (P<0.05).Integrin β4 mRNA levels peaked at 12 mo in the virgin groupfollowed by a plateau and then a declining pattern similar toα6 from late pregnancy through the dry period. Averagevalues of integrin β4 appearing during the virgin and preg-nancy states were greater than twofold higher than duringlactation (L-7d) (Fig. 2b). As shown in Fig. 2a, b, no signif-icant variation of integrin mRNA levels was observed be-tween lactation and the dry period, expect for L50.

Integrin α6 and β4 protein expression profiles in dairy cowmammary gland tissue. Using Western blotting, the

Table 1 Culture conditions forDCMECs proliferation Number DMEM/

F12Laminin 30 μg/ml,50 μl/well

Integrin α6 blocking antibody(Chemicon, MAB1378),40 μg/ml

Integrin β4 blocking antibody(Chemicon, MAB2058),40 μg/ml

1 + + – –

2 + – – –

3 + + + –

4 + + – +

5 + – + –

6 + – – +

Table 2 Real-time PCR primersequences Gene Forward primers (5′–3′) Reverse primers (5′–3′)

ITGA6 AGCGGCTATTGCTCGTGG TGGACCCTGGCTTTGGAC

ITGB4 TCAAGGTCAAGATGGTGGATG GGGAACAGGAGGAGGAAGAT

ACTB (housekeeper) AAGGACCTCTACGCCAACACG TTTGCGGTGGACGATGGAG

ZHAO ETAL.

expression of integrin α6 and β4 chain proteins in dairy cowmammary gland tissue during each stage of mammary devel-opment was assessed (Fig. 3a). Consistent with the results ofthe mRNA profile and immunohistochemical analysis,integrin α6 and β4 protein levels varied with the physiolog-ical state (Fig. 3b, c). As shown in Fig. 3b, integrin α6 levelspeaked at 4 mo during pregnancy (P4m), being almost

twofold higher (P<0.05) than in the virgin group, then de-clined during late pregnancy and remained low throughout thelactation and dry periods (P<0.05). Integrin β4 levels alsopeaked at P4m followed by a rapid decline from late pregnan-cy to the dry period. Average values of integrin β4 appearingduring the virgin and pregnancy states were almost twofoldhigher than (Fig. 3c). As shown in Fig. 3b, c, the decline of

Figure 1 Distribution of integrin α6 and β4 in dairy cow mammarygland tissue slices. Frozen dairy cow mammary gland sections wereimmunostained with special antibodies to integrin α6 and β4 subunits,defined by overlapping green (integrin α6), red (integrin β4), and blue(nucleus). Arrows indicate ducts and alveoli; arrowheads indicate bothα6 and β4 subunits in the membrane localized in basal mammary

epithelial cells; and β4 staining was also detected in apical mammaryepithelial cells. a, b 12 and 14 mo into virgin state; c, d 2 and 6 mo intopregnancy, respectively; e perinatal period (7 d before parturition); f 140 dinto lactation; g, h 3 and 30 d into dry period, respectively. Lu lumen.Scale bar 75 μm.

INTEGRIN Α6Β4 IN DAIRY COW MAMMARY DEVELOPMENT

both integrins was observed from late pregnancy to the dryperiod, but the decline of integrin β4 chains was more signif-icant than that of integrin α6.

Integrinα6 and β4 expression profiles in dairy cow mammaryepithelial cells. DCMECs exhibited a normal epithelial cellshape when visualized under a light microscope, and morethan 90% of cells stained positive for specific luminal epithe-lial marker cytokeratin 18 (Fig. 4).

To detect polar distribution of integrin α6 and β4,DCMECs were stained with special antibodies for integrinsubunits and TRITC-phalloidin for F-actin (representing thecytoskeleton). Fluorescence staining of the actin cytoskeletonwith phalloidin in fixed cells showed prominent actin struc-tures with actin-bearing ruffles in a well-developed spreadingcell (Fig. 5). Most of the actin filament bundles (red F-actin)extending into the lamellipodium from the cell center ap-peared to terminate well before reaching the periphery. Almostall cells were integrin α6- or β4-positive (Fig. 5a, d) around ablue nuclei. Differential signal detection implied the asymme-try of integrin α6 and β4 distribution on the cell membrane(Fig. 5b, e). Furthermore, detailed confocal microscopic ex-amination of the fluorescence of the cells revealed that thegreen signal intensity relied on depth of focus toward thebottom, indicating the basal expression features of the twointegrin subunits.

