Substantial proportions of identical β-chain T-cell receptor transcripts are present in epithelial...

www.elsevier.com/locate/ycimm

Cellular Immunology 234 (2005) 81–101

Substantial proportions of identical b-chain T-cellreceptor transcripts are present in epithelial ovarian

carcinoma tumors q

John Pappas a, Weon-Ju Jung a, Angeliki K. Barda a, Wan L. Lin a, John E. Fincke a,Enkhtuya Purev a, Maria Radu a, John Gaughan b, C. William Helm c,Enrique Hernandez c, Ralph S. Freedman d, Chris D. Platsoucas a,*

a Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA, USAb Department of Physiology (Biostatistics), Temple University School of Medicine, Philadelphia, PA, USAc Department of Obstetrics and Gynecology, Temple University School of Medicine, Philadelphia, PA, USA

d Department of Gynecologic Oncology, The University of Texas, M.D. Anderson Cancer Center, Houston, TX, USA

Received 6 January 2005; accepted 15 May 2005Available online 20 July 2005

Abstract

To determine whether clonally expanded T cells are present in tumor specimens from patients with epithelial ovarian carcinoma(EOC) we amplified by the non-palindromic adaptor PCR (NPA-PCR) or by Vb-specific PCR b-chain T-cell receptor (TCR) tran-scripts from these tumor specimens. The amplified transcripts were cloned and sequenced. Sequence analysis revealed the presence ofsubstantial proportions of multiple identical copies of b-chain TCR transcripts, suggesting the presence of clonal expansions of Tcells in these patients, which were statistically significant by the binomial distribution in seven of nine patients. Independent ampli-fication in separate experiments of b-chain TCR transcripts from one patient by either NPA-PCR or by Vb-specific PCR, followedby cloning and sequencing, revealed identical clonal expansions irrespectively of the amplification method used. Multiple identicalcopies of b-chain TCR transcripts can be derived only by specific antigen-driven proliferation and clonal expansion of the T-cellclones which recognize these antigens. Because of the very large size of the TCR repertoire, the probability of finding by chancemultiple identical copies of these transcripts within an independent sample of T cells is negligible. These results demonstrate thatT cells infiltrating solid tumor specimens or malignant ascites of patients with EOC contain monoclonal/oligoclonal populationsof T cells.� 2005 Elsevier Inc. All rights reserved.

Keywords: T-cell receptor; Epithelial ovarian carcinoma

1. Introduction

The process of malignant transformation results in alarge number of structural differences between normal

0008-8749/$ - see front matter � 2005 Elsevier Inc. All rights reserved.

doi:10.1016/j.cellimm.2005.05.001

q Part of this work was presented at the 11th International Congressof Immunology, Stockholm, Sweden, July 2001; Scand. J. Immunol. 54(Suppl. 1): 70W.* Corresponding author. Fax: +1 215 829 1320.E-mail address: [email protected] (C.D. Platsoucas).

and tumor cells. Tumor cells in humans and experimen-tal animals are recognized, in general, as non-self by thecells of the immune system and induce a cellular andhumoral immune response which often leads to theirelimination (reviewed in [1]). This is the case with humanepithelial ovarian carcinoma (EOC) (reviewed in [1–4]).

Ovarian tumors are infiltrated by mononuclear cellscomprised primarily of T lymphocytes, which have beendesignated tumor-infiltrating lymphocytes (TIL) (re-viewed in [1]). TIL are present in both malignant ascites

mailto:[email protected]

