THE ROLE OF RELA (p65) IN REGULATION OF NF-κB

HOMEOSTASIS: IMPLICATIONS FOR ATHEROSCLEROSIS

By

Karanvir Wasal

A thesis submitted in conformity with the requirements

for the degree of Master of Science

Graduate Department of Immunology

University of Toronto

© Copyright by Karanvir Wasal 2011

ii

THE ROLE OF RELA (p65) IN REGULATION OF NF-κB HOMEOSTASIS:

IMPLICATIONS FOR ATHEROSCLEROSIS

Degree of Master of Science, 2011

Karanvir Wasal

Graduate Department of Immunology

University of Toronto

ABSTRACT

The NF-κB/Rel family of transcription factors and IκB inhibitors play a key role in

regulation of gene expression in inflammation and immunity. Previous studies from our

laboratory suggested that steady-state levels of p65 and other NF-κB components in the normal

mouse aorta determine the magnitude of NF-κB target gene expression in response to pro-

inflammatory stimuli, however, the mechanism(s) by which steady-state levels of NF-κB

components are set is not clear. This study aims at elucidating the mechanisms behind NF-κB

homeostasis and how that affects atherosclerosis susceptibility. In HeLa cells and HUVEC,

siRNA silencing of p65 correlated with reduced steady-state expression of a subset of NF-

κB/Rel and IκB genes at the transcriptional and post-transcriptional levels, respectively, in

addition to reducing TNFα-induced NF-κB/Rel and IκB gene expression. This correlation was

also observed in atherosclerosis-susceptible mouse aortic endothelium suggesting the role of

p65 in modulating NF-κB homeostasis and affecting atherosclerosis susceptibility.

iii

ACKNOWLEDGEMENTS

Firstly, I want to thank my supervisors Drs. Jenny Jongstra-Bilen and Myron Cybulsky for their

immense support and invaluable guidance in this project. I would also like to thank my

committee members Drs. Michelle Letarte and Stephen Girardin for providing me excellent

feedback and ideas.

Thanks to all past and current members of the Cybulsky lab, Mian Chen, Suning Zhu, Jacob

Rullo, Henry Becker, Adrianet Puig Cano, Sharon Hyduk and Haiyan Xiao for helping me

throughout my project.

I especially want to thank Mian Chen for her help with the in vivo qRT-PCR experiments

without which my thesis would have been incomplete.

Thanks to my parents for all the moral and emotional support they have given me so far in

completing my master’s degree.

Finally, I want to thank God for his blessings in making this project a success.

iv

TABLE OF CONTENTS

ABSTRACT ________________________________________________________________ ii

ACKNOWLEDGEMENTS ____________________________________________________ iii

TABLE OF CONTENTS_____________________________________________________ iv

ABBREVIATIONS ___________________________________________________________ vi

LIST OF TABLES __________________________________________________________ viii

LIST OF FIGURES _________________________________________________________ ix

CHAPTER-1: Introduction _____________________________________________________ 1

1.1 The NF-κB family of transcription factors _____________________________________________ 2

1.2 NF-κB signalling ________________________________________________________________ 5

1.3 NF-κB and atherosclerosis ________________________________________________________ 10

1.4 Rationale, goal of study and hypothesis ______________________________________________ 13

CHAPTER - 2: Determing the role of RelA (p65) in regulating NF-κB/Rel and IκB

gene expression in unstimulated and TNFα-stimulated cells _________________________ 15

2.1 Specific Aims __________________________________________________________________ 15

2.2 Methods ______________________________________________________________________ 16 2.2.1 Cell culture _______________________________________________________________________ 16 2.2.2 Transfection of HeLa cells and HUVEC with siRNA targeting p65 ____________________________ 16 2.2.3 RNA extraction, cDNA synthesis and Quantitative Real-Time PCR (qRT-PCR): _________________ 17 2.2.4 SDS-PAGE and Western Blotting: _____________________________________________________ 18 2.2.5 Statistics: _________________________________________________________________________ 18

2.3 Results _______________________________________________________________________ 22 2.3.1 Suppression of p65 expression by short interfering RNA (siRNA) in HeLa cells and HUVEC _______ 22 2.3.2 p65 positively regulates the expression of specific NF-κB/Rel and IκB genes in unstimulated

HeLa cells and HUVEC __________________________________________________________________ 24 2.3.3 p65 levels determine the magnitude of NF-κB/Rel and IκB gene expression in TNFα-stimulated

HeLa cells and HUVEC __________________________________________________________________ 29

CHAPTER-3: Determining the role of the canonical NF-κB signalling pathway in

regulating constitutive NF-κB (p65)-dependent transcription in unstimulated

HeLa cells __________________________________________________________________ 32

3.1 Specific Aims __________________________________________________________________ 32 3.1.1 Rationale _________________________________________________________________________ 32

3.2 Methods ______________________________________________________________________ 34 3.2.1 Cell culture _______________________________________________________________________ 34 3.2.2 Pharmacological blockade of IKKβ activity in HeLa cells ___________________________________ 34 3.2.3 Transfection of HeLa cells with siRNA targeting IKKβ _____________________________________ 34

v

3.2.4 Sub-cloning of FLAG-tagged dominant-negative IκBα (dnIκBα) in the pcDNA1 vector ___________ 35 3.2.5 Transfection of HeLa cells with dominant negative IκBα (dnIκBα) ____________________________ 35

3.3 Results _______________________________________________________________________ 36 3.3.1 Pharmacological inhibition of IKKβ significantly reduces TNFα-induced IκBα transcription but

has no effect on constitutive IκBα transcription in HeLa cells _____________________________________ 37 3.3.2 Suppression of IKKβ by siRNA does not sufficiently inhibit the canonical pathway induced

by TNFα ______________________________________________________________________________ 40 3.3.3 Expression of dnIκBα significantly reduces TNFα–induced and constitutive transcription of

RelB, p100 and IκBα in HeLa cells _________________________________________________________ 43

CHAPTER - 4: Investigation of correlations between elevated levels of RelA (p65)

and other NF-κB/Rel and IκB genes in the endothelium of atherosclerosis-susceptible

regions of the normal mouse aorta ______________________________________________ 47

4.1 Specific Aims __________________________________________________________________ 47 4.1.1 Rationale _________________________________________________________________________ 47

4.2 Methods ______________________________________________________________________ 48

4.2.1 Harvesting of endothelial cells from the HP and LP regions of the aorta of CD11c-Diphtheria toxin

receptor (DTR) transgenic mice ____________________________________________________________ 48 4.2.2 RNA extraction, cDNA synthesis and qRT-PCR __________________________________________ 48

4.3 Results _______________________________________________________________________ 51 4.3.1 Elevated levels of p65 correlate with increased RelB, p105, p100 and IκBα expression in the

normal mouse aortic endothelium in regions prone to atherosclerotic lesion formation _________________ 51

CHAPTER - 5: Discussion and Future directions __________________________________ 55

5.1 Discussion ____________________________________________________________________ 56

5.2 Summary and future directions ____________________________________________________ 62

REFERENCES ______________________________________________________________ 65

vi

ABBREVIATIONS

ActD – Actinomycin D

ANK - Ankyrin

ARD – Ankyrin repeat domain

BAFF – B-cell activating factor

BSA – Bovine serum albumin

CBP – Creb binding protein

cDNA – Complementary Deoxyribonucleic acid

ChIP – Chromatin immunoprecipitation

CHX – Cycloheximide

DD – Death domain

DMEM – Dulbecco’s modified eagle medium

DMSO – Dimethyl sulfoxide

DT/DTR – Diphtheria toxin/Diphtheria toxin receptor

ECM – Endothelial cell medium

GRR – Glycine-rich region

HP – High probability region (for atherosclerosis)

HPRT – Hypoxanthine phosphoribosyl transferase

HRP – Horseradish peroxidase

HUVEC – Human Umbilical Vein Endothelial Cells

ICAM-1 – Intercellular adhesion molecule-1

IκB – I kappa B

IKK – I kappa B kinase

KLF – Kruppel-like factor

IL – Interleukin

LP - Low probability region (for atherosclerosis)

LPS – Lipopolysaccharide

LT – Lymphotoxin

LZ – Leucine zipper

MEKK – Mammalian mitogen-activated protein kinase kinase kinase

MEF – Mouse embryonic fibroblast

NEMO – NF-κB essential modifier

NF-κB – Nuclear factor kappa B

NIK – NF-κB inducing kinase

PBS – Phosphate buffered saline

PCR – Polymerase chain reaction

PEST – Proline, Glutamic acid, Serine, Threonine

PVDF - Polyvinylidene fluoride

RHD – Rel homology domain

RIDC – Resident Intimal Dendritic Cells

RIP – Receptor interacting protein

RIPA – Radio-immunoprecipitation assay

RNA – Ribonucleic acid

RNAi – RNA interference

SDS-PAGE – Sodium Dodecyl Sulphate polyacrylamide gel electrophoresis

vii

siRNA – Short-interfering RNA

TAK – Transforming growth factor beta- activated kinase

TAD – Transactivation domain

TBS – Tris buffered saline

TNF – Tumor necrosis factor

TRAF – Tumor necrosis factor receptor-associated factor

VCAM-1 – Vascular cell adhesion molecule-1

UV – Ultraviolet light

viii

LIST OF TABLES

CHAPTER-2

Table-1:Primers for human NF-κB/Rel and IκB genes (mRNA)______________________ 19

Table-2: Primers for human NF-κB/Rel and IκB genes (hnRNA)______________________20

Table-3:Antibodies__________________________________________________________ 21

CHAPTER-4

Table-4: Primers for mouse genes (mRNA)______________________________________ 50

Table-5: Comparison of mRNA expression (normalized to CD31) of NF-κB/Rel genes,

IκBα and an endothelial marker VE-Cadherin between atherosclerosis-susceptible (HP)

and atherosclerosis-resistant (LP) regions of the nomal mouse aorta_____________________52

ix

LIST OF FIGURES

CHAPTER-1

Figure-1: The NF-κB/Rel transcription factors and IκB inhibitors______________________3

Figure-2: Canonical and Non-canonical (Alternative) NF-κB signalling pathways_________6

Figure-3: NF-κB expression and activity is higher at sites pre-disposed to

atherosclerotic lesion formation in the normal mouse aorta__________________________11

CHAPTER-2

Figure-4: Suppression of p65 mRNA and protein expression in HeLa cells and HUVEC___23

Figure-5: Effect of p65 suppression on NF-κB/Rel and IκBα transcription and mRNA

expression in unstimulated HeLa cells______________________________________26

Figure-6: Effect of p65 suppression on NF-κB/Rel and IκB hnRNA, mRNA

and protein expression in unstimulated HUVEC_______________________________28

Figure-7: Effect of p65 suppression on NF-κB/Rel and IκBα transcription and mRNA

expression in TNFα-stimulated HeLa cells_______________________________________ 30

Figure-8: Effect of p65 suppression on NF-κB/Rel and IκBα hnRNA and mRNA

expression in TNFα-stimulated HUVEC_________________________________________ 31

CHAPTER-3

Figure-9: Effect of pharmacological inhibition of the canonical NF-κB pathway on

TNFα-induced and steady-state IκBα transcription in HeLa cells______________________38

Figure-10: Silencing of IKKβ and its effect on TNFα-induced transcription of

RelB, p100 and IκBα in HeLa cells_____________________________________________ 41

Figure-11: Detection of FLAG-tagged dnIκBα mRNA in HeLa cells by qRT-PCR________44

Figure-12: Blockade of canonical NF-κB signalling by dnIκBα expression in HeLa cells___46

CHAPTER-4

Figure-13: p65, RelB, p100, p105 and IκBα mRNA expression in atherosclerosis-prone

(HP) versus resistant regions (LP) of the normal mouse aortic endothelium_____________53

1

CHAPTER - 1: Introduction

2

1.1 The NF-κB family of transcription factors

Generation of an immune response is the result of coordinated and timely regulation of

gene expression by a diverse set of transcription factors. One of the major regulators of the

immune response is the nuclear factor-kappa B (NF-κB/ Rel) family of transcription factors that

control the expression of a myriad of genes involved in regulating inflammation, innate and

adaptive immunity [1]. The NF-κB family consists of five members, namely, RelA (p65), RelB,

cRel, p105 and p100 that function as homo or heterodimers. All five contain a Rel homology

domain (RHD) that mediates dimerization, DNA binding and nuclear localization of NF-κB

(Figure-1). RelA, RelB and cRel contain a C-terminal transactivation domain (TAD) that is

required for activation of target gene transcription while p105 and p100 lack this domain and

thus cannot initiate transactivation of gene expression. Proteolytically cleaved forms of p105

and p100 called p50 (NF-κB1) and p52 (NF-κB2), respectively, typically heterodimerize with

the other three NF-κB members and constitute a functional NF-κB unit. They can also

homodimerize with themselves and due to lack of a TAD, can function as transcriptional

repressors [42]. The prototypic NF-κB dimer consists of RelA and p50 subunits which are

ubiquitously expressed in cells whereas other subunits like RelB, cRel and p52 are

predominantly expressed in haematopoetic and lymphoid cell lineages [2]. Although the

different NF-κB subunits can dimerize with each other and form 15 potential combinations, it

has been reported that RelA and cRel preferentially associate with p50, while RelB

preferentially associates with p52; and these heterodimers are the major drivers of NF-κB

signalling [3].

3

IκBε

Figure-1: The NF-κB/Rel transcription factors and IκB inhibitors

The NF-κB/Rel family of transcription factors consists of five members, namely, RelA, RelB,

cRel, p50 and p52 (proteolytically cleaved from p105 and p100, respectively). The RHD is

conserved among all of these members and mediates DNA binding, dimerization and nuclear

localization. The TAD, present only in RelA, RelB and cRel allows for transactivation of gene

expression. The IκB family of inhibitors sequester NF-κB by the ankyrin (ANK) domain. IκBα

and IκBβ share a C-terminal PEST (Proline, Glutamic acid, Serine, Threonine) domain involved

in protein turnover. Bcl-3, although part of the IκB family can assist in NF-κB gene

transactivation by its TAD. RHD: Rel-homology domain, TAD: Transactivation domain, LZ:

Leucine zipper, GRR: Glycine-rich region, DD: Domain with homology to death domain.