Effects of rBGH and IGF-1 on integrin α6 and β4 mRNAexpression. To identify integrinα6 andβ4 mRNA expression

changes in ductal/alveolar epithelial cells associated withdairy cow mammary development, we administered rBGHor IGF-1, well-known mammogenic hormones and growthfactors, respectively, and focused on their effects on integrinmRNA expression. After cells were plated and allowed toadhere for 24 h in complete medium and then serum starvedfor another 24 h in serum-free medium, rBGH and recom-binant IGF-1 analog were added, and their effects onintegrin gene expression were assessed by qRT-PCR. Asshown in Fig. 6, the in vitro expression of integrin α6 andβ4 mRNAwas detected in purified mammary luminal epi-thelial cells in both uncoated and pre-coated plastic plates,even in wells with only DMEM/F12 medium and the ab-sence of any additional mitogen. However, administrationof rBGH or IGF-1 was shown to significantly increase theexpression of integrin α6 and β4 mRNA in DCMECs(P<0.05). In the absence of laminin, integrin mRNA ex-pression peaked within 12 to 48 h. In the presence oflaminin, however, expression peaked earlier and mRNAlevels were higher (Fig. 6a–d). IGF-1 was more effectivefor the upregulation of integrin mRNA expression thanrBGH at the same concentration (100 ng/ml).

Influence of laminin and integrin α6β4 on the IGF-1-inducedproliferation of dairy cow mammary epithelial cells. Theinfluence of integrin function on DCMEC proliferation wasassessed using rBGH and recombinant IGF-1 analog to inducecell proliferation while using antibodies to block integrin α6and β4 function. DCMECs were first incubated in complete

Figure 2 Integrin α6 and β4mRNA levels in dairy cowmammary gland tissue. TotalRNAwas collected from frozenmammary gland tissue, and aresignified by V12m and V14m (12and 14 mo into virgin state,respectively); P2m, P4m, andP6m (2, 4, and 6 mo intopregnancy, respectively); L-7dand L7d (7 d before parturitionand 7 d into lactation, namely theperinatal period, respectively);L50d, L140d, and L280d (50,140, and 280 d in lactation,respectively); and I3d and I30d (3and 30 d in the dry period,respectively). Integrin α6 and β4gene expression was measured byreal-time PCR. Superscripts oncolumns represent significantdifferences between physiologicalstages (P<0.05).

ZHAO ETAL.

medium for 24 h to allow cell adherence (even cells prolifer-ation) then serum starved in DMEM/F12 medium withoutFBS for 24 h. Since cells were seeded at the same densityand expected to proliferate at the same rate, any significantchange in live attached cell numbers after serum starvationwas ascribed to a change in cell adhesion, survival, and/orproliferation rates. As shown in Fig. 7, higher live attachedcell numbers were observed in the presence of laminin, whichimplied that the laminin substrate was more advantageousthan the plastic surface for cell adhesion, survival, and/orproliferation. Notably, laminin-dependent effects in the con-trols required α6 integrin but not β4 integrin as live attachedcell numbers were not significantly different between laminin-coated and uncoated plates when α6 integrin was blocked,while anti-β4 integrin had no such effect.

The addition of rBGH for 24-h incubation did not signifi-cantly alter live attached cell numbers in any case. UnlikerBGH, IGF-1 acted as an effective mitogen and significantlyincreased live attached cell numbers on laminin-coated platescompared with uncoated plates. However, in our previousreport (Liu et al. 2012), the addition of 10% FBS or a longerincubation (>24 h) with IGF-1 induced a visible proliferationreaction of DCMECs on uncoated plates, so it appeared that24 h might be too short a time for G0 cells to reenter the cellcycle in the absence of laminin when IGF-1 alone is used.Furthermore, the effect of IGF-1 on proliferation was lostwhen either integrin α6 or β4 was blocked. Collectively, thedata imply that the effects of IGF-1 on the proliferation ofDCMECswere associated with the laminin substrate, possiblythrough the laminin receptor function of integrin α6β4. These

Figure 3 Western blottinganalysis of integrin α6 and β4 indairy cow mammary gland tissue.Total protein was collected fromfrozen mammary gland tissue. aSamples were diluted to equalprotein concentration and loadedinto SDS-page. V: V12m andV14m; P: P2m, P4m, P6m; andL-7d; L: L7d, L50d, L140d, andL280d; I: I3d and I30d. Integrinα6 and β4 protein expressionwere measured by Westernblotting. b, c Western blottingbands were measured byBandscan 5.0. Normalizedrelative expression of integrin α6and β4 protein was analyzedusing β-actin as an internalstandard. Superscripts oncolumns represent significantdifferences between physiologicalstages (P<0.05).

