Juxtaposition of the T-Cell Receptor α-Chain Locus (14q11) and a Region (14q32) of PotentialImportance in Leukemogenesis by a 14;14 Translocation in a Patient with T-Cell ChronicLymphocytic Leukemia and Ataxia-TelangiectasiaAuthor(s): Michael P. Davey, Virginia Bertness, Kenneth Nakahara, John P. Johnson, O.Wesley McBride, Thomas A. Waldmann and Ilan R. KirschSource: Proceedings of the National Academy of Sciences of the United States of America,Vol. 85, No. 23 (Dec. 1, 1988), pp. 9287-9291Published by: National Academy of SciencesStable URL: http://www.jstor.org/stable/32934 .

Accessed: 07/05/2014 17:42

Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at .http://www.jstor.org/page/info/about/policies/terms.jsp

.JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range ofcontent in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new formsof scholarship. For more information about JSTOR, please contact support@jstor.org.

.

National Academy of Sciences is collaborating with JSTOR to digitize, preserve and extend access toProceedings of the National Academy of Sciences of the United States of America.

http://www.jstor.org

This content downloaded from 169.229.32.136 on Wed, 7 May 2014 17:42:48 PMAll use subject to JSTOR Terms and Conditions

Proc. Natl. Acad. Sci. USA Vol. 85, pp. 9287-9291, December 1988 Medical Sciences

Juxtaposition of the T-cell receptor a-chain locus (14qll) and a region (14q32) of potential importance in leukemogenesis by a 14;14 translocation in a patient with T-cell chronic lymphocytic leukemia and ataxia-telangiectasia

(genomic cloning/recombination/somatic cell hybrids/chromosomal in situ hybridization)

MICHAEL P. DAVEY*t, VIRGINIA BERTNESSt, KENNETH NAKAHARAt, JOHN P. JOHNSON?, 0. WESLEY MCBRIDE1, THOMAS A. WALDMANN*, AND ILAN R. KIRSCHtII

*Metabolism Branch and ?Laboratory of Biochemistry, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; *National Cancer Institute-Navy Medical Oncology Branch, Naval Hospital, Bethesda, MD 20814; and ?Childrens Hospital-Oakland, 747 52nd Street, Oakland, CA 94609

Contributed by Thomas A. Waldmann, August 31, 1988

ABSTRACT We describe a t(14;14)(qll;q32) translocation in a patient with T-cell chronic lymphocytic leukemia and ataxia-telangiectasia (AT). By using a battery of joining (J)- segment probes from the T-cell receptor (TCR) a-chain locus TCRA, three distinct J,4 rearrangements were observed. One rearrangement reflected a normal TCRA variable (V) region Va4-to-J, recombination. The second rearrangement was caused by the translocation event itself, which joined a DNA segment from 14q32 centromeric to the immunoglobulin heavy chain locus (IGH) and a J<. gene located =75 kilobases (kb) 5' of the TCRA constant region gene (Cet). A third rearrangement in- volved a 17-kb internal deletion 3' to the translocation, a rearrangement within the J,4 locus that has been observed once before in a patient with AT. Analysis of these three rearrange- ments underscores the increase in aberrant locus-specific re- combination in lymphocytes from patients with AT. Further- more, these studies support the view that a growth-effecting gene is present in the 14q32 region that participates in the leukemo- genic process.

Ataxia-telangiectasia (AT) is a familial disorder characterized by cerebellar ataxia, oculocutaneous telangiectasia, varying degrees of immunodeficiency, and an increased incidence of malignancy (1). Phytohemagglutinin-stimulated peripheral blood lymphocytes obtained from patients with AT show an increased frequency of translocations and inversions clustered at bands 7p13-7pl4, 7q32-7q35, 14qll, and 14q32 (2). It is within these bands that are localized the T-cell antigen receptor (TCR) genes and immunoglobulin heavy chain gene (IGH) (see ref. 3 for review) that normally undergo DNA recombination to generate active genes. It has been postulated that a disorder in the normal process of recombination underlies the common karyotypic abnormalities seen in lymphocytes of patients with AT. Aberrant recombination of TCR loci with one another or the IGH locus could lead to the inversions and translocations that are frequently observed (4, 5). Inversions between 14qll and 14q32 have been described in which the IGHlocus and TCR a chain locus (TCRA) were involved (6, 7). The proliferative advantage, if any, of these recombinations is unclear.