82 J. Pappas et al. / Cellular Immunology 234 (2005) 81–101

and solid tumor specimens from patients with EOC, andit appears that they represent the immune response ofthe host to the tumor (reviewed in [1]). Their presencein tumors is associated with improved prognosis and in-creased survival (reviewed in [1]). We have previouslydemonstrated that T-cell lines or clones exhibiting cyto-lytic activity and/or cytokine production primarilyagainst autologous tumor cells, can be developed invitro in low concentrations of rIL-2 from TIL ofpatients with EOC [5–7]. TIL-derived T-cell lines andclones that were able to preferentially lyse autologousand not allogeneic ovarian tumor cells were CD3+TCRab+ CD8+, and their cytolytic activity wasblocked by anti-CD3/ab TCR monoclonal antibodies(mab) at the effector cell level or by anti-MHC classI mab at the target cell level [5,6]. Different T-cell cloneswith autologous tumor-specific cytotoxicity frompatients with EOC could recognize different antigenicepitopes on ovarian tumor cells [6]. Certain TIL-derivedT-cell lines from patients with EOC produced IFN-c,TNF-a, and IL-6 primarily in response to autologousand not to allogeneic ovarian tumor cells [7]. Theseresults have been confirmed by others [8–14]. Inaddition, we have recently reported the identificationof HLA-DQa1 and -DRb1 residues associated withsusceptibility and protection to EOC [15].

T cells recognize through their T-cell receptor (TCR)antigenic peptides, derived either from endogenous orexogenous proteins, in association with MHC class Ior II. T cells are comprised of large numbers of differentT-cell clones, each expressing a different TCR molecule,which is a unique fingerprint of this T-cell clone [16–19].The maximum theoretical number of ab TCR has beenestimated to be in the order of 1018 [16,18,19], with themaximum theoretical number of b-chain TCR tran-scripts in the order of approximately 1012 [16]. However,the actual size of the T-cell repertoire is reduced becauseof the elimination of the vast majority of thymocytes inthe thymus by negative selection [19,20]. As a result, it isestimated that 106 different b-chain TCR transcriptsmay be expressed in the peripheral blood of normal do-nors. Each one of these TCR b-chains is pairing, on theaverage, with at least twenty-five different a-chains [20].Nevertheless, these numbers of T-cell clones are stillvery large and sufficient to recognize any conceivableantigenic epitope. The probability of finding by chancemultiple identical copies (two or more) of a particularb-chain TCR transcript within an independent sampleof T cells is negligible. Therefore, the appearance of mul-tiple identical copies of a single b-chain TCR transcriptmust be the result of specific antigen-driven proliferationand clonal expansion of a T-cell clone in response to thisspecific antigen.

To determine whether T cells infiltrating solid tumorspecimens or malignant ascites from patients with EOCcontain oligoclonal/monoclonal populations of T cells,

we amplified by the non-palindromic adaptor PCR(NPA-PCR) and/or by Vb-specific PCR [21–28] b-chainTCR transcripts from these specimens. The amplifiedtranscripts were cloned and sequenced. Substantial pro-portions of identical b-chain TCR transcripts were doc-umented, demonstrating the presence of monoclonal/oligoclonal T cells in solid tumor specimens or malig-nant ascites from patients with EOC.

2. Materials and methods

2.1. Tumor specimens

Solid tumor and malignant ascites specimens frompreviously untreated patients with EOC were used in thisstudy. Solid tumor specimens from patients with EOCwere collected during therapeutic surgery andwere imme-diately placed on ice upon removal. Fatty tissue, normal,and necrotic tissue were removed from the tumor speci-mens. In most specimens a small part of the tumor spec-imen was embedded onto optimum cutting technology(OCT) formulation, snap frozen in liquid nitrogen, andkept at �70 �C to be used for immunohistochemistry.The rest of the tumor specimen was kept in liquid nitro-gen and used for RNA preparation. In other tumor spec-imens the entire specimen was kept in liquid nitrogen andused for RNA preparation. Ascites specimens from pa-tients with EOC were collected under sterile conditionswith heparin added to 1 U/ml of ascites. These studieswere approved by the IRB of Temple University Hospi-tal. Patients with EOC who provided solid tumor or asci-tes specimens used in this study are shown in Table 1.

2.2. Peripheral blood mononuclear cells from normal

donors

Peripheral blood mononuclear cells (PBMC) fromnormal donors were used as a methodological controlin this study and were collected in heparinized collectiontubes (Becton–Dickinson, Franklin Lakes, NJ).