Figure 4 Identification ofpurified DCMECs. a DCMECsunder light microscope (×200). bCytokeratin 18 staining ofDCMECs (×400). c Negativecontrol (×400).

INTEGRIN Α6Β4 IN DAIRY COW MAMMARY DEVELOPMENT

results are consistent with the recent finding that integrinα6β4 is involved in IGF signaling (Fujita et al. 2013).

Discussion

We aimed to investigate the localization and quantitativechanges of integrin α6 and β4 subunits mRNA and proteinexpression during normal dairy cow mammary development.Since the proportion of parenchymal and mesenchymal cellswithin the mammary gland (mammary tissue sections) chang-es dramatically during development, it is essential to studyintegrin expression in purified mammary epithelial cellsin vitro. In the present study, we showed first that the mRNAand protein levels of integrin subunits α6 and β4 variedbetween multiple stages of mammary gland developmentand remained higher during virgin and pregnancy states, withduct/alveolus morphogenesis and active cell proliferation,than during lactation, in which growth arrest is essential for

mammary epithelial differentiation. We also showed thatboth integrin α6 and β4 subunits preferred the basal sur-face of the plasma membrane in purified DCMECs. Finally,the regulation of integrin expression by GH, IGF-1, and thefunction-blocking assay demonstrated that overexpressionof integrin increased proliferation of DCMECs cultured onlaminin.

Expression profiles of integrin α6 and β4 during normalmammary gland development. As expected, integrin α6and β4 subunits were present at sites of cell–ECM interac-tion, on the myoepithelial cells, and on the basal surface ofthe alveolar luminal cells, which was consistent with aprevious study in human and mouse (Taddei et al. 2003).The integrin β4 chains have also been found on the lateraland luminal surfaces of the ductal/alveolar luminal cells atsites of no cell–ECM interaction in normal mammary epi-thelium. In a few reports, the unusual distribution of integrinproteins was also found when integrin α2 and α5 weredetected (Woodward et al. 2001; Suzuki et al. 2002;

Figure 5 Distribution of integrinα6 and β4 in DCMECs. a, b α6integrin monoclonal antibody(green), d, e β4 integrinpolyclonal antibody (green), c, fPBS instead of antibody was usedas negative control. F-actin wasstained with TRITC-phalloidin(red) as an assisted positioningmarker, and cell nuclei werecounterstained with DAPI (blue).The overlap of red and greendisplays are shown as a yellowregion. The white frames aroundoverlapping region demonstratethat integrin staining was limitedwithin cell contours (note F-actinstaining in cytoplasm). Thearrows show that α6 and β4staining in the membrane (a, dgreen) is localized underneath theintracellular staining (b, e red),indicating that integrin staining ison the basal side of DCMECs.Scale bar 75 μm.

ZHAO ETAL.

Raymond et al. 2012; Zhao et al. 2012). There is littleavailable information about the activation status, potentialligands, or functions of the integrins present on lateral andluminal cell surfaces. These integrins perhaps remain inac-tive and are redundant as an intracellular pool of integrinprotein, which was documented for integrin β1 (Huang andIp 2001). Other explanations for the apparent discrepancyinclude its study across different species and/or the use ofdifferent housekeeping genes for normalization.

The spatiotemporal regulation of integrin expressionduring mammary gland development indicates a role inmajor developmental processes (Taddei et al. 2003;Raymond et al. 2012). Some studies investigating geneexpression in normal mammary gland tissue have touchedon the integrin β4 subunit and its exclusive partner the α6subunit (Huang and Ip 2001). In rat and human mammarygland, immunohistochemical analyses and Western andNorthern blotting have showed that the expression of both

Figure 6 The regulation of integrin α6 and β4 gene expression inDCMECs. Cells were treated as described in Table 1 for 6, 12, 24, 48,and 72 h. Integrin α6 and β4 mRNA level were determined by real-timePCR. Abundance of integrin mRNAs was normalized to β-actin

expression and compared with the control. Data are presented as means±SD and are representative of three independent experiments performedin triplicate. An asterisk used on columns means a significant differencebetween the same type of columns (P<0.05).