Neoplasia is a frequent occurrence appearing in at least 10% of the AT patients (8). Eighty percent of these neoplasms are lymphoid (9), predominantly of T-cell origin (8). T-cell tumors including prolymphocytic leukemia (10), adult T-cell leukemia (11), and those associated with AT frequently contain translocations and inversions between sites of TCR genes and position 14q32 (12-14). Recently evidence has

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. ?1734 solely to indicate this fact.

accumulated that frequently the breakpoints at 14q32 in T-cell tumors are found on the centromeric side of the IGH locus (15-17). To date, there is no evidence that a TCR gene is found at this position, and thus it has been speculated that the region may contain a cellular transforming gene important in the etiology of T-cell malignancies (18, 19).

We have analyzed in molecular detail a T-cell chronic lymphocytic leukemia (CLL) with a t(14;14)(q11;q32) translo- cation in a 32-yr-old woman with AT. Peripheral blood lym- phocytes from this patient have included cells carrying a t(14;14) for over 10 yr (case 2 in ref. 13). For the last 3 yr, the white blood count has been =35,000/mm3, 60% of which are mature- appearing lymphocytes. The patient's older sister had AT and died of a T-cell leukemia with the same marker chromosome 14 [t(14;14)(q11;q32)] as the case analyzed here (13). Our analysis indicates that a site-specific recombination event has led to the joining of a joining (J) region gene (Ja) from within TCRA to a segment of DNA located at position 14q32 centromeric to the IGH locus. The 14q32 restriction map and sequence data** from the breakpoint region lacks homology with other break- points previously reported from this region (16, 17, 20).

MATERIALS AND METHODS Southern Blot Analysis. DNA was extracted from granulo-

cyte and lymphocyte fractions of peripheral blood cells prepared by Ficoll/Hypaque gradient centrifugation. South- ern blot analysis was performed as described (7). The probe Ja33 (Fig. 1 Upper) was prepared from a germ-line phage clone containing a previously reported Ja gene (ref. 21; "'JaC," a gift of Tak Mak) at its 3' end. The Ja75 probe (Fig. 1 Upper) was a gift of Mark Minden (ref. 22; "JaG").

Genomic Library Preparation and Analysis. A genomic library was constructed in EMBL-3 (Promega) with partial Mbo I-digested DNA from the lymphocyte-enriched fraction. Subclones were prepared in pGEM3 (Promega) and phage M13 vectors. The dideoxy chain-termination method (23) was used for DNA sequencing. An IBM PS2 with the PC-Gene (IntelliGenetics, Mountain View, CA) program was used for data analysis and sequence comparison with other 14q32 breakpoints. Consensus and deduced invariant amino acid sequences for variable (V) region Va and Ja genes within TCRA were identified by comparison with previously re-

Abbreviations: AT, ataxia-telangiectasia; C, constant; CLL, chronic lymphocytic leukemia; D, diversity; H, heavy; J, joining; TCR, T- cell receptor; V, variable. tPresent address: Oregon Health Sciences University, VA Medical Center, Portland, OR 97207. IlTo whom reprint requests should be addressed. **The sequence reported in this paper is being deposited in the

EMBL/GenBank data base (accession no. J04135).

9287

This content downloaded from 169.229.32.136 on Wed, 7 May 2014 17:42:48 PMAll use subject to JSTOR Terms and Conditions

9288 Medical Sciences: Davey et al. Proc. Natl. Acad. Sci. USA 85 (1988)

ported sequences (24). GenBank and EMBL data bases were accessed via the Bionet National Computer Resource.

Breakpoint Localization. 3H-labeled, nick-translated probe was used for chromosomal in situ hybridization as described (25). Human-hamster cell hybrids prepared from the GM0073 cell line carrying a t(X;14) translocation (Camden strains repository) have been described (26, 27).

RESULTS Pertinent Laboratory Features of the Leukemia. The patient

was a 32-yr-old woman with AT and stage 0 CLL (28). The absolute lymphocyte count was 21,000/mm3 (leukocytes, 34,800) with 46% lymphocytosis in the bone marrow. The leukemic cells expressed CD3 and CD4 cell-surface antigens. G-banding of fresh leukemic cells confirmed the t(14;14)- (qll;q32) translocation. A 14q- chromosome was rarely observed. High-resolution R-banding (performed by Alain Aurias) suggested that an interstitial duplication and inver- sion had occurred within the q32 band at the breakpoint (data not shown). Southern blot analysis using a probe to the J region heavy (H) chain gene (JH) showed a germ-line pattern for DNA obtained from the lymphocyte fraction, while a probe to the TCR , chain gene, TCRB, demonstrated the clonal nature of the lymphocyte population (data not shown).