2.3. Preparation of single cell suspensions from ascitic

fluid

These were prepared as described previously [29].Ascitic fluid from patients with EOC was centrifugedat 800g for 10 min and the single cell suspension waswashed twice with Hank�s balanced salt solution (HBSS)and resuspended in HBSS to a concentration of 1–5 · 106 cells/ml. The cells were layered onto Ficoll–Hyp-aque (Pharmacia, Piscataway, NJ) density cushion andcentrifuged at 650g for 30 min at room temperature.The cell layer on top of the density cushion was washedtwice with PBS. CD3+ T cells accounted for55.4 ± 5.3% (mean ± SEM) of these cells [29,30].

Table 1Profiles of patients with EOC

Patient Agea Stage Grade Carcinoma type

OV29 53 IIIc 1 Mucinous cystadenocarcinomaOV31 72 IIIc 2 Papillary serous carcinomaOV32 67 Ia 1 Serous tumor of low malignant potentialOV36 75 IIIc 2 Papillary serous adenocarcinomaOV40 42 IIIc 1 Mucinous cystadenocarcinomaOV43 55 IIc 3 Clear cell carcinomaOV44 63 IIIc 2 Papillary serous adenocarcinomaOV45 63 IIIc 2 Serous tumorOV50 48 III 3 Mixed, predominantly serous

a At time of operation.

J. Pappas et al. / Cellular Immunology 234 (2005) 81–101 83

2.4. Preparation of PBMC from normal donors

PBMC from normal donors were isolated fromperipheral blood by centrifugation on Ficoll–Hypaquedensity cushion by established methods [21,22] and theywere used for RNA isolation either immediately or aftercryopreservation.

2.5. Histopathology and immunohistochemistry

Sections of 6 lm were prepared from OCT-embeddedsolid tumor specimens. Histopathological examinationwas carried out by standard procedures after stainingwith hematoxylin and eosin. Immunohistochemistrywas performed using the anti-CD3 mAb, clone NCL-CD3-PS1 (Novocastra, Newcastle upon Tyne, UK)and an isotype-matched non-specific mouse IgG as anegative control. The avidin–biotin complex (ABC)immunoperoxidase procedure (Vectastain Elite ABCkit; Vector Laboratories, Burlingame, CA) was carriedout as previously described [31]. The number of CD3+T cells versus the total number of cells was determinedin solid tumor specimens from six patients with EOC,in addition to those shown in Table 1, by manual count-ing which was carried out by qualified individuals at anoriginal magnification of 400·. Five high powered fieldswere counted per specimen (total cells counted1161 ± 162; mean ± SEM; range 834–1909 cells count-ed). The proportions of CD3+ T cells vs. total numberof cells in these specimens were 16.83 ± 2.93% (mean ±SEM; range 11–30%, n = 6).

2.6. Preparation of RNA

Total RNA was prepared from solid tumor speci-mens, single cell suspensions derived from malignantascites of patients with EOC, and PBMC from normaldonors by the guanidinium thiocyanate phenol–chloro-form extraction method using the Stratagene RNA iso-lation Kit (Stratagene, La Jolla, CA) according to themanufacturer�s instructions, as previously described[22–26]. The quality of the RNA was determined by

examining the 28S and 18S bands of the rRNA afteragarose gel electrophoresis.

2.7. Double stranded cDNA synthesis

cDNA was synthesized from oligo(dT)-NotI (Prome-ga, Madison, WI) primed total RNA by use of theSuperscript II (Gibco-BRL) cDNA synthesis kit withmodified manufacturer�s instructions, as previously de-scribed [22–26]. The double-stranded cDNA wasblunt-ended using T4 DNA polymerase in the last stepof cDNA synthesis to assume efficient adaptor ligation.