Figure 7 The effect of blocking integrin function on proliferation ofDCMECs. Cells were seeded on laminin-coated or uncoated 96-wellplates and cultured in complete medium (DMEM/F12+10% FBS) for24 h to allow adherence to the plate surface. Attached cells were serum-starved for 24 h and induced to proliferate for another 24 h in conditioned

medium as described in Table 1. An asterisk used on columns means asignificant difference between the same type of columns and an asteriskover or under the line represents a significant difference between thedifferent types of columns (P<0.05). NS not significant.

INTEGRIN Α6Β4 IN DAIRY COW MAMMARY DEVELOPMENT

α6 and β4 chains increases during pregnancy, and β4levels decrease during lactation (Suzuki et al. 2000,2002; Huang and Ip 2001). Consistent with these results,our data further identified that the expression of the twolaminin-binding integrin subunits remained higher duringperiods of intense morphogenesis (from 12 mo in thevirgin state through late pregnancy), ductal branching,and lobulo-alveolar development suggesting a role forlaminin and integrin α6 and β4 subunits examined inbovine mammary morphogenesis.

Due to the different organization of the myoepithelial celllayer in the ducts and alveoli, ductal luminal cells have onlylimited contact with the ECM, whereas alveolar luminal cellsattach directly to the mammary basement membrane sur-rounding the secretory alveoli (Raymond et al. 2012). Thehigher levels of integrin α6 and β4 subunits in early pregnan-cy relative to late pregnancy indicates that the integrins pre-ferred alveolar luminal cells over myoepithelial cells, whichare involved in lobulo-alveolar development rather than dif-ferentiation. Additionally, the levels ofα5,α6,β1, andβ4 areupregulated during involution suggests that one or more ofthese integrins are involved in mammary gland remodeling(Huang and Ip 2001); however, lower levels of α6 and β4were detected in this study, possibly due to slower and reducedtissue remodeling during the dry period.

Although data concerning the regulation of integrin expres-sion during mammary gland development are rather fragmen-tary, there is enough experimental evidence to conclude that itis controlled transcriptionally and posttranscriptionally(Taddei et al. 2003). Integrin mRNA expression does notalways correlate with the level of its protein in normal mam-mary epithelial cells (Huang and Ip 2001), but levels of α6and β4 subunit protein in this study mirrored their respectivelevels of mRNA across developmental stages, a finding thatwas also reported previously in rat mammary development(Huang and Ip 2001).

Upregulation of integrin α6 and β4 mRNA expression byrBGH and IGF-1. Although myoepithelial cells may bepresent only within the freshly isolated mammary epithelialcell population (Masso-Welch et al. 1999), the use of CK18antibody was still essential to identify mammary luminalcells exclusively in our experiment system, and almost allcells examined were CK18-positive with the presence ofα6β4 on the basal surface of the plasma membraneinteractions.

Integrin expression is rapidly upregulated and controlledby the ECM in primary culture (Delcommenne and Streuli1995). In cells on plastic, steady-state levels of mRNA for β1and various α chains were found to be much higher than thosein vivo or in cells cultured on the reconstructed basementmembrane, Matrigel (Taddei et al. 2003). These results con-firmed that integrin expression did not depend on the presence

of ECM ligands. This conclusion was supported by our ob-servation that both integrin α6 and β4 mRNA and proteinwere detected in DCMECs regardless of whether lamininsubstrate was present on culture plates.

It has been suggested that integrin expression is regulatedby mammogenic hormones and growth factors such as theovarian hormones estrogen and progesterone (Haslam andWoodward 2001). We focused on GH and IGF-1, themammogenic effects of which during postnatal bovine mam-mary development are also well known (Baumrucker andStemberger 1989; Forsyth 1989; McGrath et al. 1991; Purupet al. 1993). In the presence of rBGH or IGF-1 in serum-freemedium (DMEM/F12), the significant upregulation ofintegrin α6 and β4 mRNA in DCMECs implies that the twointegrin subunits may be involved in mammary growth anddevelopment through the control of mammogenic hormonesand growth factors. Our results showed that the regulation ofintegrin mRNA expression induced by rBGH or IGF-1 wasindependent of laminin as similar changes in the expression ofboth integrin subunits was observed, and the higher mRNAlevels remained from 12 to 48 h after the addition of rBGH orIGF-1, regardless of whether laminin substrate was present.Although the localization of integrinα6 andβ4 chains in vitrodid not quite match that in mammary tissue sections, based ontheir co-localization and similar expression change, both sub-units appeared to function as an α6β4 heterodimer. Indeed,the integrinα6 subunit is known to preferentially bind integrinβ4 in cells which co-express both of its integrin β1 and β4partners (Giancotti et al. 1992; Stahl et al. 1997).