Three Rearrangements Occurred Within the J4. Locus. Southern blot analysis was performed with a battery of probes from within the J, locus. Three rearrangements were detected with the probes illustrated in Fig. 1A. By using a Ja probe from a region 33 kb 5' to the constant (C) region gene Ca, (referred to as "Ja33") on EcoRI-digested DNA, a 4.4-kb germ-line band was observed in the granulocyte fraction (Fig. 1B Right, lane G), and two rearranged bands of 1.2 and 3.4 kb were observed in the lymphocyte fraction (Fig. 1B Right, lane L). A probe located 75 kb to 5' to the Ca gene (referred to as "Ja75") hybridized to a 10-kb germ-line fragment on BamHI-digested DNA from the granulocyte fraction (Fig. 1B Left, lane G). A single rearrangement of 18 kb was seen in

A c^ C, exl 80 70 60 50 40 30 20 10 exl

n i I I I I I I I

J,,75 J,,33 1 kb

B L G G L

_4-4.4

e Al y 3.4 18- i l

10- 0 - i

1.2

BamHI EcoRI J&t75 Jaf33

FIG. 1. Location of Ja probes used and rearrangements detected on Southern blot analysis. (A) The Ja locus spans -85 kb of DNA between the C, and C, genes, here depicted by their first exons (exl). The numbers above the line represent distance in kb 5' to Ca. The two Jct probes used here are indicated by the black solid bars below the line. (B) Southern blot analysis with DNA from granulocyte (G)- and lymphocyte (L)-enriched peripheral blood fractions from the patient studied here. Restriction enzymes and probes used are indicated at the bottom of each panel, the numbers refer to sizes in kb, dashes indicate germ-line positions, and arrows indicate rearranged bands.

DNA from the lymphocyte fraction (Fig. 1B Left, lane L). Nonleukemic cells in the lymphocyte-enriched fraction ac- counted for the bands present at the germ-line positions in the L columns of Fig. 1B.

The 3.4-kb EcoRI Fragment Hybridizing to the Ja33 Probe Represents a V-J, Recombination. Recombinant phage clones corresponding to the three Ja rearrangements were isolated from the genomic library. In Fig. 2A, we show the restriction map of the 3.4-kb EcoRI rearrangement detected with the Ja33 probe. Comparison of this map with one obtained from a phage clone representing the germ-line equivalent of this region allowed the site of recombination to be identified. DNA sequence analysis, a portion of which is shown in Fig. 2B, revealed that a recombinational event had occurred between a Va (identified by the invariant amino acid residues underlined with a solid line in Fig. 2B) and a Ja gene (identified by the consensus amino acid sequences underlined with a dashed line in Fig. 2B). This is an in-frame and po- tentially productive Va-Ja rearrangement. Indeed, the tumor cells exhibited a CD3+ surface phenotype, and a mature 1.6-kb TCR a chain mRNA was detected on RNA blot-hybridization (Northern) analysis (data not shown).

A Deletional Event Has Occurred Within the J4,, Locus. The restriction map of a DNA segment from a phage clone containing the 1.2-kb EcoRI rearrangement detected with probe Ja33 is shown in Fig. 3A along with a map from a clone representing the germ-line equivalent of this region. After identification of the site of recombination, DNA sequencing was performed. A Ja gene was identified at the 3' side of the rearrangement (consensus amino acid residues are under- lined with a dashed line in Fig. 3B). Heptamer signal sequences were identified on the germ-line Ja33 fragment (Fig. 3B). Sequence analysis performed on 1 kb of DNA immediately 5' of the rearrangement failed to identify a V region gene or signal sequences and lacked homology with mammalian sequences listed in GenBank and EMBL data bases. Comparison of restriction maps of germ-line phage clones representing the 5' end of the Ja locus with a map of the DNA segment from 5' of the rearrangement identified a region 50 kb 5' to Ca that had a similar pattern. It was shown that the rearranged DNA segment originated from this position when a probe from immediately 5' of the 1.2-kb EcoRI rearrangement hybridized to germ-line phage clones containing an insert that was 50 kb 5' of Ca but not to other phage clones that represented other regions of the Ja locus (data not shown). A restriction map of the germ-line equiv- alent of this region (referred to as "Xa5O" to reflect the

A 3.4 EcoRI vJ

II I I RB P PH H B R

1kb

B GATTCAGCCACCTACCTCTGT GTGGTGAAC A s p S e r A I a T h r T y L e u C y s V a I V a I A s n

TATGGTCAGAAT TTTGTCT TTGGTCCCGGA T y r G I y G I n A s n P h e V a I P h e G I I P r o G I Y

ACCAGATTGTCCGTGCTGCCCTGTAAGTAC T h r A r g L e u S e r V a I L e u P r o

FIG. 2. Restriction map, nucleic acid sequence, and amino acid translation of the Va-Ja rearrangement. (A) Restriction map of the rearranged 3.4-kb EcoRI fragment identified with the Ja33 probe. The Va segment is indicated by a solid bar and the Ja segment by an open bar. R, EcoRI; B, BamHI; P, Pst I; H, HindIll. (B) Partial nucleotide sequence and amino acid translation of the region surrounding the V- J recombination. Va sequences are to the left of the arrow. The invariant Va residues are underlined with a solid line. The consensus JIa residues are underlined with a dashed line.