2.8. Non-palindromic adaptor PCR

Non-palindromic adaptor PCR (NPA-PCR) was car-ried out as previously described [22–26]. Briefly, double-stranded blunt ended cDNA (250 ng; usually 1:20 of thecDNA synthesized) was ligated with an equivalent mo-lar concentration of non-palindromic adaptors whichconsist of the two complimentary oligonucleotides,EcoRI–XmnI [d(ATTCGAACCCCTTCG)] and XmnIG (5 0-phosphorylated) [d(CGAAGGGGTTCG)] (Table2), which were pre-annealed to each other. Blunt endligation of cDNA and adaptor was performed by incu-bation at 16 �C overnight with T4 DNA ligase (1.2 U)and purified on a G50 column (Eppendorf-5 prime,Westburry, NY). Digestion with NotI restriction nucle-ase (20 U) of the ligated cDNA was carried out for 2 hat 37 �C to remove the ligated adaptor from the 3 0 endof the cDNA, while it remained in the 5 0 end. The digest-ed cDNA was purified on a G50 column and used as atemplate for two rounds of PCR in a 100 ll reaction.In the first amplification, the 5 0 amplification primerwas the adaptor primer and the 3 0 amplification primerwas a constant region primer, HCb3 (Table 2). In thesecond amplification, the adaptor primer was again the5 0 amplification primer and the 3 0 amplification primerwas another constant region primer, designated HCb2(Table 2), which is located 5 0 of the HCb3 primer, thatis to say closer to the CDR3 domain. This nested PCRdesign eliminates the possible amplification by NPA-

Table 2Primers used in PCR and hybridization

Primer Primer sequence (50–3 0)

Adaptor primer ATTCGAACCCCTTCGAnti-sense adaptorprimer

GCTTGGGGAAGC

Non-palindromicadaptor (NPA)

5 0ATTCGAACCCCTTCG3 0

3 0GCTTGGGGAAGC-(PO4)50

HCb3 CAGGCAGTATCTGGAGTCATTGAHCb2 ACCAGCTCAGCTCCACGTGGTCHCb1 TTCTGATGGCTCAAACACAGCGACCTC

Vb2 GGCCACATACGAGCAAGGCGTCGAVb3 GTCTCTAGAGAGAAGAAGGAGCGCVb6 TCTCAGGTGTGATCCAAATTCGGGVb13 CACTGCGGTGTACCCAGGATATGA


PCR of other members of the immunoglobulin super-gene family, that may share homology with b-chainTCR. It is unlikely that the same member of the immu-noglobulin supergene family will share substantial se-quence homology with the b-chain TCR at twodifferent sites (HCb2 and HCb3) (Table 2). Conditionsfor the NPA-PCR amplification were denaturation(94 �C, 45 s); annealing (45 �C, 45 s); and elongation(72 �C, 45 s), for the first round of 30 cycles of amplifi-cation; and denaturation (94 �C, 45 s); annealing(50 �C, 45 s); and elongation (72 �C, 45 s), for the secondround of 30 cycles of amplification. Both rounds ofamplification included a final incubation at 72 �C for10 min.

2.9. Vb-specific PCR amplification

b-chain TCR transcripts from tumor specimens frompatients with EOC were also amplified by Vb-specificPCR, which was carried out as previously described[22–26]. The Vb3, Vb6, and Vb13 families were selectedfor Vb-specific PCR amplification because they are rep-resentative, among the most frequently utilized Vb fam-ilies in the peripheral blood, and contain a large numberof subfamily members and alleles [16,17,32–35]. In theVb-specific PCR amplification experiments describedhere we amplified 100 ng of RNA equivalents (cDNA).Vb-specific PCR amplifications were carried out usingthe appropriate primers (Table 2). Conditions for theVb-specific PCR amplification were denaturation(94 �C, 1 min), annealing (60 �C, 1 min), and elongation(72 �C, 2 min), for 40 cycles of amplification; and a finalincubation at 72 �C for 10 min.