Involvement of integrin α6β4 in IGF-1-induced proliferationof dairy cow mammary epithelial cells dependent on laminin-1. Crosstalk between integrins and receptor tyrosine kinase-mediated signaling allows the control of growth factor-induced intracellular events by adhesion machinery (Streuliand Akhtar 2009; Raymond et al. 2012). In normal andmalignant cells, activated integrins are known to regulategrowth factor receptor signaling, such as the cooperativesignaling between IGF-1/IGF-1R and integrin α6β4(Miyamoto et al. 1996; Schwartz and Ginsberg 2002).Although crosstalk between hormone receptors andintegrins has not been investigated as thoroughly, severalstudies suggest that cell–ECM interactions have a signifi-cant impact on hormonal control of mammary develop-ment (Streuli et al. 1995; Edwards et al. 1998; Haslamand Woodward 2001).

In this study, IGF-1, rather than GH, had a direct effect onDCMEC proliferation, which was also reported by Stiening(2005), yet the indirect effects of GH must be mentioned.First, it was supported by studies of ovariectomized heifersin which increased stromal IGFBP-3 and reduced IGF-Icorresponded with a failure of udder development (Akerset al. 2000). Secondly, the administration of GH increased

ZHAO ETAL.

circulating IGF-1 levels and local IGF-1 production from GHreceptor-positive fibroblasts. Finally, in other studies, GHreduced IGFBP-5 mRNA and protein expression and promot-ed the IGF-I-induced phosphorylation of Akt indirectly inbovine mammary epithelial cells (Sakamoto et al. 2007;Worster et al. 2012). In this study, independently addingrBGH and IGF-1 to DCMECs in serum-free medium allowedthe direct effect of the former to emerge and the indirect effectof the latter to be concealed. Obviously, DCMECs respondedbetter to IGF-1 than to rBGH, likely due to the absence oflocal IGF-1 production from fibroblasts and possible lowexpression of GH receptors in the poorly differentiated bovinemammary epithelial cells (Zhou 2007; Zhou et al. 2008).

We, like Stahl et al. (1997), assumed that Matrigel, or morespecifically its laminin-1 component, could initiate DCMECattachment and induce a series of morphogenetic events. Thisincludes secretion of laminin-5 which then triggers DCMECsto assemble their own hemidesmosomes, a process requiringlaminin-5/integrin α6β4 interaction, although this kind ofhemidesmosome in mammary epithelial cells in vitro may notbe true hemidesmosomes due to the absence of some compo-nents (Tait et al. 1990; Uematsu et al. 1994; Stahl et al. 1997;Taddei et al. 2003). Since it is already established that theintegrin α6β4 heterodimer is essential for hemidesmosomeassembly (Stahl et al. 1997), we were able to assay the roleof hemidesmosomes in the proliferation of DCMECs byinhibiting the activity of both integrin α6 and β4 subunits.Function-blocking antibodies that perturb integrin structure andfunction interactions have beenwidely used to evaluate integrinbiology in vitro (Gabarra et al. 2010). Neutralizing the integrinswith anti-α6 or anti-β4 antibody strongly inhibited bovinemammary epithelial cell adhesion in the short-term even tothe point that attached cells could not spread (Uematsu et al.1994), and cell spreading is essential to cell proliferation. Basedon these data, α6β4 signaling appears to be vital for DCMECproliferation induced by IGF-1 (no proliferation response torBGH). As expected, whether in the control groups or in theintegrin function-blocking group, laminin-coated platescontained more live attached cells than uncoated plates, reveal-ing that laminin-1 favors cell adhesion and cell survival. Whenadded to DCMECs plated on either surface, addition of theantibodies led to a reduction of attached DCMECs, demon-strating a direct involvement of α6β4 as both a laminin recep-tor and a hemidesmosome component in DCMEC adhesionand proliferation.

In conclusion, this report elucidated the expression patternand potential function of integrinα6β4 in DCMECs. The datashow that the expression of integrin α6β4 peaked duringductal/alveolar morphogenesis and is regulated bymammogenic hormones and growth factors. The importanceof integrin α6β4 function on the proliferation of DCMECsthus highlights the involvement of integrin α6β4 in diary cowmammary development.

Acknowledgments This work was supported by the National HighTechnology Research and Development Program of China (863 Program,2006AA10Z1A4), and the Open Research Fund for Key Laboratory ofDairy Science, Ministry of Education, Heilongjiang Province, China(2012KLDSOF-09).