This content downloaded from 169.229.32.136 on Wed, 7 May 2014 17:42:48 PMAll use subject to JSTOR Terms and Conditions

Medical Sciences: Davey et al. Proc. Natl. Acad. Sci. USA 85 (1988) 9289

A S S R R S S , , Xa,50 Germline

H B HII B H B S S R R R

1.2 EcoRl H B HII H B H H B

R R , I I Ifi , | | | | J0,.33 Germline

B B HH B H H B 0 13 l~~~kb

Ja33 1k

B Heptamer Xa5O GCACCCCCACGCACACTGCTGCCTGCCTCTGTAACCATCAGCTGTATTT

1.2 EcoRl G C A C C C C C A C AG A A AIT A AC C AG G G AG GA A AG C T T A T C T T C G G A C AG G G A II I II 111 1111111111 111 1 III

J.33 CACAGTGTGCATTTATAACCAGGGAGGAAAGCTTATCTTCGGACAGGGA Heptamer LYLEUIePhG! h G InG1X

FIG. 3. Restriction map and nucleic acid sequence of the X,a50-J,a33 rearrangement/deletion. (A) Restriction map of the Xa'50 (solid bar) and Jat33 (open bar) germ-line gene segments that recombined to produce the 1.2-kb EcoRI fragment identified with the J,a33 probe (open box at bottom). S, Sst I; H, HindlIl; B, BamHI; R, EcoRI; HII, Hincll. (B) Partial nucleic acid sequence of the two germ-line fragments (X,a50 and Ja,33) and the recombined fragment (1.2 EcoRI). Heptamer signal sequences are indicated by the solid line and labeled. Sequences in boxes are at the point of recombination and probably represent N-region addition. Identical sequences are indicated by vertical lines. The amino acid translation is shown for a portion of the J,a33 germ-line sequence. J, consensus residues are underlined with a dashed line.

distance 5' of C,; a J, gene is not present for at least the first 1 kb on the 5' side of the rearrangement) is shown in Fig. 3A with the corresponding DNA sequence analysis in Fig. 3B. Heptamer-like sequences were identified in the germ-line fragment from X,a50 immediately beyond the point of the break, indicating that a site-specific rearrangement probably occurred between X,a50 and J,a33. Four bases were identified at the point of recombination that were not derived from either germ-line fragment and that may represent N-region (a sequence generated in the absence of a template) addition. Thus, the 1.2-kb EcoRI rearrangement represents a site- specific rearrangement and resultant 17-kb internal deletion within the J, locus.

Cloning and Sequencing of the Translocation Breakpoint. Since the V,-J, rearrangement represented by the 3.4-kb EcoRI fragment would have deleted all of the J,a locus 5' of J,33, thereby making these sites unavailable as recipients of additional recombinational events, we assumed that this re- arrangement occurred at the cytogenetically normal position 14qll (closest to the centromere; see Fig. 6). However, the rearrangement described above between X,50 and J,33 would still allow for recombination at the 5' end of the J, locus (see

Fig. 6)-i.e., 25 kb of 5' J, genes remain. The 18-kb BamHI rearrangement detected with J,a75 was therefore a likely candidate to represent the translocation. Phage clones repre- senting this rearrangement and the germ-line equivalent of J,J75 were obtained, and the site of recombination was iden- tified by restriction map analysis (Fig. 4A) and sequenced (Fig. 4B). Recombination occurred into a J,, gene (as indicated by the consensus amino acid residues underlined with a dashed line in Fig. 4B). Heptamer and nonamer signal sequences (indicated by the solid line in Fig. 4B) were identified in the germ-line 14qll clone at sites 5' to the J element. The sequences 5' to the site of recombination lacked invariant sequences that would be present in a V, or VH region gene. A search of the GenBank and EMBL data bases performed on the 400 nucleotides immediately 5' of the rearrangement indicated the presence of Alu sequences. A nonreiterated 350-base-pair EcoRI-Pst I fragment from the 5' side of the rearrangement (indicated by an asterisk in Fig. 4A) was used to isolate a genomic clone representing the germ-line equiva- lent of this rearrangement. Restriction mapping (indicated by 14q32 germ line in Fig. 4A) and sequencing (Fig. 4B) was performed. There was a heptamer-like sequence (TACAGTC)