2.10. Cloning and sequencing of PCR products

Purified PCR products of the NPA-PCR or of theVb-specific PCR were cloned into the pCR2.1 plasmidvector (TA Cloning Kit, Invitrogen, Carlsbad, CA)and were transformed into DH5a competent cells

(Gibco-BRL) or one shot competent cells (Invitrogen)according to the manufacturer�s instructions. Briefly,competent cells were incubated with the vector on icefor 30–45 min and submitted to heat shock at 42 �Cfor 30–45 s. After a brief incubation on ice for 2 min,the competent cells were incubated in 250 ll of SOCmedium (consisting of 20 g bacto-tryptone, 5 g bacto-yeast extract, 0.5 g NaCl, 2.5 M KCl, 0.1 M MgCl2,and 20 mM glucose) at 37 �C for 1 h and plated ontoX-gal containing agar plates. After overnight growth,the white colonies were screened for the presence ofTCR cDNA by hybridization with 32P-labeled HCb1(located 5 0 to HCb2; Table 2). Randomly isolatedhybridization positive colonies were grown overnightin Luria–Bertani broth (bacto-tryptone yeast extract,Fisher Scientific) followed by plasmid purification usingWizard Miniprep DNA Purification System (Promega)according to manufacturer�s instructions. Plasmids weresequenced on a 6% polyacrylamide DNA sequencing gelusing the ABI 373A DNA Sequencer (Applied Biosys-tems, Foster City, CA), with the exception of those frompatients OV50 and OV29 (Vb13 clones), which were se-quenced by the dideoxy chain termination method usingSequenase 2.0 (USB, Cleveland, OH). Large numbers ofwhite colonies were obtained after NPA-PCR amplifica-tion [21] or after each one of the Vb-specific PCR ampli-fications followed by cloning. The number of TCRclones obtained after NPA-PCR is comparable to thoseobtained after each Vb-specific PCR amplification.

The maximum theoretical number of unique b-chainTCR transcripts has been estimated to be in the range of1012 [16]. Based on this number, the probability of ran-domly finding two identical copies of a single b-chainTCR transcript within an independent sample popula-tion is practically negligible. The transformation of theEscherichia coli competent cells involves subjecting theplasmid/cell mixture to heat shock (at 42 �C for 30–45 s) followed by incubation on ice for 2 min and growthfor 60 minutes in SOC media at 37 �C before plating.Since under ideal growth conditions (log phase), E. colihas a doubling time of 20 min [36], and the possibilityexists that two doublings could occur within this 60-min period, although the stress of the heat shock shouldpreclude the competent cells from entering log phase be-fore plating. However, it is theoretically possible for afew of the transformed cells to double during this time,resulting in the presence of two E. coli cells with identi-cal TCR inserts. Therefore, identical TCR sequencesfrom two different colonies (a doublet) may indicate aclonal expansion or could be a result from a singly trans-fected E. coli cell that doubled before plating.

2.11. Computer analysis and comparison of sequences

b-chain TCR transcripts encoding the V (variable), D(diversity), J (junctional), and C (constant) regions


found in each specimen and controls were compared tothose in GenBank and EMBL Data bases using theBLAST sequence alignment program [37]. The sequenceof the N–D–N region of each TCR transcript was definedas the nucleotide sequence between the last homologousVb nucleotide and the first discernible nucleotide of Jb.

2.12. Statistical analysis

This was carried out using the binomial distribution,as previously described [26,27,38].

3. Results

To determine whether tumor specimens from patientswith EOC contain monoclonal/oligoclonal populationsof T lymphocytes, we amplified by NPA-PCR and/orVb-specific PCR, b-chain TCR transcripts from solidtumor specimens ormalignant ascites from these patients.The amplified transcripts were subsequently cloned. Se-quence analysis revealed substantial proportions of iden-tical b-chain TCR transcripts in tumor specimens fromseven out of nine patients with EOC, demonstrating thepresence of oligoclonal populations of T cells. These re-sults are shown in Table 3 (b-chain TCR transcriptsamplified by NPA-PCR) and Table 4 (b-chain TCR tran-scripts amplified by Vb-specific PCR).