Adapted from Ghosh S and Hayden M. Nat. Rev. Immunol. (2008) 8:837-848.

4

In unstimulated cells, NF-κB remains sequestered in the cytosol by inhibitors of NF-κB

called the IκB proteins which mask the nuclear localization sequence (NLS) of NF-κB and

prevent its import to the nucleus. The IκB family consists of eight members, namely, IκBα,

IκBβ, IκBε, p105 (also called IκBγ), p100 (also called IκBδ), IκBNS, IκBδ, Bcl-3 and a newly

identified ninth member called IκBε [3, 54, 69]. Among these, IκBα, IκBβ, IκBε, p105 p100 and

Bcl-3 (Figure-1) are the best studied.

All IκB proteins contain an ankyrin-repeat domain (ARD), a characteristic structural

feature of these inhibitors. The C-terminal terminal PEST domain is present only in IκBα and

IκBβ and mediates basal turnover. The classical IκB’s, IκBα, IκBβ and IκBε preferentially

associate with RelA/p50 (IκBα and IκBβ), RelA/cRel and RelA/RelA (IκBε) dimers and

undergo signal-induced proteasomal degradation to allow nuclear import of these dimers [4].

p105 (IκBγ) behaves like the classical IκB’s and is also subjected to complete proteasomal

proteolysis upon NF-κB activation to release RelA/p50 and cRel/p50 dimers but, in

unstimulated cells it has been reported to be constitutively processed into p50 by proteolytic

cleavage of its ARD [4]. In contrast, p100 (IκBδ), partnered with RelB in the cell cytoplasm,

only undergoes partial proteasomal processing to generate p52 upon NF-κB activation which

allows the nuclear localization of the RelB/p52 dimer [4]. The putative RelA/p50 and RelB/p52

dimers activate target gene expression via two separate NF-κB signalling pathways which are

discussed in the next section.

5

1.2 NF-κB signalling

NF-κB is activated by numerous pathways but the two major pathways that have been

well characterized are the canonical NF-κB pathway and the non-canonical NF-κB pathway

(Figure-2). Canonical NF-κB signalling is induced by pro-inflammatory mediators like TNFα,

IL-1 and LPS, which bind to their cognate receptors and activate a signalling cascade involving

lysine-63 (K63) poly-ubiquitination of adaptor proteins (RIP1, TRAF2, 5 and 6) and

phosphorylation of kinases (TAK1 and MEKK3) leading to activation of the I kappa B kinase

(IKK) complex [3]. This kinase complex consists of three subunits, namely, IKKα (IKK1),

IKKβ (IKK2) and IKKγ (NEMO) with IKKα and IKKβ being the catalytically active subunits

and NEMO being the regulatory subunit. Activation of the IKK complex is a key step in

canonical NF-κB signalling because this kinase complex is the main transducer of pro-

inflammatory signals leading to NF-κB activation [1, 3]. This step involves conformational

changes in the NEMO subunit by K63 poly-ubiquitination which allows kinases such as TAK1

to activate IKKβ by phosphorylating its catalytic serine residues (Ser-177 and 181). The

molecular mechanism behind activation of IKKα during canonical signalling is still not well

understood, however, there is evidence from the literature that an IKK complex containing

IKKα and NEMO alone can activate NF-κB in response to IL-1 [5]. Nevertheless, it is

established that canonical NF-κB signalling requires the presence of NEMO because NEMO-

deficient cells have a more severe loss of NF-κB activity compared to IKKβ or IKKα-deficient

cells [6].

6

Figure-2: Canonical and Non-canonical NF-κB signalling pathways

The canonical NF-κB pathway is activated by pro-inflammatory stimuli like TNFα, LPS and IL-

1 causing activation of the IKK complex by upstream kinases (MEKK3 and TAK1). IKK

complexes phosphorylate IκB (in this case IκBα) causing subsequent ubiquitination and

proteasomal degradation of IκB and nuclear localization of the prototypic RelA/p50 dimer and

activation of numerous NF-κB target genes involved in inflammation, cell survival and

differentiation. The alternative NF-κB pathway is activated by developmental stimuli such as

lymphotoxin, BAFF and CD40L which leads to activation of NIK and IKKα. IKKα mediated

ubiquitination and subsequent proteasomal processing of p100 results in the nuclear

translocation of a RelB/p52 dimer which activates genes that regulate lymphoid organogenesis.

( ) indicates potential cross-talk between the two pathways via non-canonical stimuli and

( ) indicates RelA-dependent RelB and p100 synthesis precedes the nuclear translocation

of RelB/p52.

Adapted from Bollrath J and Greten FR. EMBO reports. (2009) 10: 1314-19.

7

IKKβ, when activated by pro-inflammatory mediators, subsequently phosphorylates the

classical IκB’s IκBα, IκBβ and IκBε which leads to their lysine-48 (K48) polyubiquitination and

subsequent proteasomal degradation. Degradation of these inhibitors unmasks the NLS of NF-

κB and allows NF-κB nuclear translocation (typically a RelA/p50 heterodimer) which

transactivates the expression of a host of genes regulating inflammation, apoptosis, cell survival

and differentiation [1]. Activation of NF-κB by the canonical pathway is subject to strict control

from a number of feedback loops. Termination of canonical NF-κB signalling by IκBα is the

best studied of these feedback loops. NF-κB-dependent re-synthesis of IκBα occurs within 30-

60 minutes of activation of the canonical pathway [3]. Newly synthesized IκBα gets imported to

the nucleus and binds to NF-κB and exports it back to the cytosol thereby terminating NF-κB

activity. The kinetics of feedback inhibition by IκBα is distinct from those of IκBβ and IκBε

which are degraded and re-synthesized much slower than IκBα and thus sustain the NF-κB

response [7]. Overall, the canonical NF-κB pathway causes a rapid but transient phase of NF-κB

activity that induces the expression of a diverse set of genes.

The non-canonical NF-κB pathway is activated by a different set of stimuli like

lymphotoxin α or β (LTαβ), BAFF and CD40L involved in regulating lymphoid organogenesis

and development [4]. Activation of this pathway involves the stabilization of the NF-κB

inducing kinase (NIK) (which is normally degraded in resting cells) and subsequent NIK-

dependent phosphorylation of IKKα (Ser-176 and 180) which is present as a homodimer

independent of NEMO, a unique feature of this pathway [4]. Once IKKα is activated, it

phosphorylates p100 bound to RelB which leads to polyubiquitination and cleavage of the C-

terminal ARD of p100 by the proteasome (Figure-2).

8

This allows activated NF-κB in the form of a RelB/p52 dimer to undergo nuclear translocation

and activate a distinct subset of chemokines involved in regulating lymphoid tissue development

and adaptive immunity.

In contrast to the canonical pathway, the non-canonical pathway exhibits delayed and

persistent NF-κB activation, which depends on the de novo synthesis of p100 and RelB by the

canonical pathway. Studies in mouse embryonic fibroblasts (MEF’s) have shown that both

LTβR and CD40 signalling first activate the canonical pathway which leads to nuclear

translocation of RelA containing dimers which in turn transcribe RelB and p100 genes [8, 9].

Newly synthesized RelB and p100 translocate to the nucleus as a RelB/p52 dimer via the non-

canonical pathway which activates its own set of target genes as mentioned above. This

illustrates cross-talk between these two pathways whereby a first wave of RelA activity induced

by LTβR or CD40 signalling is required to set the levels of RelB and p100, which then

constitute a second wave of NF-κB activity [9]. This contrasts with TNFα or IL-1 induced NF-

κB signal transduction which occurs only through the canonical pathway.

Recent studies, also in MEF’s, by Basak et. al. [9] provide evidence for another level of

cross-talk between these two pathways mediated by p100 bound RelA/p50 dimers that are

responsive to developmental stimuli. In addition to confirming the previous findings that

activation of the non-canonical pathway first requires RelA activity, these studies showed that

de novo generated p100 can bind to both RelB and RelA/p50 subunits via its ARD domain,

similar to the activity of classical IκB’s [10]. This RelA/p50/p100 complex, when subjected to

LTβR signalling allows RelA/p50 to undergo nuclear translocation and activate gene expression

after degradation of p100 [9]. These cross-talk mechanisms between the two NF-κB signalling

pathways demonstrate that the NF-κB signalling response occurs due to integration of different

9

signals and is regulated at multiple levels to result in a coordinated temporal gene expression

profile [11]. This coordinated gene expression is required for generation of effective

inflammatory and developmental responses, deregulation of which can contribute to progression

of chronic inflammatory diseases such as atherosclerosis discussed in the next section.

10

1.3 NF-κB and atherosclerosis

Atherosclerosis is a chronic inflammatory disease characterized by lesion formation in

regions of the arterial tree exposed to disturbed blood flow. A major contributor to this

inflammatory process is the NF-κB transcription factor that controls the expression of several

genes (E-selectin, VCAM-1 and TNFα) that have been shown to play role in the pathogenesis of

atherosclerosis [12]. The extent of inflammation and atherosclerosis susceptibility has been

shown to be dependent on the level of expression of NF-κB target genes from both the cells of

the immune system (dendritic cells and macrophages) and endothelial cells [12]. Endothelial

cells, depending on their location in the vascular tree, are continuously exposed to different

patterns of blood flow which generates differential shear forces on these cells. These forces are

mechanically sensed by endothelial cells which results in the activation of many signal

transduction pathways including NF-κB signalling, by a process known as mechanotransduction

[13, 66]. It has been demonstrated that areas exposed to disturbed blood flow (low time

averaged shear stress) are more susceptible to atherosclerosis due to activation of low-level

endothelial NF-κB signalling [13, 14, 67]. It has also been shown that acute exposure of

cultured endothelial cells to low shear stress activates canonical NF-κB signalling and

upregulates pro-inflammatory gene expression [47, 65, 68]. Overall, this illustrates that a

disturbed flow pattern activates NF-κB signalling which determines the extent of inflammation

and susceptibility to atherosclerosis.

Previous studies from our laboratory [25] and Cuhlmann et. al. [15] have shown that

under normal conditions, there is relatively high cytoplasmic expression of NF-κB components,

p65, IκBα and IκBβ in endothelial cells at sites pre-disposed to atherosclerosis in murine aorta

(Figure-3).

11

CD31 (Green), VCAM-1 and CD68 (Red), Nuclear staining (Purple)

Figure-3: NF-κB expression, activity and pro-inflammatory gene expression is higher at

sites pre-disposed to atherosclerotic lesion formation in the normal mouse aorta

(A) Diagram of a mouse aorta depicting regions of high (HP) and low (LP) probability for

atherosclerosis (Adapted from Iiyama et.al. Circ. Res.(1999) 85:199-207). Also shown are

elevated p65 and IκBα levels in the HP versus the LP regions (Hajra et. al. PNAS (2000) 97:

9052-9057, © Copyright (2000) National Academy of Sciences, USA). (B) Higher VCAM-1

and CD68 (a myeloid cell marker) expression is observed in HP versus LP regions. Endothelial

cells are stained by CD31 (© Copyright Cuhlmann et. al. Circ. Res. (2011) 108: 950-959).

LP HP

(A)

(B)

High probability

for

atherosclerosis

(HP)

Low probability

for

atherosclerosis

(LP)

12

This correlates with higher VCAM-1 expression at these sites which is responsible for

the accumulation of CD11c-positive and CD68-positive resident intimal dendritic cells (RIDC)

into the sub-endothelial layer (the intima) [15, 26, 56].Under hypercholesterolemic conditions,

the RIDC engulf trapped oxidized lipid and transform into foam cells and produce pro-

inflammatory mediators which enhance endothelial NF-κB activation (p65 nuclear localization)

and target gene expression (adhesion molecules and chemokines) preferentially at

atherosclerosis-susceptible sites [16, 56]. This starts a cascade of events leading to increased

recruitment of leukocytes at these sites causing more inflammation and subsequent

atherosclerotic lesion formation.

In addition to atherosclerosis susceptibility, NF-κB signal transduction has also been

shown to determine the extent of atherosclerotic lesion formation. Studies showed that loss of

IKK2 in macrophages and NF-κB1 (p50) in hematopoietic cells of Low-Density Lipoprotein

receptor-deficient (LDLR-/-

) mice on a high cholesterol diet lead to an increase in atherogenesis

[58, 59]. In contrast, blockade of the canonical NF-κB pathway by expression of dominant

negative IκBα and deletion of NEMO in aortic endothelial cells of hypercholesterolemic

apoliporoteinE-deficient (ApoE-/-

) mice reduced atherosclerotic lesion formation as well as

expression of pro-inflammatory mediators like IL-6 and TNFα [57]. These studies demonstrate

that while NF-κB signalling serves an athero-protective function in macrophages and

haematopoietic cells, it is pro-atherogenic in endothelial cells. This is of importance in

designing therapeutic approaches that decrease atherosclerotic burden.

13

1.4 Rationale, goal of study and hypothesis

Rationale:

Previous studies from our laboratory showed that steady-state levels of p65 and other

NF-κB components, IκBα and IκBβ were upregulated in atherosclerosis-susceptible regions of

the normal mouse aorta relative to resistant regions. Upon induction of hypercholesterolemia or

LPS challenge, NF-κB activity and target gene expression were preferentially enhanced in the

atherosclerosis-susceptible regions suggesting that the steady-state level of NF-κB components

determines the strength of NF-κB signal transduction in response to pro-inflammatory and pro-

atherogenic stimuli [25]. In addition, a study showed that all members of the NF-κB/Rel family

except p65 have a consensus NF-κB sequence in their promoters suggesting that expression of

RelA/p65 is not under the control of NF-κB signalling [17]. Furthermore, it has been shown that

p65 can undergo nuclear translocation and activate target gene transcription independently of

the canonical NF-κB pathway [18, 19]. Overall, these observations lead me to question if p65 is

involved in regulating constitutive NF-κB gene expression independently of the canonical

pathway and how that can affect susceptibility to atherosclerosis.