A M* R R R R S

| ? 14q32 Germline H P

R R S SR _ t(14;14) (q1l; q32)

H P HilIHil B B S R S SR

I , I I I 14q11 Germtine PHIIHII B B

r _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 1 l kb

J,,75

B Heptamer

14q32 Germline G T A A A T A A T A T T T A C * A A A T T G C A T C T G A C A A G A G A A G T C T T T G T A C AG T G AG T A A C T C G T C C T G C G A A T T C T C A A A T

T T T A T T T C C T G. . . - I I I II IG G G TT I

t(14;14) (qll; q32) G T A A A T A A T A T T T A C T A A A T T G C A T C T G A * * G A GA G A A A C C AG T G G G T C T A G G T T GA C C T T T G G G G A AG G A A C A

14q11 Germline AG G T T T T T T G C A A A G T C C T C T T C T C AG C A C A G T G T T T A A G A A A C C AG T G G G T C T A G G T T G A C C T T T G G G G A AG G A A C A Nonarner Heptamer Le u T h r P h e G I y G I u G I y T h r

FIG. 4. Restriction map and nucleic acid sequence of the t(14;14)(qll;q32) translocation. (A) Restriction map of the 14q32 (solid bar) and 14qll (open bar) germ-line gene segments that recombined causing the t(14;14)(qll;q32) translocation. The Jat75 probe is indicated at the bottom. The 0.35-kb EcoRI-Pst I fragment used as a probe representing the 5' side of the breakpoint is shown by an asterisk. Restriction enzymes are abbreviated as in Fig. 3. (B) Partial nucleic acid sequence of the two germ-line fragments (14q32 and 14qll) and the fragment representing the t(14;14)(qll;q32) translocation. Specific areas of the sequence are labeled as in Fig. 3. Nucleotides representing insertions or deletions are indicated by dots.

This content downloaded from 169.229.32.136 on Wed, 7 May 2014 17:42:48 PMAll use subject to JSTOR Terms and Conditions

9290 Medical Sciences: Davey et al. Proc. Natl. Acad. Sci. USA 85 (1988)

A der X der 14 der ? Translocation or

C= Deletion I 3 NP I TCRA

PPOLP2 P P P B Ch 14

NP ! n n M l~~~~~~~~~~TCRA

CKBB PPOLP2 IGH Breakpoint Probe _. Hybridization: - + + 14q32- CKBB

FIG. 5. Summary of mapping data on the translocation breakpoint sequences. (A) Somatic cell human-hamster hybrid data with a probe derived from the DNA segment brought into Ja75 by a site-specific recombination event (0.35-kb EcoRI-Pst I, see Fig. 4). This probe does not hybridize to the derivative X chromosome derived from GM0073 and containing the CKBB (creatine kinase, brain type) and IGH loci. However, it does hybridize to the derivative 14 chromosome and a subsequent derivative of that derl4 that has lost the NP (nucleoside phosphorylase) and TCRA loci while still retaining the PPOLP2 [poly(ADP-ribose) polymerase II pseudogene 2] locus. (B) Chromosome in situ hybridization using this same probe on normal chromosomes localizes the sequence at band 14q32. Seventy metaphases were analyzed. Of these, 24% showed a grain or grains associated with 14q32. Grains at 14q32 represented 11% of total chromosome-associated grains. No other significant site of grain accumulation was observed (P << 0.05).

located six nucleotides from the site of recombination (top line in Fig. 4B). Two nucleotides (boxed area in the middle line of Fig. 4B) were present at the point of recombination that may represent N-region addition. Three nucleotides, CAA, located four bases 5' from the point of recombination were deleted, and one residue, T, was inserted 20 bases 5' of the rearrange- ment. Northern blot analysis using the 350-base-pair EcoRI- Pst I probe did not identify a mRNA transcript.

The Breakpoint Is Located Centromeric to IGH at 14q32. The breakpoint was localized by using the probe shown in Fig. 4A (indicated by an asterisk). As indicated in the summary Fig. 5A, the probe failed to identify human-hamster hybrids containing a segment of chromosome 14 located between q32 and the telomere that had been shown previously to contain the IGH locus. Furthermore, the probe did identify a t(14;X) hybrid that had deleted TCRA. Chromosomal in situ hybrid- ization (Fig. SB) localized the probe to 14q32. These results indicate that the translocation event joined a DNA segment from a position centromeric to the IGH locus at 14q32 with a Ja gene located "-75 kb 5' to the Ca locus.