Sequence analysis after NPA-PCR amplification andcloning of b-chain TCR transcripts from a solid tumorspecimen from patient OV36 revealed that 14 of 18(78%) of the b-chain TCR transcripts sequenced wereidentical to each other (clone ov36t09, Vb3.1Db1.1Jb2.7; CDR3: CASSSPIQGTYEQYF) (Table 3). Thisclonal expansion was statistically significant (Table 3),as determined by the binomial distribution, which wasused to calculate the probability, p, of the fraction of ob-served multiple identical transcripts (i.e., 14/18 in cloneov36t09, Table 3), versus the alternative hypothesis thateach b-chain TCR transcript is unique when comparedto each other and is expressed only once, 1/n = 1/18,or versus a second alternative hypothesis that all b-chainTCR transcripts are expressed once, with the exceptionof a single TCR transcript that is expressed twice (2/n = 2/18). These two alternative hypotheses were devel-oped using PBMC from normal donors as controls. Wehave sequenced more than 300 b-chain TCR transcriptsfrom PBMC of normal donors after amplification byeither NPA-PCR or by Vb-specific PCR and cloning,and with the exception of five b-chain TCR transcriptswhich appeared in duplicate, all others are unique, whencompared to each other (Table 5; and [21–27]). Theappearance of a single TCR transcript twice may indi-cate a clonal expansion or could be the result of a singlytransfected E. coli that was doubled before plating (seeSection 2).

To confirm that clone ov36t09 was clonally expandedin tumor OV36, we used Vb3-specific PCR followed bycloning and sequencing. Vb3-specific PCR amplificationwas carried out on single-stranded cDNA prepared fromthe same RNA that was used as a template for the NPA-PCR. We used a Vb3-specific primer and a Cb primer(Table 2). Sequence analysis after Vb3-specific PCRand cloning revealed a clonally expanded b-chain TCRtranscript (clone 36tvb301; Vb3.1Db1.1Jb2.7; CDR3:CASSSPIQGTYEQ) (Table 3) that was identical to theone that was clonally expanded in the OV36 tumor afterNPA-PCR, cloning and sequencing (clone ov36t09,Vb3.1Db1.1Jb2.7; CDR3: CASSSPIQGT YEQ) (Table3). These results demonstrate that this transcript is in-deed clonally expanded in the OV36 tumor.

Sequence analysis after NPA-PCR and cloning ofb-chain TCR transcripts from themalignant ascites of pa-tient OV50 revealed that clone OV50-1, Vb5.3Db2.1Jb2.2; CDR3: ASSLEPNTGE accounted for 13 of 20(65%) of the b-chain TCR transcripts sequenced (p <0.0001) (Table 3). Sequence analysis after NPA-PCRand cloning of b-chain TCR transcripts from the malig-nant ascites of patientOV31 revealed that two cloneswerepresent in triplicate (3 of 12; 25%) (p = 0.058) (Table 3).Sequence analysis afterNPA-PCRand cloning of b-chainTCR transcripts from solid tumor from patient OV32 didnot reveal any clonal expansions (Table 3).

Vb-specific PCR amplification, followed by cloningand sequencing of b-chain TCR transcripts from tumorspecimens from patients with EOC is shown in Table 4.The three Vb families were arbitrarily selected for thesestudies, however, they were among the most frequentlyused in the peripheral blood and among those thatcontain the largest number of subfamily members andalleles [16,17,32–35].

Sequence analysis of b-chain TCR transcripts from asolid tumor specimen from patient OV29, after Vb13-specific PCR and cloning, revealed that cloneBO29T13.13, Vb13.6Db2.1Jb2.1; CDR3: CASTSAGGSYNE accounted for 4 of 24 (17%) of the b-chain TCRtranscripts sequenced (Table 4). We used the binomialdistribution to calculate the p of the fraction of the ob-served multiple identical transcripts, 4/24 in cloneBO29T13.13 (Table 4), versus the alternative hypothesesthat either: (i) each Vb13 TCR transcript is unique whencompared to each other and is expressed only once, 1/n = 1/24; or (ii) all Vb13 transcripts are expressed onlyonce, except of a single Vb13 transcript expressed twice,2/n = 2/24. These two alternative hypotheses weredeveloped on the basis of results obtained by Vb13 spe-cific PCR amplification followed by cloning andsequencing of TCR transcripts from PBMC from nor-mal donors. Unique Vb13 TCR transcripts when com-pared to each other were obtained, typical ofpolyclonal populations of T cells, with the exceptionof one clone which appeared twice (Table 5). Similar

Table 3Sequence analysis of b-chain TCR transcripts (CDR3 region) expressed in tumor specimens from patients with EOC after NPA-PCR amplificationand cloning


Table 3 (continued)


results were obtained with PBMC from a second normaldonor [25]. This BO29T13.13 Vb13 clonal expansionwas statistically significant for one hypothesis(p = 0.0137) (Table 4).