Hypothesis:

p65 protein levels regulate the expression of other NF-κB/Rel and IκB family member

genes in unstimulated cells and can influence the magnitude of their expression induced by

TNFα. This constitutive p65-dependent gene expression is regulated independently of the

canonical NF-κB signaling pathway.

Goal:

To elucidate the mechanisms behind control of NF-κB homeostasis and assess its

implications on atherosclerosis susceptibility.

14

In order to test my hypothesis, I initially used HeLa cells, a commonly used cell line to

study NF-κB signal transduction and compared my findings with parallel experiments using

Human Umbilical Vein Endothelial Cells (HUVEC) which are widely used for studying

endothelial NF-κB signalling. I used a siRNA silencing approach to modulate p65 expression in

these cells and assessed its effect on NF-κB/Rel and IκB gene expression in both unstimulated

and TNFα-stimulated cells by quantitative real-time PCR (qRT-PCR). In addition, I assessed

any potential correlation between elevated levels of p65 in atherosclerosis-susceptible regions of

the normal mouse aorta and other NF-κB/Rel and IκB genes in vivo. To investigate the role of

the canonical NF-κB pathway in regulating constitutive p65-dependent NF-κB/Rel and IκB gene

transcription, I blocked the canonical NF-κB pathway by three approaches: 1) pharmacological

inhibition of IKKβ, 2) silencing IKKβ expression by siRNA and 3) expression of dominant

negative IκBα. I assessed the effect of inhibition of this pathway on both TNFα-induced (as a

positive control) and constitutive NF-κB/Rel and IκB gene transcription by qRT-PCR.

15

CHAPTER - 2: Determing the role of RelA (p65) in regulating NF-κB/Rel

and IκB gene expression in unstimulated and TNFα-stimulated cells

2.1 Specific Aims

1) To silence p65 expression by siRNA and assess its effect on the expression of other NF-

κB/Rel and IκB genes in unstimulated HeLa cells and HUVEC.

2) To determine if this steady-state modulation of p65 impacts NF-κB/Rel and IκB gene

expression in TNFα-stimulated HeLa cells and HUVEC.

16

2.2 Methods

2.2.1 Cell culture

Human cervical epithelial carcinoma cells (HeLa cells) were cultured in Dulbbeco’s

Modified Eagle’s Medium (DMEM, Sigma) containing 10% FBS (Gibco) and maintained in a

37ºC and 5% CO2 environment.

Human Umbilical Vein Endothelial Cells (HUVEC) were cultured in Endothelial Cell

Medium (ECM, ScienCell Research Laboratories) supplemented with 5% FBS, Endothelial Cell

Growth Supplement (ECGS) and Penicillin (10,000U/mL)-Streptomycin (10,000μg/mL) and

maintained under the same conditions as HeLa cells.

2.2.2 Transfection of HeLa cells and HUVEC with siRNA targeting p65

HeLa cells were grown on 6-well tissue culture plates (2 x 105 cells per well) in DMEM

containing 10% FBS to allow ~60% confluency at the time of transfection. A pre-designed and

validated siRNA targeting p65 or a non-targeting siRNA (Ambion) was diluted in serum-free

DMEM (800 nM in 100 μL) and mixed briefly. RNAiFECT transfection reagent (Qiagen) was

then added to the mixture (10 μL in 100 μL) and the contents were vortexed quickly and

incubated for 10 minutes to allow transfection complex formation. The transfection mixture was

added to cells with 0.9 mL fresh serum-free media (final siRNA concentration: 80 nM). Serum-

free DMEM was changed to DMEM with 10% FBS after 5 hours of transfection. 48 hours post-

transfection, cells were stimulated with 100 ng/mL of TNFα for 1 hour or left unstimulated and

then harvested to assess the expression of p65 and other NF-κB/Rel and IκB genes.

HUVEC were grown on 60 mm tissue culture dishes (3 x 105 cells per dish) in ECM

containing 5% serum to ensure ~60% confluency at the time of transfection. siRNA targeting

17

p65 or non-targeting siRNA (2 μM) and DharmaFECT1 transfection reagent (Dharmacon; 6 μL)

were diluted in 400 μL Opti-MEM1 (Invitrogen) media in separate tubes and incubated for 5

minutes. Diluted siRNA and DharmaFECT1 were then mixed and incubated for 20 minutes to

enable complex formation. 3.2 mL of Opti-MEM1 was then added to the transfection complex

(final siRNA concentration: 100 nM) and the mixture was added to the cells after aspirating the

growth medium. Media was changed back to ECM with serum 4 hours post-transfection.

HUVEC were stimulated with TNFα (100 ng/mL, 2 hours) 48 hours post-transfection or left

unstimulated and then harvested to analyze the expression of p65 and other NF-κB/Rel and IκB

genes.

2.2.3 RNA extraction, cDNA synthesis and Quantitative Real-Time PCR (qRT-PCR):

Total RNA was isolated from both HeLa cells and HUVEC by using the RNeasy mini

plus kit (Qiagen) as per the manufacturer’s instructions. cDNA was synthesized (using random

primers) by the high capacity reverse-transcription kit (Applied Biosystems) according to the

manufacturer’s protocol. A single reverse-transcription reaction contained 0.5 – 1 μg of total

RNA. Reactions containing no reverse transcriptase served as a control for DNA contamination

in qRT-PCR.

Quantitative Real-Time PCR (qRT-PCR) was performed using the LightCycler480

system with SYBR green detection chemistry. Primers were designed to amplify intron/exon-

intron regions for hnRNA (pre-mRNA) and spanned exon boundaries for mRNA detection. PCR

reactions containing no cDNA (H2O control) served as an additional control for DNA

contamination. hnRNA and mRNA expression was normalized to the housekeeping gene

hypoxanthine phosphoribosyl transferase (HPRT).

18

2.2.4 SDS-PAGE and Western Blotting:

HeLa cells or HUVEC were washed twice with cold PBS (Sigma) and whole cell lysates

were prepared using 150-200 µL ice cold RIPA buffer (25 mM Tris-Cl pH 7.6, 150mM NaCl,

1% NP-40, 1% sodium deoxycholate, 0.1% SDS) supplemented with 1mM each of sodium

orthovanadate, sodium fluoride and PMSF and a tablet of protease inhibitor cocktail (Roche).

Lysates were incubated on ice for 10 minutes and then centrifuged to pellet the insoluble

cytoskeleton (12000g, 10 minutes, 4ºC). To isolate protein and RNA from the same batch of

cells, cells were detached with Trypsin (Gibco) and washed with cold PBS. Cells were split into

separate tubes and used for RNA extraction or protein isolation. Protein concentration in RIPA

buffer lysates was measured by the Lowry method using Bovine Serum Albumin as a standard.

Samples were then boiled in Laemmli Buffer for 5 minutes and homogenized using a 25-gauge

needle. Total protein (20-40 µg) was fractionated by SDS-PAGE (8-10%) and transferred to a

PVDF membrane (22V, overnight at 4ºC). The membrane was then incubated for 1 hour in

blocking buffer (5% non-fat dry milk or BSA in Tris-buffered saline (TBS) containing 0.1%

Tween20, pH 7.6) and immunoblotted with primary antibodies to p65, RelB, p100, IκBα, IκBβ,

IKKβ and actin followed by horseradish-peroxidase (HRP) conjugated secondary antibodies.

Bound antibodies were detected using the Enhanced Chemiluminescence Plus kit (GE

healthcare) according to the manufacturer’s instructions. Densitometry was performed using

ImageJ software to quantify protein expression normalized to actin.

2.2.5 Statistics:

Statistically significant differences between two groups were assessed using a Student’s

t-test. A one-way ANOVA followed by Bonferroni’s post-test was used to assess significant

differences between multiple groups.

19

Table-1 - Primers for human NF-κB/Rel and IκB genes (mRNA)

Gene Sequence (5’- 3’)

RelA F CAACCCCTTCCAAGTTCCTATAGA

R CCTGCCTGATGGGTCCC

RelB F CCCCGACCTCTCCTCACTCT

R CTCGTCGATGATCTCCAATTCA

cRel F CTGTGCCAGGATCACGTAGAAA

R GTGGGTGGATCACCTGATGTC

p105 F AGAGTGCTGGAGTTCAGGATAACCC

R TCACCGCGTAGTCGAAAAGG

p100 F AAGGACATGACTGCCCAATTTAA

R ATCATAGTCCCCATCATGTTCTTCTTC

IκBα F CCAACCAGCCAGAAATTGCT

R TGTGGCCTGGAAGAACAAAAG

IκBβ

F TGTCGCCTTGTACCCCGAT

R TGGCCCTCGTAGTTTTCAGC

IκBε F ACTCATGGAATTGCTGCTTCG

R TCTTGGGTTTCCACAGCCAG

HPRT F CAAGCTTGCCTGGTGAAAAGGA

R TGAAGTACTCATTATAGTCAAGGGCATATC

F – Forward primer, R – Reverse primer

20

Table-2 – Primers for human NF-κB/Rel and IκB genes (hnRNA)

F – Forward primer, R – Reverse primer

Gene Sequence (5’-3’)

RelA F GGTTCACGTGGCTAGTAAGTAGCAG

R GGGCTGTATGGTAGTGACAAGACA

RelB F CCCTCCAGGCCCAACTTTAA

R AGGTCCTGGCCTTTAGTTTCTGT

cRel F CCACGCTCTGTAATTCGATCCT

R TTCGCTTATGACTTCCCTAATCCT

p105 F TCAGGGATTGCTCATTGTGGTA

R AGGTCTTGCTGATGGAATGATAGTC

p100 F GGTCACAGCTGCAGGTTGAG

R CCCACTGTCCACCAGCAGAT

IκBα F TCTGACCCTGGGACGTAGCT

R TAAAGACCTCACCAAATCAGTGGAA

IκBβ F GCAGGAAAATGAGGCAATAGATAAAC

R GGGCATACAGCAGTAAACACAACA

IκBε F GCAGGTGCTCTTGTTTTACCC

R AGCAATAAGATGGGACACCTTCTC

HPRT F GACCGATGCCCCAGGATAT

R GGAGCTAAGATACCAGAGGCTGAT

21

Table-3 - Antibodies

Antibody Source

RelA/p65 Goat (polyclonal, C-20, Santa Cruz, sc-372)

RelB Rabbit (monoclonal, C1E4, Cell Signalling, #4922)

p100/NF-κB2 Rabbit (polyclonal, Cell Signalling, #4882)

IκBα Mouse (monoclonal, 112B2, Cell Signalling, #9247)

IκBβ Rabbit (polyclonal, C-20, Santa Cruz, sc-945)

IKKβ Rabbit (monoclonal, 2C8, Cell Signalling, #2370)

actin Rabbit (monoclonal, Sigma, A 2066)

22

2.3 Results

2.3.1 Suppression of p65 expression by short interfering RNA (siRNA) in HeLa cells and

HUVEC

Short interfering RNA’s (siRNA’s) are double-stranded RNA molecules that have been

widely used as a tool to silence gene expression in a sequence-specific manner. siRNA’s

specifically bind to and destabilize mRNA sequences of target genes thereby inhibiting gene

expression post-transcriptionally [20]. p65 expression was silenced in HeLa cells and HUVEC

by using this RNA interference (RNAi) approach and the extent of silencing was assessed by

measuring p65 mRNA and protein expression. In addition, transcription of p65, which should

remain unaffected after siRNA silencing, was also measured to test the specificity of this

approach. This was done by measuring expression of heterogeneous nuclear RNA (hnRNA – a

precursor of mRNA), a short-lived unspliced transcript which has been shown to be a surrogate

marker of transcription [21, 22]. Cells were transfected with siRNA targeting p65 or non-

targeting siRNA (scrambled siRNA) and p65 hnRNA and mRNA expression was measured by

qRT-PCR and protein expression by western blotting, 48 hours post-transfection. Preliminary

experiments assessed p65 suppression by siRNA at 24, 48 and 72 hours. At 24 hours, only p65

mRNA levels were minimally reduced in contrast to significant suppression of p65 mRNA and

protein levels at 48 hours (~70% - HeLa cells, ~90% - HUVEC, Figure-4, Panels B, C and E, F).

At 72 hours, p65 mRNA and protein expression in p65 siRNA transfected cells recovered close

to the expression level in control siRNA transfected cells. No change was observed in p65

hnRNA expression at 48 hours post-transfection of siRNA (Figure-4, Panels A and D), showing

that the siRNA silenced p65 expression without affecting its transcription, as expected.

23

Figure-4: Suppression of p65 mRNA and protein expression in HeLa cells and HUVEC.

HeLa cells (I) or HUVEC (II) were transfected with siRNA against p65 (p65 siRNA) or

scrambled siRNA (sc siRNA). 48 hours post-transfection, p65 hnRNA (A, D), mRNA (B, E)

and protein (C, F) levels were assessed by qRT-PCR and Western blotting respectively.

Expression was normalized to HPRT (hnRNA and mRNA) and actin (Protein). Values are

represented as Mean ± SEM relative to the scrambled siRNA control (Panel A, B and C n=4, *

p<0.05; Panel D and E, n=6, *** p<0.001; Panel F, n=3, ** p<0.01).

0.0

0.2

0.4

0.6

0.8

1.0

1.2

p65

Rela

tive h

nR

NA

expre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0

1.2

*

sc siRNA

p65 siRNA

p65

Rela

tive m

RN

A e

xpre

ssio

n

0.0

0.5

1.0

1.5

*

p65

Rela

tive p

rote

in e

xpre

ssio

n

0.0

0.5

1.0

1.5

p65

Rela

tive h

nR

NA

expre

ssio

n

(I) HeLa cells

(II) HUVEC

0.0

0.2

0.4

0.6

0.8

1.0

1.2

** *

sc siRNA

p65 siRNA

p65

Rela

tive m

RN

A e

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0

1.2

**

p65

Rela

tive p

rote

in e

xpre

ssio

n

(A) (B)

(C)

(D) (E)

(F)

24

Based on the results of this time course, the 48 hour time point was chosen to assess the

effect of p65 suppression on other NF-κB/Rel and IκB genes. The robust suppression of p65

expression in HUVEC compared to HeLa cells could possibly be due to the efficiency of the

DharmaFECT1 transfection reagent that was used (see methods section 2.2.2). This reagent has

been shown to result in superior gene silencing compared to other lipid-based transfection

reagents [23]. Overall, these results demonstrated that the RNAi approach to silence p65

expression was efficient and specific.