References

Akers RM, McFadden TB, Purup S, Vestergaard M, Sejrsen K,Capuco AV (2000) Local IGF-I axis in peripubertal ruminantmammary development. J Mammary Gland Biol Neoplasia5(1):43–51

Baratta M, Grolli S, Poletti A, Ramoni R, Motta M, Tamanini C(2000) Role of androgens in proliferation and differentiationof mouse mammary epithelial cell line HC11. J Endocrinol167(1):53–60

Baumrucker CR, Stemberger BH (1989) Insulin and IGF-I stimulateDNA synthesis in bovine mammary tissue in vitro. J Anim Sci67(12):3503–3514

Delcommenne M, Streuli CH (1995) Control of integrin expression byextracellular matrix. J Biol Chem 270(45):26794–26801

Edwards GM, Wilford FH, Liu X, Hennighausen L, Djiane J, Streuli CH(1998) Regulation of mammary differentiation by extracellular ma-trix involves protein-tyrosine phosphatases. J Biol Chem 273(16):9495–9500

Falcioni R, Antonini A, Nistico P, Di Stefano S, Crescenzi M, Natali PG,Sacchi A (1997) Alpha6beta4 and alpha6beta1 integrins associatewith ErbB-2 in human carcinoma cell lines. Exp Cell Res 236(1):76–85

Farrelly N, Lee YJ, Oliver J, Dive C, Streuli CH (1999) Extracellularmatrix regulates apoptosis in mammary epithelium through a controlon insulin signaling. J Cell Biol 144(6):1337–1348

Folgiero V, Bachelder RE, Bon G, Sacchi A, Falcioni R, Mercurio AM(2007) The alpha6beta4 integrin can regulate ErbB-3 expression:implications for alpha6beta4 signaling and function. Cancer Res67(4):1645–1652

Forsyth IA (1989) Growth factors in mammary gland function. J ReprodFertil 85(2):759–770

Fujita M, Ieguchi K, Cedano-Prieto DM, Fong A, Wilkerson C, Chen JQ,Wu M, Lo SH, Cheung AT, Wilson MD, Cardiff RD, BorowskyAD, Takada YK, Takada Y (2013) An integrin binding-defectivemutant of insulin-like growth factor-1 (R36E/R37E IGF1) acts as adominant-negative antagonist of the IGF1 receptor (IGF1R) andsuppresses tumorigenesis but still binds to IGF1R. J Biol Chem288(27):19593–19603

Gabarra V, Cho S, Ramirez M, Ren Y, Chen LL, Cheung A, Cao X,Rennard R, Unruh KR, Graff CP, Browning B, Huet HA,McLachlan K (2010) Antibodies directed to alpha6beta4 highlightthe adhesive and signaling functions of the integrin in breast cancercell lines. Cancer Biol Ther 9(6):437–445

Gambaletta D, Marchetti A, Benedetti L, Mercurio AM, Sacchi A,Falcioni R (2000) Cooperative signaling between alpha(6)beta(4)integrin and ErbB-2 receptor is required to promote phos-phatidylinositol 3-kinase-dependent invasion. J Biol Chem275(14):10604–10610

Gerson KD, Maddula VS, Seligmann BE, Shearstone JR, KhanA, Mercurio AM (2012) Effects of beta4 integrin expressionon microRNA patterns in breast cancer. Biol Open 1(7):658–666

Giancotti FG (1996) Signal transduction by the alpha 6 beta 4 integrin:charting the path between laminin binding and nuclear events. J CellSci 109(Pt 6):1165–1172

INTEGRIN Α6Β4 IN DAIRY COW MAMMARY DEVELOPMENT

Giancotti FG, Ruoslahti E (1999) Integrin signaling. Science 285(5430):1028–1032

Giancotti FG, Stepp MA, Suzuke S, Engvall E, Ruoslahti E (1992)Proteolytic processing of endogenous and recombinant β4 integrinsubunit. J Cell Biol 118(4):951–959

Guo W, Pylayeva Y, Pepe A, Yoshioka T, Muller WJ, Inghirami G,Giancotti FG (2006) Beta4 integrin amplifies ErbB2 signaling topromote mammary tumorigenesis. Cell 126(3):489–502

Haslam SZ, Woodward TL (2001) Reciprocal regulation of extracellularmatrix proteins and ovarian steroid activity in the mammary gland.Breast Cancer Res 3(6):365–372