DISCUSSION Patients with AT have an increased frequency of nonrandom chromosomal abnormalities and a high incidence of neoplasia. The patient studied here had two TCRA Ja-associated rear- rangements in addition to the normal Va...Ja recombination (Fig. 6). One of these rearrangements represented an unex- pected finding. A rearrangement/deletion from within the Ja locus occurred 3' of the translocation (Fig. 6). A segment (Xa5O) of DNA 50 kb 5' of Ca rearranged into Ja33, resulting in a 17-kb deletion. N-region addition was observed. As anticipated, a germ-line heptamer recognition sequence was observed 5' to the Ja33 gene (Fig. 3B). Furthermore, a germ-line heptamer sequence was observed 3' to the Xa50 element (Fig. 3B) that was joined despite the fact the sequence analysis of DNA immediately 5' of the rearrangement did not reveal either a V or J region or further signal sequences that would be anticipated with a diversity region element. It was recently reported that aberrant rearrangements occurring between different segments of the Ja locus may not be an uncommon finding (33). This represents the second report of a Ja chromosomal translocation with an internal deletion occurring some distance 3'. An unrelated AT patient with a

T-cell tumor carrying an inversion mutation, invl4(qll;q32), showed a similar internal deletion 3' to a breakpoint beginning =50 kb 5' to Ca (20, 33). The contribution, if any, of these deletional events to tumorigenesis remains speculative. One result of deletions within the J, locus is that genetic elements involved in translocations and inversions occurring at the 5' end of the locus would be positioned closer to enhancer sequences located between Ca and the first Ja gene (34).

The third rearrangement in our patient was caused by the translocation event and joined a DNA segment from 14q32 to a J, gene located -75 kb 5' of Ca. Translocation and inver- sions between sites of TCR genes (a/8 chain genes at 14qll, ,B chain gene at 7q35, and y chain genes at 7p13) and 14q32 occur rarely in T cells from normal individuals (35) but in a much higher frequency in T cells from patients with AT (2) and in T-cell tumors (10, 11). With the exception of T-cell tumors or the rare case of an expanded clone in AT patients, for the

t( 14;14)(ql l;q32)

(qll;q32) qll

4 ~~~~~0 /s~~~\ cajavay

Ca Ja33 X 50 Ja75 q32

10kb

FIG. 6. Schematic representing the marker 14q+ chromosome present in the T-cell CLL studied here. The centromere is to the right and telomere to the left. The V,a-J,a rearrangement has occurred at the qll site closest to the centromere. The hatched area to the right of the (qll;q32) breakpoint represents the region where a probable duplication with inversion of bands 14q32.1-14q32.3 has been described as discussed in previous reports (29-32). The events occurring within the J,, locus at the breakpoint are indicated. A DNA segment from 14q32 (solid bar) has recombined with Ja,75. The hatched bar represents that portion of the Jc, locus located between 50 and 75 kb 5' to Ca. The rearrangement/deletion between X,a50 and Jc,33 that occurred 3' to the translocation is indicated. The remainder of the Ja locus (between C, and Jcr33) is indicated by an open bar.

This content downloaded from 169.229.32.136 on Wed, 7 May 2014 17:42:48 PMAll use subject to JSTOR Terms and Conditions

Medical Sciences: Davey et al. Proc. Natl. Acad. Sci. USA 85 (1988) 9291

most part karyotypic abnormalities at 14q32 are sporadic- i.e., they do not appear to give the cell much, if any, proliferative advantage. Several lines of evidence now indicate that two different breakpoints, one within the IGH locus and one at a more centromeric position, are present in transloca- tions and inversions of 14q32. Chromosomal exchanges in- volving the region centromeric to IGH (14q32.1) appear to be correlated more directly with cellular proliferation (36).