25

2.3.2 p65 positively regulates the expression of specific NF-κB/Rel and IκB genes in

unstimulated HeLa cells and HUVEC

Regulation of NF-κB activation and target gene expression in response to different pro-

inflammatory stimuli has been studied extensively. However, the mechanisms behind the

regulation of NF-κB homeostasis, including the regulation of steady-state NF-κB/Rel and IκB

gene expression, have not been investigated in detail. In order to investigate whether changes in

p65 levels affect steady-state NF-κB/Rel and IκB target gene expression, p65 expression was

silenced by siRNA and its effect on the expression of other NF-κB/Rel (RelB, cRel, p105, p100)

and IκB (IκBα) family member genes was measured in unstimulated HeLa cells. The effect of

p65 suppression on the hnRNA and mRNA levels of other NF-κB/Rel and IκB genes was

assessed by qRT-PCR to determine their rate of transcription and message production

respectively. The efficiency of primers amplifying both hnRNA and mRNA of NF-κB/Rel and

IκB genes was comparable as determined by standard curve analysis which demonstrated

comparable qPCR rates between the target genes. As a result, crossing point (Cp) values (which

define the threshold of signal above noise) were used to estimate the relative expression levels

of these genes. Based on these measurements, the relative expression levels of p65, p105, p100

and IκBα were comparable with each other except RelB which was ~16 fold lower. cRel

expression was the lowest amongst all the NF-κB/Rel members.

In unstimulated HeLa cells, silencing p65 expression significantly reduced hnRNA and

mRNA levels of only a subset of NF-κB/Rel and IκB genes namely, RelB, p100, IκBα (Figure-

5, Panel A and B) suggesting that p65 positively regulates the transcription of these particular

genes. However, mRNA levels of one gene, cRel, were upregulated after p65 silencing.

26

Figure-5: Effect of p65 suppression on NF-κB/Rel and IκBα transcription and mRNA

expression in unstimulated HeLa cells. HeLa cells were transfected with siRNA targeting p65

or scrambled siRNA and hnRNA (A) and mRNA (B) levels of NF-κB/Rel genes and IκBα were

assessed 48 hours post-transfection by qRT-PCR. Expression was normalized to HPRT. Values

are represented as Mean ± SEM relative to the scrambled siRNA control set as 1 (n=4, *

p<0.05).

RelB cRel p105 p100 IB0.0

0.2

0.4

0.6

0.8

1.0

1.2

*

p65 siRNA

sc siRNA

* *R

ela

tive h

nR

NA

exp

ressio

n

RelB cRel p105 p100 IB 0.0

0.5

1.0

1.5

2.0

2.5

** *

sc siRNA

p65 siRNA

Rela

tive m

RN

A e

xp

ressio

n

(B)

(A)

27

This may be due to a compensatory effect caused by the suppression of p65 steady-state

levels, resulting in increased mRNA stability of cRel [36]. Collectively, these results indicate

that modulation of p65 expression influences the constitutive transcription of only certain NF-

κB/Rel and IκB genes in HeLa cells.

In order to investigate whether changes in p65 levels affect endothelial NF-κB

homeostasis and particularly the same set of genes studied in HeLa cells, p65 expression was

suppressed in HUVEC and expression of other NF-κB/Rel and IκB genes was measured by

qRT-PCR and Western blotting respectively. Similar to HeLa cells, the relative expression

levels of p65, p105, p100 and IκBα were comparable except RelB which was ~8 fold lower

(based on Cp value measurements). cRel expression was the lowest amongst all other NF-

κB/Rel members.

Silencing p65 significantly reduced the protein expression of RelB, p100 and IκBα

(Figure-6, Panel C) but strikingly, in contrast to HeLa cells, silencing p65 expression had no

effect on the constitutive hnRNA levels of other NF-κB/Rel and IκB members (Figure-6, Panel

A), but resulted in significantly reduced RelB, p105 and p100 mRNA levels (Figure-6, Panel

B) in HUVEC. These results suggested that in unstimulated HUVEC, p65 does not regulate the

transcription of RelB, p105, p100 and IκBα genes but may have an effect post-transcriptionally,

by regulating the mRNA or protein stability of these genes. Also, the observation that IκBβ

protein levels in HUVEC and cRel mRNA levels in HeLa cells get upregulated after p65

suppression (Figure-5, Panel B and Figure-6, Panel C) suggests the existence of compensatory

mechanism(s) that can play a role in regulating NF-κB homeostasis.

28

Figure-6: Effect of p65 suppression on NF-κB/Rel and IκB hnRNA, mRNA and protein

expression in unstimulated HUVEC. HUVEC were transfected with siRNA targeting p65 or

scrambled siRNA and hnRNA (A), mRNA (B) and protein (C) levels of NF-κB/Rel and IκB

genes were assessed 48 hours post-transfection by qRT-PCR and Western Blotting respectively.

Expression was normalized to HPRT (hnRNA and mRNA) and actin (Protein). Values are

represented as Mean ± SEM relative to the scrambled siRNA control set as 1 (Panel A and B,

n=6, * p<0.05; Panel C, n=3, * p<0.05, ** p<0.01).

RelB cRel p105 p100 IB IB IB0.0

0.5

1.0

1.5

sc siRNA

p65 siRNAR

ela

tive h

nR

NA

exp

ressio

n

RelB cRel p105 p100 IB IB IB0.0

0.5

1.0

1.5

2.0

sc siRNA

p65 siRNA

** *

Rela

tive m

RN

A e

xp

ressio

n

p65 RelB p100 IB IB0.0

0.5

1.0

1.5

2.0

2.5

p65 siRNA

sc siRNA

* **

**Rela

tive p

rote

in e

xp

ressio

n

(A)

(B)

(C)

29

2.3.3 p65 levels determine the magnitude of NF-κB/Rel and IκB gene expression in TNFα-

stimulated HeLa cells and HUVEC

Pro-inflammatory stimuli such as TNFα induce the expression of numerous NF-κB

target genes that act as positive and negative regulators of inflammation [24]. In order to keep a

strict control over the levels of the inflammatory response, several feedback regulatory

mechanisms are involved in setting the magnitude of NF-κB activation and gene expression

such as termination of NF-κB signalling by IκB (see Introduction). To investigate the role of

p65 as a potential regulator of TNFα-induced expression levels of other NF-κB/Rel and IκB

genes, p65 expression was silenced in HeLa cells and HUVEC by siRNA and its effect on

TNFα-induced hnRNA and mRNA expression of other NF-κB/Rel and IκB genes was assessed.

As shown in Figure-7 and 8, all NF-κB/Rel and IκB genes except p65 were induced by

TNFα as predicted. In addition, suppression of p65 significantly reduced hnRNA and mRNA

levels of all NF-κB/Rel genes, except cRel mRNA, in TNFα-stimulated HeLa cells and HUVEC

(Figure-7 and 8). The lack of upregulation of p65 hnRNA and mRNA after TNFα stimulation

was as expected [17]. TNFα-stimulated IκBα hnRNA and mRNA expression was also

significantly downregulated in HeLa cells (Figure-7) and HUVEC (Figure-8). Overall, these

results suggest that steady-state p65 levels play a role in regulating the TNFα-induced

expression levels of its own family member genes and inhibitors.

30

Figure-7: Effect of p65 suppression on NF-κB/Rel and IκBα transcription and mRNA

expression in TNFα-stimulated HeLa cells. HeLa cells transfected with siRNA against p65 or

scrambled siRNA were stimulated with 100 ng/mL of TNFα (1 hour) 48 hours post-transfection.

hnRNA (A) and mRNA (B) levels of NF-κB/Rel genes and IκBα were assessed by qRT-PCR.

Expression was normalized to HPRT. Values are represented as Mean ± SEM relative to the

scrambled siRNA control set to 1 (n=4, * p<0.05, ** p<0.01, *** p<0.001).

p65 RelB cRel p105 p100 IB 0

5

10

15

*** *****

***** **

**

***

***

sc siRNA

sc siRNA + TNF

p65 siRNA + TNF

*Re

lati

ve

mR

NA

ex

pre

ss

ion

p65 RelB cRel p105 p100 IB 0

2

4

6

8

10

12 sc siRNA

sc siRNA + TNF

p65 siRNA + TNF

***

***

*** **

*

******

**

*****

Re

lati

ve

hn

RN

A e

xp

res

sio

n

(A)

(B)

31

Figure-8: Effect of p65 suppression on NF-κB/Rel and IκBα hnRNA and mRNA

expression in TNFα-stimulated HUVEC. HUVEC transfected with siRNA against p65 or

scrambled siRNA were stimulated with 100 ng/mL of TNFα (2 hours) 48 hours post-

transfection. hnRNA (A) and mRNA (B) levels of NF-κB/Rel and IκB genes were assessed by

qRT-PCR. Expression was normalized to HPRT. Values are represented as Mean ± SEM

relative to the scrambled siRNA control set to 1 (n=5, * p<0.05, ** p<0.01, *** p<0.001).

(A)

(B)

p65 RelB cRel p105 p100 IB IB IB0

1

2

3

4

5

6

7

8

9

10

sc siRNA

sc siRNA + TNF

p65 siRNA + TNF** * ** *

*** *

*

* **** ** *

*

*****

Rela

tive m

RN

A e

xp

ressio

n

p65 RelB cRel p105 p100 IB IB IB

0

5

10

15

sc siRNA

sc siRNA + TNF

p65 siRNA + TNF

** * ** *** * ** *

*** ***** * ** *

* ** *

Rela

tive h

nR

NA

exp

ressio

n

32

CHAPTER-3: Determining the role of the canonical NF-κB signalling

pathway in regulating constitutive NF-κB (p65)-dependent transcription in

unstimulated HeLa cells

3.1 Specific Aims

1) To validate the blockade of the canonical NF-κB pathway by assessing the extent of

inhibition of TNFα-induced NF-κB/Rel and IκB target gene transcription.

2) To assess the effect of blockade of the canonical NF-κB pathway on constitutive transcription

of NF-κB/Rel and IκB genes that is dependent on p65 in the steady-state.

3.1.1 Rationale

The results described in Chapter-2 showed that p65 can influence the steady-state

expression of certain NF-κB/Rel and IκB genes as well as the TNFα-induced expression of these

genes. However, the p65 siRNA studies performed in HeLa cells and HUVEC did not fully

address the mechanism(s) behind regulation of steady-state p65-dependent NF-κB/Rel and IκB

gene expression. It is well established that the canonical NF-κB pathway drives TNFα-induced

NF-κB activation and target gene expression, but little is known about the role of this pathway

in regulating constitutive p65-dependent target gene expression. Previous studies have shown

that p65 can undergo nuclear translocation and regulate gene transcription independently of the

canonical pathway in Jurkat cells and HEK-293 cells [18, 19]. Thus, we hypothesized that p65

regulates the steady-state transcription of other NF-κB/Rel and IκB genes independently of the

canonical pathway. As reduction in p65 levels correlated with a significant decrease in the

transcription of RelB, p100 and IκBα in unstimulated HeLa cells, but not in unstimulated

HUVEC, the role of the canonical NF-κB pathway in regulating the constitutive transcription of

33

these genes was investigated only in HeLa cells. Three experimental approaches were adopted:

1) pharmacological inhibition, 2) silencing IKKβ expression by siRNA and 3) inhibiting IκBα

phosphorylation and degradation by expression of dnIκBα. These approaches are outlined in

sections 3.3.1, 3.3.2 and 3.3.3 respectively.

34

3.2 Methods

3.2.1 Cell culture

HeLa cells were maintained in DMEM supplemented with 10% FBS. For details refer to section

2.2.1.

3.2.2 Pharmacological blockade of IKKβ activity in HeLa cells

HeLa cells were grown in 12-well tissue culture treated plates (2 x 105 cells per well) in

DMEM supplemented with 10% FBS. A specific IKKβ inhibitor (Parthenolide) or DMSO alone

was diluted in DMEM with serum (100 μM and 0.1%, respectively) and added to a confluent

monolayer of cells at a final concentration of 30-60 μM (0.03%-0.06% DMSO control).

Unstimulated HeLa cells were incubated with the inhibitor or vehicle for 2 or 4 hours. As a

positive control, cells were pre-incubated with the inhibitor for 1 hour prior to stimulation with

TNFα (100 ng/mL) for an additional hour. Cells were then harvested to assess transcription of

IκBα, a well established NF-κB target gene.

3.2.3 Transfection of HeLa cells with siRNA targeting IKKβ

HeLa cells were grown on 6-well tissue culture treated plates (2 x 105 cells per well) in

DMEM containing 10% FBS to allow ~60% confluency at the time of transfection. Cells were

transfected with a pre-designed and validated siRNA pool targeting IKKβ (Dharmacon) or a

non-targeting siRNA (Ambion) according to the protocol mentioned in section 2.2.2 for

HUVEC siRNA transfection.

35

3.2.4 Sub-cloning of FLAG-tagged dominant-negative IκBα (dnIκBα) in the pcDNA1

vector

A FLAG-tagged dnIκBα construct under the control of the ICAM2 promoter previously

cloned into a pUC19 plasmid was subjected to restriction enzyme digestion (HindIII and XbaI,

New England Biolabs) to delete the ICAM2 promoter element. In parallel, a pcDNA1 plasmid

was also digested by the same restriction enzymes and both the FLAG-dnIκBα insert and

pcDNA1 vector were purified by gel electrophoresis and subsequently extracted using the

QIAquick gel extraction kit (Qiagen) according to the manufacturer’s instructions. Purified

insert and vector constructs were ligated using the Rapid DNA ligation kit (Roche Applied

Science) as per the manufacturer’s protocol and transformed into MC1061/P3 Ultracomp E.coli

(Invitrogen). The resulting FLAG-dnIκBα plasmid was extracted from bacterial colonies using

the GenElute Plasmid MiniPrep kit (Sigma) and digested with HindIII and XbaI to verify the

results of sub-cloning. The plasmid was then sequenced to ensure that sub-cloning occurred in

frame and further purified by the EndoFree Plasmid Maxi kit (Qiagen) to remove endotoxin

contamination and increase the yield.