Hopkinson SB, Hamill KJ, Wu Y, Eisenberg JL, Hiroyasu S, Jones JCR(2014) Focal contact and hemidesmosomal proteins in keratinocytemigration and wound repair. AdvWound Care (New Rochelle) 3(3):247–263

Huang JG, Gao XJ, Li QZ, Lu LM, Liu R, Luo CC,Wang JL, Qiao B, JinX (2012) Proteomic analysis of the nuclear phosphorylated proteinsin dairy cow mammary epithelial cells treated with estrogen. VitroCell Dev Biol Anim 48(7):449–457

Huang RY, IpMM (2001) Differential expression of integrin mRNAs andproteins during normal rat mammary gland development and incarcinogenesis. Cell Tissue Res 303(1):69–80

Hynes RO (2002) Integrins: bidirectional, allosteric signaling machines.Cell 110(6):673–687

Jones JC, Hopkinson SB, Goldfinger LE (1998) Structure and assemblyof hemidesmosomes. BioEssays 20(6):488–494

Lambert AW, Ozturk S, Thiagalingam S (2012) Integrin signaling inmammary epithelial cells and breast cancer. ISRN Oncol 2012:493283

Liu C, Zhao F, Li Q (2012) Influence of different hormone and cytokinerelated lactation on the proliferation ofmammary epithelial cells of dairycow. China Anim Husb Vet Med 39(5):102–106, Article in Chinese

Lu L, Gao X, Li Q, Huang J, Liu R, Li H (2012) Comparativephosphoproteomics analysis of the effects of L-methionine on dairycow mammary epithelial cells. Can J Anim Sci 92(4):433–442

Mainiero F, Pepe A, Yeon M, Ren Y, Giancotti FG (1996) The intracel-lular functions of alpha6beta4 integrin are regulated by EGF. J CellBiol 134(1):241–253

Masso-Welch PA, Verstovsek G, Ip MM (1999) Alterations in the ex-pression and localization of protein kinase C isoforms during mam-mary gland differentiation. Eur J Cell Biol 78(7):497–510

McGrath MF, Collier RJ, Clemmons DR, BusbyWH, Sweeny CA, KriviGG (1991) The direct in vitro effect of insulin-like growth factors(IGFs) on normal bovinemammary cell proliferation and productionof IGF binding proteins. Endocrinology 129(2):671–678

Miyamoto S, Teramoto H, Gutkind JS, Yamada KM (1996) Integrins cancollaborate with growth factors for phosphorylation of receptor tyro-sine kinases and MAP kinase activation: roles of integrin aggregationand occupancy of receptors. J Cell Biol 135(6 Pt 1):1633–1642

Motyl T, Bierła JB, Kozłowski M, Gajewska M, Gajkowska B,Koronkiewicz M (2011) Identification, quantification and transcrip-tional profile of potential stem cells in bovine mammary gland.Livest Sci 136(2):136–149

Nickerson SC, Owens WE, Boddie RL, Boddie NT (1992) The effect ofchronic immunostimulation of the nonlactating bovine mammarygland with interleukin-2, pokeweed mitogen, and lipopolysaccha-ride. J Dairy Sci 75(12):3339–3351

Nievers MG, Schaapveld RQ, Sonnenberg A (1999) Biology and func-tion of hemidesmosomes. Matrix Biol 18(1):5–17

Purup S, Sejrsen K, Foldager J, Akers RM (1993) Effect of exogenousbovine growth hormone and ovariectomy on prepubertal mammarygrowth, serum hormones and acute in vitro proliferative response ofmammary explants from Holstein heifers. J Endocrinol 139(1):19–26

Raymond K, Faraldo MM, Deugnier MA, Glukhova MA (2012)Integrins in mammary development. Semin Cell Dev Biol 23(5):599–605

Sakamoto K, Yano T, Kobayashi T, Hagino A, Aso H, Obara Y (2007)Growth hormone suppresses the expression of IGFBP-5, and pro-motes the IGF-I-induced phosphorylation of Akt in bovine mam-mary epithelial cells. Domest Anim Endocrinol 32(4):260–272

Schwartz MA, Assoian RK (2001) Integrins and cell proliferation: regu-lation of cyclin-dependent kinases via cytoplasmic signaling path-ways. J Cell Sci 114(Pt 14):2553–2560

Schwartz MA, Ginsberg MH (2002) Networks and crosstalk: integrinsignalling spreads. Nat Cell Biol 4(4):E65–E68

Shaw LM (1999) Integrin function in breast carcinoma progression. JMammary Gland Biol Neoplasia 4(4):367–376