Molecular analysis of the site of recombination supports the presence of two different breakpoints at 14q32. It appears that one class of chromosomal exchanges in T cells is recombination between members of the immunoglobulin gene superfamily. This is best exemplified by the T-cell line SUP-Ti [invl4(qll ;q32)] where TCRA isjoined to IGH (6,7). This is the result of an in-frame aberrant V-J recombination event, and it is unclear what (if any) contribution this makes to lymphomagenesis. In contrast, 14q32 abnormalities found in AT clones (15), T-cell tumors from AT patients (refs, 15 and 20 and this report), and T-cell tumors from non-AT patients (17) do not involve recombination with the IGH locus. Rather, a DNA segment centromeric of IGH has been implicated, and it is here that a cellular transforming gene may reside. Other investigators have proposed to call this gene "TCLI" (18) or the 14q32.1 locus (20). The results described in this paper show that a translocation has occurred in the leukemic T cells of the AT patient between a TCR Ja gene and a DNA segment located centromeric to the IGH locus at 14q32. Several features of this translocation are similar to those previously reported. In all cases, the trans- location has occurred immediately 5' of a Ja (refs. 17 and 20 and this report) or J4 (16) gene. The germ-line equivalent of the 14q32 breakpoint has been sequenced in two cases (ref. 16 and this report). Both cases show the same mechanism of the translocation in that heptamer recombination signals can be identified on the chromosomal segments immediately adjacent to the breakpoint. Also both cases show probable N-region addition.

A coding region for a cellular transforming gene present in the breakpoint region derived from 14q32 has not yet been identified. Moreover, comparison of restriction maps and sequence data from the previously reported cases (16, 17, 20) and the present case fails to indicate that a specific breakpoint cluster region is present. These observations in T-cell tumors containing inversions or translocations between loci contain- ing TCR genes and 14q32 contrast with the findings with tumors such as follicular lymphoma [t(14;18)(q32;q21)], where the breakpoints cluster within a 4.3-kb region on chromosome 18 (37). It appears that the breakpoints at 14q32 can occur over a relatively broad range centromeric to IGH in T-cell leukemias. This lack of tight clustering of the breakpoint is analogous to the situation in some cases of Burkitt's lymphoma that show altered c-myc expression yet contain breakpoints at a considerable distance from the oncogene (38, 39). By analogy, despite the relatively broad area within which 14q32 breakpoints have been reported, translocations and inversions between a TCR gene and this region might result in altered expression of a transforming gene that could participate in the leukemogenic process. Note Added in Proof. Although, in general, breakpoints in this region appear to be relatively dispersed, since submitting this manuscript we have learned of an additional chromosomal breakpoint cloned from an inv(14) in an AT patient with CLL that has targeted an area only a few kilobases from a breakpoint noted in an inv(14) from a patient without AT (40).

We thank Dr. Marc-Henri Stern for many helpful discussions, Dr. Alain Aurias for cytogenetic analysis, and Gena Parris for her help in the preparation of this manuscript.

1. McKinnon, P. J. (1987) Hum. Genet. 75, 197-208. 2. Aurias, A., Dutrillaux, B., Buriot, D. & Lejeune, J. (1980) Mutat.

Res. 69, 369-374. 3. Waldmann, T. A. (1987) Adv. Immunol. 40, 247-321. 4. Aurias, A. & Dutrillaux, B. (1986) Hum. Genet. 72, 210-214. 5. Hollis, R. J., Kennaugh, A. A., Buitterworth, S. V. & Taylor,

A. M. R. (1987) Hum. Genet. 76, 389-395. 6. Baer, R., Chen, K. C., Smith, S. D. & Rabbitts, T. H. (1985) Cell

43, 705-713. 7. Denny, C. T., Yoshikai, Y., Mak, T. W., Smith, S. D., Hollis,

G. F. & Kirsch, I. R. (1986) Science 320, 549-551. 8. Toledano, S. R. & Lange, B. J. (1980) Cancer 45, 1675-1678. 9. Filipovich, A. H., Heinitz, K. J., Robinson, L. L. & Frizzera, G.

(1987) Am. J. Ped. Hem./Onc. 9, 183-184. 10. Brito-Babapulle, V., Pomfert, M., Matutes, E. & Catovsky, D.

(1987) Blood 70, 926-931. 11. Sadamori, N., Kusano, M., Nishino, K., Tagawa, M., Yao, E.,

Yamada, Y., Amagasaki, T., Kinoshita, K. & Ichimary, M. (1985) Cancer Genet. Cytogenet. 17, 279-282.

12. McGaw, B. K., Hecht, F., Harnden, D. G. & Teplitz, R. L. (1975) Proc. Natl. Acad. Sci. USA 72, 2071-2075.

13. Levitt, R., Pierre, R. V., White, W. L. & Siekert, R. G. (1978) Blood 52, 1003-1011.

14. Sparkes, R. S., Como, R. & Golde, D. W. (1980) Cancer Genet. Cytogenet. 1, 329-336.

15. Kennaugh, A. A., Butterworth, S. V., Hollis, R., Baer, R., Rab- bitts, T. H. & Taylor, A. M. R. (1986) Hum. Genet. 73, 254-259.