3.2.5 Transfection of HeLa cells with dominant negative IκBα (dnIκBα)

HeLa cells were grown on 6-well tissue culture treated plates (3 x 105 cells per well) in

DMEM with serum to attain ~80% confluency at the time of transfection. FLAG-tagged dnIκBα

or vector alone was diluted in Opti-MEM1 media (4 μg in 250 μL). Lipofectamine 2000

transfection reagent (Invitrogen) was diluted in Opti-MEM1 (10 μL in 250 μL) separately and

the tubes were allowed to incubate for 5 minutes after vortexing. The plasmid DNA was then

mixed with Lipofectamine 2000 and the contents were allowed to incubate for 20 minutes. The

transfection mixture was added to the cells in 1.5 mL of Opti-MEM1and allowed to incubate for

36

5 hours before replacing the media with DMEM containing 10% FBS. Cells were stimulated

with TNFα (100 ng/mL, 1 hour) or left unstimulated 24 hours post-transfection and harvested to

assess expression of dnIκBα and transcription of selected NF-κB/Rel and IκB genes by Western

blotting and qRT-PCR, respectively.

37

3.3 Results

3.3.1 Pharmacological inhibition of IKKβ significantly reduces TNFα-induced IκBα

transcription but has no effect on constitutive IκBα transcription in HeLa cells

A key step in canonical NF-κB signalling is the activation of IKKβ which in turn

phosphorylates IκB resulting in its ubiquitination and proteasomal degradation, allowing nuclear

translocation of NF-κB. Inhibiting IKKβ activity pharmacologically or expressing dominant

negative mutants of IKKβ and IκBα has been shown to effectively block canonical NF-κB

signalling in LPS or TNFα-stimulated cells [23, 27-29]. However, the role of the canonical NF-

κB pathway in regulating steady-state NF-κB-dependent transcription in unstimulated cells has

not been investigated. As a first approach, IKKβ activity was blocked in HeLa cells by

pharmacological inhibition using a specific IKKβ inhibitor, Parthenolide. This inhibitor has

been demonstrated to bind specifically to IKKβ and block phosphorylation of its catalytic site

by upstream kinases thereby inhibiting NF-κB nuclear translocation and DNA binding [30].

Before assessing the effect of Parthenolide on constitutive p65-dependent target gene

transcription, the efficiency of this inhibitor in suppressing the TNFα-induced transcription of

IκBα (a well known p65 target gene) was determined as a positive control. HeLa cells were pre-

incubated with established doses of Parthenolide [30] for 1 hour followed by 1 hour of TNFα

stimulation, after which IκBα hnRNA levels were measured by qRT-PCR. Parthenolide

significantly reduced TNFα-induced IκBα transcription at both doses (Figure-9, Panel A)

indicating that indeed, this inhibitor potently blocked the canonical NF-κB pathway.

38

Figure-9: Effect of pharmacological inhibition of the canonical NF-κB pathway on TNFα-

induced and steady-state IκBα transcription in HeLa cells. HeLa cells were pre-incubated

with Parthenolide, an IKKβ inhibitor or DMSO (Vehicle, Parthenolide = 0 μM) for the indicated

times and stimulated with 100 ng/mL of TNFα in the presence of the inhibitor for an additional

1 hour (A) or left unstimulated (B). IκBα hnRNA levels were assessed by qRT-PCR and

normalized to HPRT. Values are represented as Mean ± SEM relative to the DMSO control set

to1 (n=3, ** p<0.01).

0

1

2

3

4

5

6

7

** **

Rela

tive

I

B

hn

RN

A e

xp

ressio

n

0.0

0.5

1.0

1.5

2.0

Rela

tive I

B

hn

RN

A e

xp

ressio

n

(A)

(B)

- + + + TNFα – 1 hour

0 0 30 60 Parthenolide (μM) – 1 hour

0 30 60 0 30 60 Parthenolide (μM)

2 hours 4 hours

39

After observing robust inhibition of TNFα-induced IκBα transcription by Parthenolide,

steady-state IκBα hnRNA levels were measured by qRT-PCR in unstimulated HeLa cells

incubated with Parthenolide (30, 60 μM) for 2 or 4 hours. This time course experiment was

performed to test whether any low level canonical NF-κB signalling can account for regulating

the steady-state p65-dependent NF-κB and IκB gene transcription over a relatively short period

of time. Longer incubation times with this inhibitor could not be performed due to the

cytotoxicity observed. In contrast to the significant reduction of TNFα-induced IκBα

transcription after pharmacological blockade by Parthenolide, steady-state IκBα hnRNA levels

remained unchanged (Figure 9, Panel B). This suggested that the constitutive p65-dependent

transcription of IκBα is regulated independently of the canonical pathway.

40

3.3.2 Suppression of IKKβ by siRNA does not sufficiently inhibit the canonical pathway

induced by TNFα

Pharmacological blockade of IKKβ in HeLa cells by Parthenolide suggested that steady-

state IκBα transcription can be regulated independently of the canonical NF-κB pathway over a

short time period. The steady-state kinetics of the canonical NF-κB pathway (like turnover of

IκB’s) may occur over longer periods of time (24 hours or more) which might require prolonged

blockade of this pathway to assess effects on p65-dependent transcription. However, this was

not possible with the pharmacological inhibition approach due to cytotoxic and potential off-

target effects of Parthenolide. Therefore, a second approach was adopted. IKKβ expression was

suppressed by siRNA in HeLa cells and results in Figure-10, Panel A, showed that IKKβ mRNA

and protein expression, but not hnRNA, were markedly reduced (~70%).

To first test the efficiency of IKKβ silencing in blocking the canonical NF-κB pathway,

inhibition of TNFα-induced transcription of selected target genes, RelB, p100 and IκBα (genes

shown to be transcriptionally regulated by p65 in the steady-state), was assessed by qRT-PCR.

TNFα-induced transcription of RelB, p100 and IκBα was minimally reduced after IKKβ

suppression in HeLa cells (Figure-10, Panel B). This suggests that residual IKKβ activity

(~30%) could be sufficient for driving TNFα-induced NF-κB-dependent transcription since

complete suppression of IKKβ expression has previously been shown to block canonical NF-κB

signalling in TNFα-stimulated HeLa cells and MEF’s [31]. Alternatively, it could be possible

that IKKα (a component of the putative IKK complex containing NEMO and IKKβ, see section

1.2) compensates for the lack of IKKβ activity, however, the role of IKKα activation as part of

the canonical IKK complex in response to TNFα stimulation is still controversial [5, 32, 33].

41

Figure-10: Silencing of IKKβ and its effect on TNFα-induced transcription of RelB, p100

and IκBα in HeLa cells. HeLa cells were transfected with siRNA targeting IKKβ or scrambled

siRNA and stimulated with 100 ng/mL TNFα (B) or left unstimulated (A). hnRNA, mRNA and

protein levels of IKKβ (A) were assessed by qRT-PCR 48 hours post-transfection and Western

blotting 72 hours post-transfection respectively. hnRNA levels of RelB, p100 and IκBα (B) were

assessed by qRT-PCR 72 hours post-transfection. Values are represented as Mean ± SEM

relative to the scrambled siRNA control set to l (n=2).

IKK mRNA IKK hnRNA

0.0

0.5

1.0

1.5sc siRNA

IKK siRNA

Rela

tive e

xp

ressio

n

0.0

0.5

1.0

1.5 sc siRNA

IKK siRNA

IKKR

ela

tive p

rote

in e

xp

ressio

n

RelB p100 IB

0

5

10

15

sc siRNA

sc siRNA + TNF

IKK siRNA + TNF

Rela

tive h

nR

NA

exp

ressio

n

(A)

(B)

42

Since IKKβ suppression did not result in significant reduction of TNFα-stimulated p65-

dependent target gene transcription as was expected, constitutive transcription of p65 target

genes was not assessed by this approach.

43

3.3.3 Expression of dnIκBα significantly reduces TNFα–induced and constitutive

transcription of RelB, p100 and IκBα in HeLa cells

Targeting the canonical NF-κB pathway by means of pharmacological inhibition and

RNAi had potential limitations like cytotoxicity and lack of inhibition of TNF-induced target

gene transcription as mentioned in sections 4.3.1 and 4.3.2, respectively. To overcome these

limitations, the canonical NF-κB pathway was targeted by overexpressing a dominant-negative

mutant of IκBα (dnIκBα). DnIκBα cannot be phosphorylated by IKKβ at serine residues S32

and S36 because they have been mutated to alanine and thus this form of IκBα is not be targeted

for degradation. This results in the inhibition of NF-κB nuclear translocation and target gene

expression. Previously, this approach has been shown to completely block TNFα-induced

canonical NF-κB signalling [29]. HeLa cells were transfected with a FLAG-tagged dnIκBα

vector and its expression was assessed by two methods 24 hours post-transfection, 1) qRT-PCR,

which was used to detect and quantify mRNA expression of this construct by using primers

binding to the region joining the FLAG sequence and N-terminal region of dnIκBα and 2)

Western blotting to assess protein levels of dnIκBα by an antibody specific for IκBα.

Expression of dnIκBα assessed by qRT-PCR showed specific and high amplification (Cp value ~

10) of FLAG-tagged dnIκBα mRNA compared to cells transfected with vector alone where it

was virtually undetectable (Figure 11, Panels A and B).

44

Figure-11: Detection of FLAG-tagged dnIκBα mRNA in HeLa cells by qRT-PCR.

HeLa cells were transfected with dnIκBα or empty vector and were harvested 24 hours post-

transfection to assess mRNA expression of dnIκBα by primers targeting a specific region

spanning the FLAG and the N-terninal IκBα sequences. Representative amplification curves (A)

and dissociation curves (B) of 4 independent experiments demonstrate specific amplification of

dnIκBα versus vector alone.

(A)

(B)

Amplification Plots

Dissociation Curves

45

As was done previously (sections 4.3.1 and 4.3.2), initial experiments evaluated the

efficacy of this approach to inhibit TNFα-induced degradation of of IκBα and TNFα-induced

transcription of RelB, p100 and IκBα. This was assessed by Western blotting and qRT-PCR,

respectively, 24 hours post-transfection (Figure-12, Panel A and B). Measurement of p65

transcription served as a negative control, as it is known that transcription of p65 is not under

the control of the canonical NF-κB pathway (shown by results in section 2.3.3).

Protein expression of dnIκBα was >10 fold higher compared to endogenous IκBα

(Figure 13, Panel A, compare lanes 1, 3 and 4). This level of dnIκBα expression blocked

canonical NF-κB signalling as TNFα-induced IκBα degradation (Figure-12, Panel A) and target

gene expression (Figure-12, Panel B) were robustly inhibited. Having observed efficient

blockade of TNFα-induced canonical NF-κB signalling by dnIκBα, hnRNA levels of RelB,

p100 and IκBα were assessed in unstimulated HeLa cells. The transcription of these genes was

found to be significantly reduced (Figure 12, Panel C). This suggested that the canonical NF-κB

pathway is involved in regulating constitutive p65-dependent target gene transcription in

unstimulated HeLa cells. These results contradicted the outcome of experiments using the

pharmacological inhibitor approach. This demonstrates that low-level canonical NF-κB

signalling is active in unstimulated HeLa cells, and responsible for driving the constitutive

transcription of p65-dependent target genes.

46

Figure-12: Blockade of canonical NF-κB signalling by dnIκBα expression in HeLa cells.

HeLa cells were transfected with dnIκBα or empty vector and were treated with 100 ng/mL of

TNFα for 15 minutes (A) or 1 hour (B) or left untreated (C) 24 hours post-transfection. Protein

levels of dnIκBα (A) and hnRNA levels of p65, RelB, p100 and IκBα (B and C) were assessed

by Western Blotting and qRT-PCR respectively. Expression was normalized to actin (protein)

and HPRT (hnRNA). Values are represented as Mean ± SEM relative to the values of empty

vector set to 1 (Panel A, representative blot of 3 independent experiments; Panels B and C, n=4,

* p<0.05, ** p<0.01).

1 2 3 4 TNFα - + - + (15 mins)

p65 RelB p100 IB0

2

4

6

8

10

12

14

empty vector

empty vector + TNF

dnIB + TNF

*

*

**

*

***

Rela

tive h

nR

NA

exp

ressio

n

p65 RelB p100 IB0.0

0.5

1.0

1.5

2.0empty vector

dnIB

**

*

Rela

tive h

nR

NA

exp

ressio

n

(A) (B)

(C)

47

CHAPTER - 4: Investigation of correlations between elevated levels of RelA

(p65) and other NF-κB/Rel and IκB genes in the endothelium of

atherosclerosis-susceptible regions of the normal mouse aorta

4.1 Specific Aims

1) To determine NF-κB/Rel and IκB gene expression by qRT-PCR in the regions of the mouse

aortic endothelium prone to atherosclerotic lesion formation (HP regions) relative to regions

resistant to lesion formation (LP regions).

4.1.1 Rationale

Previous observations in our laboratory showed that both p65 mRNA and protein

expression was upregulated in regions prone to atherosclerotic lesion formation relative to the

resistant areas in the normal mouse aorta [25]. Based on these observations, I wanted to

investigate if elevated expression of p65 in atherosclerosis-prone regions correlated with the

expression of other NF-κB/Rel and IκB genes. To assess expression of NF-κB/Rel and IκB

genes specifically in aortic endothelial cells which constitute majority of the intima, potential

contamination from resident intimal dendritic cells (RIDC) present in the HP region needed to

be eliminated [26, 56]. For this purpose, mice expressing the high-affinity simian Diphtheria-

toxin receptor (DTR) under the control of the CD11c promoter were used to delete CD11c-

positive RIDC in the HP region of the aorta [26, 56]. DTR is normally expressed by rodent cells

and has a low affinity for Diphtheria toxin (DT); therefore mice are relatively resistant to DT. In

contrast, CD11c-DTR transgenic mice express a high affinity simian DTR under the

transcriptional regulation of CD11c; thus a single injection of DT deletes virtually all of the

CD11c positive RIDC within 24 hours [26, 60].