Stahl S, Weitzman S, Jones JC (1997) The role of laminin-5 and itsreceptors in mammary epithelial cell branching morphogenesis. JCell Sci 110(Pt 1):55–63

Stiening CM (2005) Genomic regulation of bovine mammary epi-thelial cell growth and differentiation. Dissertation, Universityof Arizona

Streuli CH, Akhtar N (2009) Signal co-operation between integrins andother receptor systems. Biochem J 418(3):491–506

Streuli CH, Edwards GM, Delcommenne M, Whitelaw CB, Burdon TG,Schindler C, Watson CJ (1995) Stat5 as a target for regulation byextracellular matrix. J Biol Chem 270(37):21639–21644

Suzuki R, Atherton AJ, O’Hare MJ, Entwistle A, Lakhani SR, Clarke C(2000) Proliferation and differentiation in the human breast duringpregnancy. Differentiation 66(2–3):106–115

Suzuki RN, Entwistle A, Atherton AJ, Clarke C, Lakhani SR, O’HareMJ(2002) The expression patterns of integrin subunits on human breasttissues obtained during pregnancy. Cell Biol Int 26(7):593–598

Taddei I, Faraldo MM, Teuliere J, Deugnier MA, Thiery JP, GlukhovaMA (2003) Integrins in mammary gland development and differen-tiation of mammary epithelium. J Mammary Gland Biol Neoplasia8(4):383–394

Tait L, Soule HD, Russo J (1990) Ultrastructural and immunocytochem-ical characterization of an immortalized human breast epithelial cellline MCF-10. Cancer Res 50(18):6087–6094

Uematsu J, Nishizawa Y, Sonnenberg A, Owaribe K (1994)Demonstration of type II hemidesmosomes in a mammary glandepithelial cell line, BMGE-H. J Biochem 115(3):469–476

Weaver VM, Lelièvre S, Lakins JN, Chrenek MA, Jones JCR, GiancottiF, Werb Z, Bissell MJ (2002) β4 integrin-dependent formation ofpolarized three-dimensional architecture confers resistance to apo-ptosis in normal and malignant mammary epithelium. Cancer Cell2(3):205–216

Werner ME, Chen F, Moyano JV, Yehiely F, Jones JC, Cryns VL (2007)Caspase proteolysis of the integrin beta4 subunit disruptshemidesmosome assembly, promotes apoptosis, and inhibits cellmigration. J Biol Chem 282(8):5560–5569

Woodward TL, Mienaltowski AS, Modi RR, Bennett JM, Haslam SZ(2001) Fibronectin and the alpha(5)beta(1) integrin are under devel-opmental and ovarian steroid regulation in the normal mouse mam-mary gland. Endocrinology 142(7):3214–3222

Woodward TL, Sia MA, Blaschuk OW, Turner JD, Laird DW (1998)Deficient epithelial-fibroblast heterocellular gap junction communi-cation can be overcome by co-culture with an intermediate cell typebut not by E-cadherin transgene expression. J Cell Sci 111(Pt 23):3529–3539

Worster DT, Schmelzle T, Solimini NL, Lightcap ES, Millard B, MillsGB, Brugge JS, Albeck JG (2012) Akt and ERK control the prolif-erative response of mammary epithelial cells to the growth factorsIGF-1 and EGF through the cell cycle inhibitor p57Kip2. Sci Signal5(214):ra19

Yoon SO, Shin S, Lipscomb EA (2006) A novel mechanism for integrin-mediated ras activation in breast carcinoma cells: the alpha6beta4integrin regulates ErbB2 translation and transactivates epidermalgrowth factor receptor/ErbB2 signaling. Cancer Res 66(5):2732–2739

ZHAO ETAL.

Zhao F, Liu C, Li Q (2012) Detection of integrin subunits α5 and β1 bydouble immunofluorescence labeling staining of cow mammarygland. J Northeast Agric Univ 43(6):46–50, Article in Chinese

Zhou Y (2007) Effects of growth hormone and insulin-like growth factor-1 on milk protein gene expression and nutrient uptake and cell

proliferation in clonal bovine mammary epithelial cells.Dissertation, Virginia Polytechnic Institute and State University

Zhou Y, Akers RM, Jiang H (2008) Growth hormone can induce expres-sion of four major milk protein genes in transfected MAC-T cells. JDairy Sci 91(1):100–108

INTEGRIN Α6Β4 IN DAIRY COW MAMMARY DEVELOPMENT