16. Russo, G., Isobe, M., Pegoraro, L., Finan, J., Nowell, P. C. & Croce, C. M. (1988) Cell 53, 137-144.

17. Mengle-Gaw, L., Willard, H. F., Smith, C. I. E., Hammarstrom, L., Fischer, P., Sherrington, P., Lucas, G., Thompson, P. W., Baer, R. & Rabbitts, T. H. (1987) EMBO J. 6, 2273-2280.

18. Croce, C. M., Isobe, M., Palumbo, A., Puck, J., Ming, J., Tweardy, D., Erikson, J., Davis, M. & Rovera, G. (1985) Science 227, 1044- 1047.

19. Rabbitts, T. H., Lefranc, M.-P., Stinson, M. A., Sims, J. E., Schroder, J., Steinmetz, M., Spurr, N. L., Solomon, E. & Good- fellow, P. N. (1985) EMBO J. 4, 1461-1465.

20. Baer, R., Heppell, A., Taylor, A. M. R., Rabbitts, P. H., Boullier, B. & Rabbitts, T. H. (1987) Proc. Natl. Acad. Sci. USA 84, 9069- 9073.

21. Sangster, R. N., Minowada, J., Suciu-Foca, N., Minden, M. & Mak, T. W. (1986) J. Exp. Med. 163, 1491-1508.

22. Hara, J., Benedict, S. H., Champagne, E., Mak, T. W., Minden, M. & Gelfand, E. W. (1988) J. Clin. Invest. 81, 989-996.

23. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467.

24. Kabat, E. A., Wu, T. T., Reid-Miller, M., Perry, H. M. & Gottes- man, K. S. (1987) Sequences of Proteins of Immunological Interest (U.S. Dept. of Health and Human Services, Washington, DC), pp. 262-265.

25. Kirsch, I. R., Morton, C. C., Nakahara, K. & Leder, P. (1982) Science 216, 301-303.

26. McBride, 0. W., Hieter, P. A., Hollis, G. F., Swan, D., Otey, M. C. & Leder, P. (1982) J. Exp. Med. 155, 1480-1490.

27. McBride, 0. W., Swan, D. C., Santos, S., Barbacid, M., Tronick, S. R. & Aaronson, S. A. (1982) Nature (London) 300, 773-774.

28. Canellos, G. P. (1985) in Cancer, Principles and Practice of Oncol- ogy, eds. DeVita, V. T., Hellman, S. & Rosenberg, S. A. (Lippin- cott, Philadelphia), pp. 1739-1740.

29. Aurias, A., Couturier, J., Dutrillaux, A., Dutrillaux, B., Herpin, F., Lamoliatte, E., Lombard, M., Muleris, M., Paravatou, M., Prieur, M., Prod'homme, M., Sportes, M., Viegas-Pequignot, E. & Volo- bouev, V. (1985) Hum. Genet. 71, 19-21.

30. Aurias, A., Croquette, M. F., Nuyts, J. P., Griscelli, C. & Dutril- laux, B. (1986) Hum. Genet. 72, 22-24.

31. Johnson, J. P., Gatti, R. A., Sears, T. S. & White, R. L. (1986) Am. J. Hum. Genet. 39, 787-796.

32. Stem, M. H., Zhang, F., Thomas, G., Griscelli, C. & Aurias, A. (1988) Hum. Genet., in press.

33. Baer, R., Boehm, T., Yssel, H., Spits, H. & Rabbitts, T. (1988) EMBO J. 7, 1661-1668.

34. Luria, S., Gross, G., Horowitz, M. & Givol, D. (1987) EMBO J. 6, 3307-3312.

35. Welch, J. P. & Lee, C. L. Y. (1975) Nature (London) 255, 241-242. 36. Aurias, A., Dutrillaux, B. & Griscelli, C. (1983) Hum. Genet. 63,

320-322. 37. Bakhshi, A., Jensen, J. P., Goldman, P., Wright, J. J., McBride,

0. W., Epstein, A. L. & Korsmeyer, S. J. (1985) Cell 41, 889-906. 38. Haluska, F. G., Finver, S,, Tsujimoto, Y. & Croce, C. M. (1986)

Nature (London) 324, 158-161. 39. Graham, M. & Adams, J. M. (1986) EMBO J. 5, 2845-2851. 40. Mengle-Gaw, L., Albertson, D. G., Sherrington, P. D. & Rabbitts,

T, H. (1988) Proc. Nat!. Acad. Sci. USA 85, 9171-9175.

This content downloaded from 169.229.32.136 on Wed, 7 May 2014 17:42:48 PMAll use subject to JSTOR Terms and Conditions