48

4.2 Methods

4.2.1 Harvesting of endothelial cells from the HP and LP regions of the aorta of CD11c-

Diphtheria toxin receptor (DTR) transgenic mice

CD11c-DTR mice were injected intraperitoneally with diphtheria toxin (DT, 4ng/g body

weight, List Biologicals) and 24 hours after DT injection, the vascular tree in these mice was

perfused with 20 mL of cold PBS containing 1% heparin. The ascending aorta and aortic arch

were harvested, and adipose tissue was removed using a dissecting microscope (SMZ-U; Nikon)

in a Petri dish containing ice-cold PBS and 1mM of the RNase inhibitor aurintricarboxylic acid

(ATA). Segments of the aorta were opened and pinned with the endothelial surface facing

upwards on a dish with a black silicone base. Next, the aortic tissue was bathed in 2 units of

DNase-I (Fermentas) followed by 8 minutes of incubation with Liberase Blendzyme 2 (1:100

dilution, Roche Diagnostics) at 37ºC in Ca2+

/Mg2+

- containing PBS. The digested tissue was

then washed with cold Ca2+

/Mg2+

- containing PBS with 1mM ATA followed by the addition of

1 μL of FITC-labelled latex beads (0.1 micron, Polysciences) which facilitated the visualization

of distinct endothelial cell morphology in HP and LP regions of the aorta. Cells from the HP and

LP regions were gently scraped with a 30-gauge needle and transferred with a pipetman (P10,

Gilson) directly into RNA extraction buffer (Buffer RLT Plus, Qiagen).

4.2.2 RNA extraction, cDNA synthesis and qRT-PCR

Total RNA was extracted from the aortic endothelial cells by using the RNeasy micro

plus kit (Qiagen) as per the manufacturer’ instructions. Synthesis of cDNA and qRT-PCR was

performed as mentioned in section 2.2.3. mRNA expression of NF-κB/Rel genes and IκBα was

normalized to CD31, a housekeeping gene primarily expressed by endothelial cells.

49

I would like to thank Mian Chen for harvesting aortic endothelial cells from CD11c-

DTR mice and extracting RNA from these cells for subsequent qRT-PCR analysis.

50

Table-4 - Primers for mouse genes (mRNA)

Gene Sequence (5’- 3’)

RelA F ACCTGGAGCAAGCCATTAGC

R GAGGCGCACTGCATTC

RelB F ACAATGCTGGCTCCCTGAAG

R GTCCCTGCTGGTCCCGATA

cRel F GACAACCGTGCCCCAAATAC

R TCATCTCCTCCCCTGACACTTC

p105 F GGACATGGTGGTTGGCTTTG

R TCCGTGCTTCCAGTGTTTCA

p100 F TGCGCTTCTCAGCTTTCCTT

R CCCCTGGAGACTTGCTGTCA

IκBα F GCTACCCGAGAGCGAGGAT

R GCCTCCAAACACACAGTCATCAT

CD31

F AGGGAGCACACCGAGAGCTA

R TGGATACGCCATGCACCTT

VE-Cadherin

F GAAAACCAGAAGAAACCGCTGAT

R CACTGGTCTTGCGGATGGA

CD11c

F CCACTGTCTGCCTTCATATTCATG

R AAGATGGCCCGGGTACTCA

F – Forward primer, R – Reverse primer

51

4.3 Results

4.3.1 Elevated levels of p65 correlate with increased RelB, p105, p100 and IκBα expression

in the normal mouse aortic endothelium in regions prone to atherosclerotic lesion

formation

Firstly, to ensure the deletion of CD11c-positive RIDC in CD11c-DTR transgenic

mice, qRT-PCR was used to assess intimal CD11c mRNA expression. 24 hours after injecting

these mice with DT, CD11c mRNA levels were undetectable in the HP region in contrast to

endothelial markers (CD31 and VE-cadherin) which remain unchanged (Table-5). This

demonstrated that CD11c-positive intimal RIDC in the HP region were successfully deleted

while intimal endothelial cells remained intact. Subsequent qRT-PCR analysis of NF-κB/Rel

and IκBα gene expression in the HP versus the LP regions revealed that mRNA levels of all NF-

κB/Rel genes (except cRel whose expression was not detected in the HP region) correlated with

p65 mRNA levels in the HP region endothelium with the strongest correlation between p100

and IκBα (Table-5 and Figure-13). The relatively lower correlation coefficients of RelB and

p105 genes may be due to variability in measurements between successive experiments, which

will be further tested by increasing the number of experiments. Two out of the four experiments

performed (one mouse per experiment) showed that the ratio of p65 mRNA expression in the

HP region versus the LP region was close to 1 which correlated with the HP to LP mRNA

expression ratio of other NF-κB/Rel genes and IκBα. One may find this intriguing because p65

mRNA and protein expression has been demonstrated to be higher in the HP region relative to

LP region [25, 61]. However, this can be attributed to the experimental approach used to

investigate the differences of p65 expression in these regions.

52

Table-5 - Comparison of mRNA expression (normalized to CD31) of NF-κB/Rel genes,

IκBα and an endothelial marker VE-Cadherin between atherosclerosis-susceptible (HP)

and atherosclerosis-resistant (LP) regions of the nomal mouse aorta

Experiment -1 Experiment -2 Experiment -3 Experiment -4

HP LP HP:LP HP LP HP:LP HP LP HP:LP HP LP HP:LP

p65 0.12 0.10 1.1 0.65 0.20 3.2 0.45 0.37 1.2 0.76 0.20 3.8

RelB 0.16 0.10 1.6 0.88 0.36 2.4 0.85 0.38 2.2 0.22 0.06 3.6

p100 0.12 0.11 1.1 0.93 0.31 3.0 0.60 0.52 1.15 1.68 0.34 5.0

p105 0.72 0.61 1.2 2.72 1.70 1.6 2.50 2.22 1.1 5.2 0.8 6.5

IκBα 0.1 0.16 0.62 0.71 0.31 2.3 0.50 0.49 1.0 4.7 1.4 3.3

VE-

Cadherin

0.04 0.05 0.8 0.04 0.05 0.8 0.04 0.04 1.0 0.02 0.02 1.0

CD11c ND ND ND ND ND ND ND ND ND ND ND ND

HP: High probability region for atherosclerosis

LP: Low probability region for atherosclerosis

ND: Not detectable

53

Figure-13: p65, RelB, p100, p105 and IκBα mRNA expression in atherosclerosis-prone

(HP) vs. resistant regions (LP) of the normal mouse aortic endothelium. Intimal cells

harvested from DTR mice 24 hours after intra-peritoneal injection of DT and qRT-PCR was

performed to analyze mRNA expression of p65, RelB, p100, p105 and IκBα. To account for

differences in RNA yield, gene expression was normalized to CD31, a pan-endothelial marker.

Values are represented as a ratio of HP region relative to the LP region. The p65 ratio is plotted

on the x-axis as a function of the ratio of other NF-κB genes and IκBα (n=4).

54

In contrast to en face immunostaining coupled with confocal microscopy, where

different layers of the vessel wall (intima, media and adventitia) can be observed separately [25,

26], the qRT-PCR approach requires harvesting of only the intimal layer of the vessel wall in

which endothelial cells are visualized by FITC-labeled beads prior to harvest (see methods

section 3.3.1). Due to the inherent variability in scraping the intimal cells by this approach, it is

possible that in some experiments, aortic intimal cells may be harvested from areas that border

both the HP and LP regions. This may explain the low mRNA expression of p65 observed in

these regions in certain experiments. I expect to overcome this variability by performing more

experiments. Measurement of hnRNA levels by qRT-PCR was not possible in this case due to

low sample size and abundance of this molecule.

These in vivo results are similar to the observations in unstimulated HUVEC (section

2.3.2, Figure-6), and support our hypothesis that p65 levels influence the constitutive expression

of RelB, p100, p105 and IκBα.

55

CHAPTER - 5: Discussion and Future directions

56

5.1 Discussion

Activation of NF-κB in response to diverse stimuli such as pro-inflammatory mediators,

growth factors and UV-radiation has been well characterized by numerous studies [3]. Yet, the

molecular mechanisms behind the regulation of NF-κB homeostasis remain poorly understood.

Given the importance of the prototypic NF-κB subunit RelA (p65) in regulating signal-induced

NF-κB target gene expression coupled with the observations that p65 transcription is not

regulated by NF-κB led me to investigate the role of p65 in regulating the constitutive

expression of other NF-κB/Rel and IκB family member genes.

In order to determine the role of p65 in regulating the expression of other NF-κB/Rel and

IκB genes and assess its effect on NF-κB homeostasis, p65 expression was suppressed by

siRNA silencing in HeLa cells, a well known model for studying NF-κB signalling. Reduction

in p65 levels correlated with significantly reduced transcription and mRNA expression of RelB

and p100 but not cRel and p105 within the NF-κB/Rel family genes, and IκBα and IκBε (Won,

D PhD Thesis, 2008) except IκBβ (Won, D PhD Thesis, 2008) within the IκB family genes in

unstimulated HeLa cells. These results suggest that p65 regulates the transcription of only

certain NF-κB/Rel and IκB family members constitutively. These data are supported by studies

using chromatin immunoprecipitation (ChIP) assays performed in unstimulated HeLa cells [34]

which showed that p65 is recruited to the promoters of p100 and IκBα, thus, suggesting that p65

regulates the constitutive transcription of these genes. Under quiescent conditions, p65 is mostly

sequestered in the cytosol of cells, however, it has been reported that a fraction of p65 can

undergo constitutive nuclear translocation and possibly drive the transcription of selected target

genes (IL-8, Naf-1) with accessible promoters [34, 35]. Therefore, it is possible that epigenetic

57

modifications may render the promoters of a subset of NF-κB/Rel and IκB genes more

accessible for p65-dependent transcription in unstimulated HeLa cells.

Expression of dnIκBα in HeLa cells significantly reduced the TNFα-induced

transcription of RelB, p100 and IκBα, which verified the efficiency of this approach in

inhibiting the canonical NF-κB pathway after TNFα stimulation. Furthermore, the constitutive

hnRNA levels of these genes in dnIκBα expressing HeLa cells were found to be significantly

reduced, suggesting that the canonical NF-κB pathway is indeed involved in regulating

constitutive p65-dependent target gene transcription. These findings do not support our

hypothesis which stipulated that in unstimulated cells p65 can undergo nuclear translocation and

transactivate target gene expression independently of the canonical pathway.

We concluded that low-level IKKβ activation is responsible for the constitutive p65-

dependent target gene transcription in HeLa cells. This is in line with findings from a study that

used a Doxycycline-inducible dnIκBα construct stably transfected into HeLa cells which

reduced basal NF-κB DNA binding and steady-state RelB mRNA expression [35]. This

constitutive IKKβ mediated p65-dependent transcription in HeLa cells may reflect the

importance of canonical NF-κB activity to ensure survival of many cancer cells [53].

In contrast to HeLa cells, p65 modulation by RNAi had no affect on the constitutive

transcription of NF-κB/Rel and IκB genes in unstimulated HUVEC; however, RelB, p105 and

p100 mRNA and RelB, p100 and IκBα protein levels were significantly reduced. These results

raised the possibility that p65 does not directly control the transcription of these genes but

somehow affects their mRNA and/or protein stability. The profound loss of IκBα protein

expression after p65 suppression could possibly be a result of proteasomal degradation as free

IκBα has a very short half–life (<10 minutes) after its C-terminal PEST domain is unmasked

58

[37]. However, it is intriguing that IκBβ levels were upregulated after silencing p65 as IκBβ also

possesses a C-terminal PEST domain and was expected to undergo proteasomal degradation

when unbound from p65 (see Figure-1 in introduction). This result together with the

upregulation of cRel mRNA in HeLa cells suggests the existence of mechanism(s) that play a

role in compensating the loss of one or more NF-κB or IκB family members in unstimulated

cells. Upregulation of cRel expression has been observed in in p65-deficient MEF’s [36] which

further supports the possibility of molecular compensation within the NF-κB signalling module.

The stabilities of NF-κB and IκB proteins may account for these differences. IκBβ is the most

stable of the IκB’s as demonstrated by cycloheximide experiments in IκBα and ε deficient-

MEF’s [7, 37]. Also, RelB and p100 stabilize each other when complexed together as a

RelB/p100 dimer because loss of either protein leads to degradation of the other [9].

Transcription of many NF-κB target genes following pro-inflammatory cytokine

stimulation is rapidly induced and down-regulated and the rate of transcription of such genes

correlates with their mRNA and protein expression. For example, it is well known that after

TNFα-stimulation, p65 is rapidly recruited to the IκBα promoter and participates in the

transactivation of IκBα transcription. IκBα protein synthesis follows. In addition to

transcriptional regulation, control of gene expression within the NF-κB signalling module and of

other NF-κB targets has also been shown to occur by post-transcriptional mechanisms in cells

exposed to pro-inflammatory stimuli. For example, LPS stimulation of MEF’s resulted in

prolonged half-life of p100 mRNA compared to IκBα mRNA [38]. Also, TNFα stimulation of

murine bone marrow-derived macrophages and fibroblasts induced numerous transcripts with

prolonged half-lives such as CCL5 and ICAM-1[39]. In addition, low shear stress exposure to

HUVEC lead to stabilization of KLF2 mRNA levels compared to static conditions [40]. Thus, it

59

is important to note that mRNA and protein expression of genes may not be reflective of their

rate of transcription especially in unstimulated cells where most of the transcriptional machinery

is silent. Therefore, the potential involvement of post-transcriptional mechanisms in regulating

constitutive NF-κB/Rel and IκB gene expression should be considered since it may account for

p65-dependent expression levels of these genes in unstimulated HUVEC.

The correlation of p65 levels with RelB, p100 and IκBα expression in unstimulated

HeLa cells and additionally p105 in unstimulated HUVEC highlights potential mechanism(s),

either transcriptional or post-transcriptional in the latter case, by which p65 regulates

components of the canonical as well as the non-canonical NF-κB pathways in resting cells. This

is consistent with studies performed in unstimulated MEF’s which showed that genetic deletion

of p65 lead to a reduction in RelB and p100 mRNA and protein levels [9]. This p65-dependent

homeostatic cross-talk between the two NF-κB pathways can possibly determine the strength of

both canonical and non-canonical NF-κB signalling in response to their respective stimuli (see

Introduction section 1.2). For instance, modulation of RelB and p100 expression by p65 can set

the magnitude of activation of the non-canonical pathway after exposure to stimuli like CD40L

and LTαβ. In addition, p65 can determine the extent of canonical NF-κB signalling by

influencing the expression of p105 which can act as a transcriptional activator or repressor (see

Introduction section 1.1), and IκBα which functions as terminator of transcription.

It remains to be investigated whether modulation of steady-state p65 levels can affect

non-canonical NF-κB signalling in endothelial cells similar to MEF’s [11].

TNFα stimulation of both HeLa cells and HUVEC significantly upregulated the

transcription and mRNA expression of all NF-κB/Rel and IκB genes which is consistent with

the literature as these genes are known NF-κB targets [35]. The lack of upregulation of p65

60

hnRNA and mRNA after TNFα stimulation supports the observations of a previous study that

p65 is not under the control of NF-κB [17]. Silencing p65 expression in TNFα-stimulated HeLa

cells and HUVEC significantly reduced the magnitude of induction of other NF-κB/Rel and IκB

(except cRel and IκBβ) genes, which suggested that steady-state p65 levels regulate the

threshold of NF-κB/Rel and IκB gene expression under TNFα-stimulated conditions. This

indicates an additional level of control of canonical NF-κB signalling mediated by p65 besides

control mediated by known NF-κB feedback regulators like IκBα [43]. Also, it is established

that after TNFα or LPS stimulation, p65 undergoes rapid nuclear localization, enhanced DNA

binding and transactivates numerous target genes [42, 44]. This highly induced NF-κB

activation is due to many processes some of which include chromatin remodelling, post-

translational modifications (such as phosphorylation of p65 on Ser-536) and co-factor binding

(like CBP/p300) that can be responsible for the broad spectrum induction of NF-κB/Rel and IκB

genes [45, 46]. However, all this is either absent or occurring at a low-level for selective

regulation of NF-κB/Rel and IκB gene expression by p65 in unstimulated HeLa cells and

HUVEC.

Assessment of intimal endothelial NF-κB/Rel and IκBα gene in atherosclerosis-

predisposed versus protected regions of the normal mouse aorta revealed a correlation between

elevated mRNA levels of p65 in the predisposed region and the same set of genes as was

observed in cultured HUVEC, i.e RelB, p100, p105 and IκBα. These findings expanded the

previous observations from our laboratory which showed that p65, IκBα and IκBβ protein levels

were upregulated in the atherosclerosis predisposed region of the normal mouse aorta [25]. In

addition, these results suggest that p65 also influences the expression of members of both the

canonical and non-canonical NF-κB pathways in vivo. It is likely that this p65-dependent control

61

of the expression of these genes is dependent on exposure of endothelial cells to disturbed blood

flow in atherosclerosis-predisposed regions. It is well documented that oscillatory low time-

averaged shear stress can cause endothelial dysfunction and lead to prolonged activation of both

MAP kinase (JNK1) and NF-κB signalling pathways [15, 47, 48]. My data obtained in

unstimulated HUVEC after suppression of p65 suggests that HUVEC maintained under static

conditions (no flow) exhibit relatively similar p65-dependent regulation of other NF-κB/Rel

genes and IκBα compared to mouse aortic endothelial cells exposed to disturbed hemodynamics

in atherosclerosis-predisposed regions. Indeed, there is evidence from the literature which

supports the fact that endothelial cells maintained under static conditions behave similarly to

those exposed to disturbed flow [15, 49]. Overall, both the in vitro and in vivo findings in

endothelial cells demonstrate that p65 plays an important role in regulating endothelial NF-κB

homeostasis as well as pro-inflammatory or shear-stress induced endothelial NF-κB signalling

all of which can affect atherosclerosis susceptibility. One of the determinants of susceptibility to

atherosclerosis could be a result of cross talk between the canonical and non-canonical NF-κB

pathways as studies have shown that both pathways contribute to an increase in atherosclerotic

burden [50-52, 57].

62

5.2 Summary and future directions

This study showed that in unstimulated HeLa cells, p65 can influence NF-κB

homeostasis by regulating the transcription of RelB, p100 and IκBα through low-grade

canonical NF-κB signalling. In unstimulated HUVEC, it appears that canonical NF-κB

signalling is largely quiescent, yet, p65 regulates the expression of these genes in addition to

p105 at the post-transcriptional level rather than by altering transcription. In addition to

regulating NF-κB homeostasis, p65 levels play a role in setting the threshold of TNFα-induced

NF-κB/Rel and IκB gene expression in both cell types.

The correlation of p65 mRNA levels with that of other NF-κB/Rel genes and IκBα in the

atherosclerosis-susceptible regions of the mouse aorta suggest that p65 can also influence the

expression of its own family members in vivo. This coupled with the in vitro observations in

HUVEC suggests that components of both the canonical (RelA, p105 and IκBα) and non-

canonical (RelB and p100) NF-κB pathways may play a role in the pathogenesis of

atherosclerosis.

Future studies will investigate the molecular mechanisms underlying the p65-dependent

RelB, p105, p100 and IκBα expression in unstimulated HUVEC. As p65 did not regulate the

transcription of these genes, yet their mRNA and protein levels were lower, p65 may regulate

the mRNA and/or protein stability of these genes. It is possible that p65 stabilizes the mRNA

levels of RelB, p105 and p100 by regulating the expression or function of proteins that influence

mRNA stability. I will determine if p65 levels influence mRNA half-life of these genes in time

course experiments by treating HUVEC transfected either with p65 siRNA or control siRNA

with Actinomycin D (ActD), a common inhibitor of new mRNA synthesis [39, 40]. I expect that

in p65 siRNA transfected cells, the mRNA half-life of these genes will be reduced compared to

63

control siRNA transfected cells. In parallel experiments, I expect that the half-life of cRel

mRNA will remain unaffected or will increase in p65 siRNA transfected cells since my

experiments showed a trend towards increased cRel mRNA levels after p65 suppression. If

mRNA stability of RelB, p100 and p105 is indeed dependent on p65 expression levels, I would

utilize a microarray approach to screen for genes encoding for potential mRNA

binding/stabilizing factors, whose expression is regulated by constitutive p65 levels.

It has been well documented that the protein stability of IκB proteins is dependent upon

the stoichiometry and availability of p65 and other NF-κB members [7, 37]. Thus, it may also be

possible that p65 also stabilizes the protein expression of RelB and p100 by direct interactions.

To test for protein stability/turnover, I would perform either pulse-chase experiments or use

cycloheximide (CHX), a widely used inhibitor of new protein synthesis [7, 37, 41] to measure

protein half-life of RelB, p100 and IκBα in p65 siRNA versus control siRNA transfected cells.

Any potential interactions between p65 and the selected NF-κB members will be verified by

immunoprecipitation assays as described by a study in MEF’s [38].

Upregulation of cRel mRNA in HeLa cells and IκBβ protein levels in HUVEC after

suppression of p65 exhibits compensation within the NF-κB signalling module and this

phenomenon has also been observed in MEF’s [7, 36]. However, the molecular mechanisms

behind how this compensation occurs remain to be elucidated. It is possible that upon p65

suppression, cRel mRNA stability and IκBβ protein stability is increased which would be

addressed experimentally by mRNA and protein turnover experiments.

64

It also remains to be investigated whether the modulation of NF-κB/Rel and IκB gene

expression in endothelial cells of atherosclerosis-predisposed regions is dependent on low-level

canonical NF-κB signalling, as was observed in HeLa cells. This is a likely possibility, since in

vitro disturbed flow can induce canonical NF-κB signalling in endothelial cells [47, 64, 65, 68].

These studies will use normal mice which have not been exposed to pro-atherogenic and

pro-inflammatory stimuli, and are deficient in p65 or express dnIκBα specifically in endothelial

cells by a Cre-loxP system [57, 62, 63]. Expression of other NF-κB/Rel and IκB genes will be

assessed in the endothelium of the atherosclerosis-susceptible regions. These experiments will

also provide insights into the role of p65 and the canonical NF-κB pathway in regulating the

expression of members of the non-canonical pathway (RelB and p100) in vivo. Other parameters

affecting atherosclerosis susceptibility like monocyte recruitment, RIDC abundance and pro-

inflammatory gene expression (IL-8, VCAM1 and MCP-1) in the atherosclerosis-susceptible

regions will also be assessed using these mice.

65

REFERENCES

[1] Hoffmann A, Baltimore D. Circuitry of nuclear factor kappaB signaling. Immunol Rev.

2006; 210: 171-86.

[2] Liou HC, Hsia CY. Distinctions between c-Rel and other NF-kappaB proteins in immunity

and disease. Bioessays. 2003; 25: 767-80.

[3] O'Dea E, Hoffmann A. The regulatory logic of the NF-kappaB signaling system. Cold

Spring Harb Perspect Biol. 2010; 2: a000216.

[4] Shih VF, Tsui R, Caldwell A, Hoffmann A. A single NF-kappaB system for both

canonical and non-canonical signaling. Cell Res. 2011; 21: 86-102.

[5] Solt LA, Madge LA, May MJ. NEMO-binding domains of both IKKalpha and IKKbeta

regulate IkappaB kinase complex assembly and classical NF-kappaB activation. J Biol Chem.

2009; 284: 27596-608.

[6] Rudolph D, Yeh WC, Wakeham A, Rudolph B, Nallainathan D, Potter J, Elia AJ, Mak

TW. Severe liver degeneration and lack of NF-kappaB activation in NEMO/IKKgamma-

deficient mice. Genes Dev. 2000; 14: 854-62.

[7] O'Dea EL, Barken D, Peralta RQ, Tran KT, Werner SL, Kearns JD, Levchenko A,

Hoffmann A. A homeostatic model of IkappaB metabolism to control constitutive NF-kappaB

activity. Mol Syst Biol. 2007; 3: 111.

[8] Dejardin E, Droin NM, Delhase M, Haas E, Cao Y, Makris C, Li ZW, Karin M, Ware

CF, Green DR. The lymphotoxin-beta receptor induces different patterns of gene expression

via two NF-kappaB pathways. Immunity. 2002; 17: 525-35.

[9] Basak S, Shih VF, Hoffmann A. Generation and activation of multiple dimeric

transcription factors within the NF-kappaB signaling system. Mol Cell Biol. 2008; 28: 3139-50.

[10] Basak S, Kim H, Kearns JD, Tergaonkar V, O'Dea E, Werner SL, Benedict CA, Ware

CF, Ghosh G, Verma IM, Hoffmann A. A fourth IkappaB protein within the NF-kappaB

signaling module. Cell. 2007; 128: 369-81.

[11] Basak S, Hoffmann A. Crosstalk via the NF-kappaB signaling system. Cytokine Growth

Factor Rev. 2008; 19: 187-97.

[12] Galkina E, Ley K. Immune and inflammatory mechanisms of atherosclerosis . Annu Rev

Immunol. 2009; 27: 165-97.

[13] Helderman F, Segers D, de Crom R, Hierck BP, Poelmann RE, Evans PC, Krams R.

Effect of shear stress on vascular inflammation and plaque development. Curr Opin Lipidol.

2007; 18: 527-33.

[14] Pober JS, Sessa WC. Evolving functions of endothelial cells in inflammation. Nat Rev

Immunol. 2007; 7: 803-15.

66

[15] Cuhlmann S, Van der Heiden K, Saliba D, Tremoleda JL, Khalil M, Zakkar M,

Chaudhury H, Luong le A, Mason JC, Udalova I, Gsell W, Jones H, Haskard DO, Krams

R, Evans PC. Disturbed Blood Flow Induces RelA Expression via c-Jun N-Terminal Kinase 1:

A Novel Mode of NF-{kappa}B Regulation That Promotes Arterial Inflammation. Circ Res.

2011; 108: 950-9.

[16] Cybulsky MI, Jongstra-Bilen J. Resident intimal dendritic cells and the initiation of

atherosclerosis. Curr Opin Lipidol. 2010; 21: 397-403.

[17] Ueberla K, Lu Y, Chung E, Haseltine WA. The NF-kappa B p65 promoter. J Acquir

Immune Defic Syndr. 1993; 6: 227-30.

[18] Sasaki CY, Barberi TJ, Ghosh P, Longo DL. Phosphorylation of RelA/p65 on serine 536

defines an I{kappa}B{alpha}-independent NF-{kappa}B pathway. J Biol Chem. 2005; 280:

34538-47.

[19] Buss H, Dorrie A, Schmitz ML, Hoffmann E, Resch K, Kracht M. Constitutive and

interleukin-1-inducible phosphorylation of p65 NF-{kappa}B at serine 536 is mediated by

multiple protein kinases including I{kappa}B kinase (IKK)-{alpha}, IKK{beta}, IKK{epsilon},

TRAF family member-associated (TANK)-binding kinase 1 (TBK1), and an unknown kinase

and couples p65 to TATA-binding protein-associated factor II31-mediated interleukin-8

transcription. J Biol Chem. 2004; 279: 55633-43.

[20] Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded RNA. Nature.

2004; 431: 343-9.

[21] Elferink CJ, Reiners JJ,Jr. Quantitative RT-PCR on CYP1A1 heterogeneous nuclear

RNA: a surrogate for the in vitro transcription run-on assay. BioTechniques. 1996; 20: 470-7.

[22] Ear T, Fortin CF, Simard FA, McDonald PP. Constitutive association of TGF-beta-

activated kinase 1 with the IkappaB kinase complex in the nucleus and cytoplasm of human

neutrophils and its impact on downstream processes. J Immunol. 2010; 184: 3897-906.

[23] Upton PD, Davies RJ, Trembath RC, Morrell NW. Bone morphogenetic protein (BMP)

and activin type II receptors balance BMP9 signals mediated by activin receptor-like kinase-1 in

human pulmonary artery endothelial cells. J Biol Chem. 2009; 284: 15794-804.

[24] Renner F, Schmitz ML. Autoregulatory feedback loops terminating the NF-kappaB

response. Trends Biochem Sci. 2009; 34: 128-35.

[25] Hajra L, Evans AI, Chen M, Hyduk SJ, Collins T, Cybulsky MI. The NF-kappa B

signal transduction pathway in aortic endothelial cells is primed for activation in regions

predisposed to atherosclerotic lesion formation. Proc Natl Acad Sci U S A. 2000; 97: 9052-7.

[26] Paulson KE, Zhu SN, Chen M, Nurmohamed S, Jongstra-Bilen J, Cybulsky MI.

Resident intimal dendritic cells accumulate lipid and contribute to the initiation of

atherosclerosis. Circ Res. 2010; 106: 383-90.

67

[27] Meiler SE, Hung RR, Gerszten RE, Gianetti J, Li L, Matsui T, Gimbrone MA,Jr,

Rosenzweig A. Endothelial IKK beta signaling is required for monocyte adhesion under laminar

flow conditions. J Mol Cell Cardiol. 2002; 34: 349-59.

[28] Ogawara K, Kuldo JM, Oosterhuis K, Kroesen BJ, Rots MG, Trautwein C, Kimura

T, Haisma HJ, Molema G. Functional inhibition of NF-kappaB signal transduction in

alphavbeta3 integrin expressing endothelial cells by using RGD-PEG-modified adenovirus with

a mutant IkappaB gene. Arthritis Res Ther. 2006; 8: R32.

[29] Nowak DE, Tian B, Jamaluddin M, Boldogh I, Vergara LA, Choudhary S, Brasier

AR. RelA Ser276 phosphorylation is required for activation of a subset of NF-kappaB-

dependent genes by recruiting cyclin-dependent kinase 9/cyclin T1 complexes. Mol Cell Biol.

2008; 28: 3623-38.

[30] Kwok BH, Koh B, Ndubuisi MI, Elofsson M, Crews CM. The anti-inflammatory natural

product parthenolide from the medicinal herb Feverfew directly binds to and inhibits IkappaB

kinase. Chem Biol. 2001; 8: 759-66.

[31] Adli M, Merkhofer E, Cogswell P, Baldwin AS. IKKalpha and IKKbeta each function to

regulate NF-kappaB activation in the TNF-induced/canonical pathway. PLoS One. 2010; 5:

e9428.

[32] Mercurio F, Murray BW, Shevchenko A, Bennett BL, Young DB, Li JW, Pascual G,

Motiwala A, Zhu H, Mann M, Manning AM. IkappaB kinase (IKK)-associated protein 1, a

common component of the heterogeneous IKK complex. Mol Cell Biol. 1999; 19: 1526-38.

[33] Li X, Massa PE, Hanidu A, Peet GW, Aro P, Savitt A, Mische S, Li J, Marcu KB.

IKKalpha, IKKbeta, and NEMO/IKKgamma are each required for the NF-kappa B-mediated

inflammatory response program. J Biol Chem. 2002; 277: 45129-40.

[34] Nowak DE, Tian B, Brasier AR. Two-step cross-linking method for identification of NF-

kappaB gene network by chromatin immunoprecipitation. BioTechniques. 2005; 39: 715-25.

[35] Tian B, Nowak DE, Jamaluddin M, Wang S, Brasier AR. Identification of direct

genomic targets downstream of the nuclear factor-kappaB transcription factor mediating tumor

necrosis factor signaling. J Biol Chem. 2005; 280: 17435-48.

[36] Hoffmann A, Leung TH, Baltimore D. Genetic analysis of NF-kappaB/Rel transcription

factors defines functional specificities. EMBO J. 2003; 22: 5530-9.

[37] Mathes E, O'Dea EL, Hoffmann A, Ghosh G. NF-kappaB dictates the degradation

pathway of IkappaBalpha. EMBO J. 2008; 27: 1357-67.

[38] Shih VF, Kearns JD, Basak S, Savinova OV, Ghosh G, Hoffmann A. Kinetic control of

negative feedback regulators of NF-kappaB/RelA determines their pathogen- and cytokine-

receptor signaling specificity. Proc Natl Acad Sci U S A. 2009; 106: 9619-24.

[39] Hao S, Baltimore D. The stability of mRNA influences the temporal order of the induction

of genes encoding inflammatory molecules. Nat Immunol. 2009; 10: 281-8.

68

[40] van Thienen JV, Fledderus JO, Dekker RJ, Rohlena J, van Ijzendoorn GA, Kootstra

NA, Pannekoek H, Horrevoets AJ. Shear stress sustains atheroprotective endothelial KLF2

expression more potently than statins through mRNA stabilization. Cardiovasc Res. 2006; 72:

231-40.

[41] Hertlein E, Wang J, Ladner KJ, Bakkar N, Guttridge DC. RelA/p65 regulation of

IkappaBbeta. Mol Cell Biol. 2005; 25: 4956-68.

[42] Schreiber J, Jenner RG, Murray HL, Gerber GK, Gifford DK, Young RA.

Coordinated binding of NF-kappaB family members in the response of human cells to

lipopolysaccharide. Proc Natl Acad Sci U S A. 2006; 103: 5899-904.

[43] Werner SL, Kearns JD, Zadorozhnaya V, Lynch C, O'Dea E, Boldin MP, Ma A,

Baltimore D, Hoffmann A. Encoding NF-kappaB temporal control in response to TNF: distinct

roles for the negative regulators IkappaBalpha and A20. Genes Dev. 2008; 22: 2093-101.

[44] Medzhitov R, Horng T. Transcriptional control of the inflammatory response. Nat Rev

Immunol. 2009; 9: 692-703.

[45] Calao M, Burny A, Quivy V, Dekoninck A, Van Lint C. A pervasive role of histone

acetyltransferases and deacetylases in an NF-kappaB-signaling code. Trends Biochem Sci. 2008;

33: 339-49.

[46] Perkins ND. Post-translational modifications regulating the activity and function of the

nuclear factor kappa B pathway. Oncogene. 2006; 25: 6717-30.

[47] Mohan S, Koyoma K, Thangasamy A, Nakano H, Glickman RD, Mohan N. Low shear

stress preferentially enhances IKK activity through selective sources of ROS for persistent

activation of NF-kappaB in endothelial cells. Am J Physiol Cell Physiol. 2007; 292: C362-71.

[48] Chatzizisis YS, Coskun AU, Jonas M, Edelman ER, Feldman CL, Stone PH. Role of

endothelial shear stress in the natural history of coronary atherosclerosis and vascular

remodeling: molecular, cellular, and vascular behavior. J Am Coll Cardiol. 2007; 49: 2379-93.

[49] Dai G, Kaazempur-Mofrad MR, Natarajan S, Zhang Y, Vaughn S, Blackman BR,

Kamm RD, Garcia-Cardena G, Gimbrone MA,Jr. Distinct endothelial phenotypes evoked by

arterial waveforms derived from atherosclerosis-susceptible and -resistant regions of human

vasculature. Proc Natl Acad Sci U S A. 2004; 101: 14871-6.

[50] Monaco C, Andreakos E, Kiriakidis S, Mauri C, Bicknell C, Foxwell B, Cheshire N,

Paleolog E, Feldmann M. Canonical pathway of nuclear factor kappa B activation selectively

regulates proinflammatory and prothrombotic responses in human atherosclerosis. Proc Natl

Acad Sci U S A. 2004; 101: 5634-9.

[51] Mach F, Schonbeck U, Libby P. CD40 signaling in vascular cells: a key role in

atherosclerosis? Atherosclerosis. 1998; 137 Suppl: S89-95.

[52] Lutgens E, Lievens D, Beckers L, Wijnands E, Soehnlein O, Zernecke A, Seijkens T,

Engel D, Cleutjens J, Keller AM, Naik SH, Boon L, Oufella HA, Mallat Z, Ahonen CL,

Noelle RJ, de Winther MP, Daemen MJ, Biessen EA, Weber C. Deficient CD40-TRAF6

69

signaling in leukocytes prevents atherosclerosis by skewing the immune response toward an

antiinflammatory profile. J Exp Med. 2010; 207: 391-404.

[53] Gasparian AV, Yao YJ, Kowalczyk D, Lyakh LA, Karseladze A, Slaga TJ, Budunova

IV. The role of IKK in constitutive activation of NF-kappaB transcription factor in prostate

carcinoma cells. J Cell Sci. 2002; 115: 141-51.

[54] Ghosh S, Hayden MS. New regulators of NF-kappaB in inflammation. Nat Rev Immunol.

2008; 8: 837-48.

[55] Bollrath, J. and Greten, FR. IKK/NF-κB and STAT3 pathways: central signalling hubs in

inflammation-mediated tumour promotion and metastasis. EMBO reports. 2009; 10: 1314-19.

[56] Jongstra-Bilen J, Haidari M, Zhu SN, Chen M, Guha D, Cybulsky MI. Low-grade

chronic inflammation in regions of the normal mouse arterial intima predisposed to

atherosclerosis. J Exp Med. 2006; 203: 2073-83.

[57] Gareus R, Kotsaki E, Xanthoulea S, van der Made I, Gijbels MJ, Kardakaris R,

Polykratis A, Kollias G, de Winther MP, Pasparakis M. Endothelial cell-specific NF-kappaB

inhibition protects mice from atherosclerosis. Cell Metab. 2008; 8: 372-83.

[58] Kanters E, Pasparakis M, Gijbels MJ, Vergouwe MN, Partouns-Hendriks I, Fijneman

RJ, Clausen BE, Forster I, Kockx MM, Rajewsky K, Kraal G, Hofker MH, de Winther

MP. Inhibition of NF-kappaB activation in macrophages increases atherosclerosis in LDL

receptordeficient mice. J Clin Invest. 2003; 112:1176 –85.

[59] Kanters E, Gijbels MJ, van dM, I, Vergouwe MN, Heeringa P, Kraal G,Hofker MH,

de Winther MP. Hematopoietic NF-kappaB1 deficiency results in small atherosclerotic lesions

with an inflammatory phenotype.Blood. 2004; 103:934 –40.

[60] Jung S, Unutmaz D, Wong P, Sano G, De los Santos K, Sparwasser T, Wu S, Sri

Vuthoori K, Zavala F, Pamer EG, Littman DR, Lang RA. In Vivo Depletion of CD11c+

Dendritic Cells Abrogates Priming of CD8+ T Cells by Exogenous Cell-Associated Antigens.

Immunity. 2002; 17:211-20.

[61] Won D, Zhu SN, Chen M, Teichert AM, Fish JE, Matouk CC, Bonert M, Ojha M,

Marsden PA, Cybulsky MI. Relative reduction of endothelial nitric-oxide synthase expression

and transcription in atherosclerosis-prone regions of the mouse aorta and in an in vitro model of

disturbed flow. Am J Pathol, 2007; 171: 1691-704.

[62] Algul A, Trieber M, Lesina M, Nakhai H, Saur D, Geisler F, Pfeifer A, Paxian S,

Schmid RM. Pancreas-specific RelA/p65 truncation increases susceptibility of acini to

inflammation-associated cell death following cerulean pancreatitis. J Clin Invest, 2007;

117:1490-501.

[63] Geisler F, Algul H, Paxian S, Schmid RM. Genetic inactivation of RelA/p65 sensitizes

adult mouse hepatocytes to TNF-induced apoptosis in vivo and in vitro. Gastroenterology,

2007; 132: 2489-503.

70

[64] Partridge J, Carlsen H, Enesa K, Chaudhury H, Zakkar M, Luong L, Kinderlerer A,

Johns M, Blomhoff R, Mason JC, Haskard DO, Evans PC. Laminar shear stress acts as a

switch to regulate divergent functions of NF-kappaB in endothelial cells. FASEB J. 2007; 21:

3553-61.

[65] Orr AW, Sanders JM, Bevard M, Coleman E, Sarembock IJ, Schwartz MA. The

subendothelial extracellular matrix modulates NF-kappaB activation by flow: a potential role in

atherosclerosis. J Cell Biol. 2005; 169: 191-202.

[66] Hahn C, Schwartz MA. Mechanotransduction in vascular physiology and atherogenesis.

Nat Rev Mol Cell Biol. 2009; 10: 53-62.

[67] Passerini AG, Polacek DC, Shi C, Francesco NM, Manduchi E, Grant GR, Pritchard

WF, Powell S, Chang GY, Stoeckert CJ,Jr, Davies PF. Coexisting proinflammatory and

antioxidative endothelial transcription profiles in a disturbed flow region of the adult porcine

aorta. Proc Natl Acad Sci U S A. 2004; 101: 2482-7.

[68] Mohan S, Hamuro M, Sorescu GP, Koyoma K, Sprague EA, Jo H, Valente AJ,

Prihoda TJ, Natarajan M. IkappaBalpha-dependent regulation of low-shear flow-induced NF-

kappa B activity: role of nitric oxide. Am J Physiol Cell Physiol. 2003; 284: C1039-47.

[69] Yamauchi S, Ito H, Miyajima A. IκBε, a nuclear IκB protein, positively regulates the NF-

κB–mediated expression of proinflammatory cytokines. Proc Natl Acad Sci U S A. 2010; 107:

11924-929.

[70] Iiyama K, Hajra L, Iiyama M, Li H, DiChiara M, Medoff BD, Cybulsky MI. Patterns

of vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 expression in rabbit

and mouse atherosclerotic lesions and at sites predisposed to lesion formation. Circ. Res. 1999;

85: 199-207.