Vb3-specific PCR followed by cloning and sequencingrevealed in a solid tumor specimen from patient OV29 aclonal expansion (clone BO29T3.1; Vb3.1Db1.1Jb2.4;CDR3: CASSLERRAKNIQYF), which accounted for6 of 16 (38%) of the b-chain TCR transcripts sequenced(p = 0.0003) (Table 4). The binomial distribution wasused for statistical analysis. Vb3-specific PCR followedby cloning and sequencing of TCR transcripts fromPBMC from normal donors revealed unique Vb3 TCRtranscripts when compared to each other, typical of poly-clonal populations of T cells, with the exception of twoclones which appeared twice (Table 5).

A Vb6 clonal expansion (clone BO29T6.1;Vb6.4Db1.1Jb2.7, CDR3: CASSGWGVGEQYF) wasidentified in a solid tumor specimen from patient OV29,after Vb6-specific PCR followed by cloning and sequenc-ing (p < 0.0001) (Table 4). This clonal expansion account-ed for 18 of 25 (72%) of the transcripts sequenced. Thebinomial distribution was used for statistical analysis.Vb6 specific PCR followed by cloning and sequencingof TCR transcripts from PBMC from a normal donor re-vealed unique Vb6 transcripts when compared to eachother, typical of polyclonal populations, with the excep-tion of one clone which appeared twice (Table 5).

In a solid tumor specimen from patient OV40 withEOC the following clonal expansions were identified,after Vb13-specific PCR amplification, cloning, andsequencing (Table 4): (i) clone BO40T13.1,Vb13.6Db1.1Jb1.6; CDR3: CASTPAGGVFSPL, whichaccounted for 11 of 23 (48%) of the b-chain TCR tran-scripts sequenced (p < 0.0001); (ii) clone BO40T13.10,Vb13.1 Db2.1 Jb2.1; CDR3: CASSYAGVGNEQ, which

accounted for 5 of 23 (22%) of the TCR transcripts se-quenced (p < 0.0024); (iii) clone BO40T13.2 was presentin three copies, but the statistical significance of this clon-al expansion was ‘‘marginal’’ (p < 0.06; Table 4).

Several clonal expansions were observed in a solid tu-mor specimen from patient OV43 with EOC after Vb13-specific PCR, cloning and sequencing. Clone BO43T13.1, Vb13.2Db1.1Jb2.7 CDR3: CASSQGP TQQYF,and clone BO43T13.2, Vb13.2Db2.1 Jb2.2, CDR3: CAS-SYSS TGELFF, each accounted for 6 of 23 (26%) of theb-chain TCR transcripts sequenced (Table 4). These twoclonal expansions are statistically significant (Table 4).Another b-chain TCR clone BO43T13.5, Vb13.1Db1.1Jb2.7, CDR3: CASSYSRTASHYEQ, accountedfor 5 of 23 (22%) of the b-chain TCR transcripts se-quenced (p < 0.0024) (Table 4). Clone BO43T13.3,Vb13.1Db1.1Jb2.6, CDR3: CASSSQVRQSPLHF, waspresent in triplicate (p = 0.059) (Table 4).

Sequencing analysis of b-chain TCR transcripts froma solid tumor specimen from patient OV44 with EOCafter Vb13-specific PCR amplification and cloning, re-vealed a rather heterogeneous T-cell repertoire (Table4). Clone BO44T13.8, Vb13.1Db2.1Jb2.6 CDR3: CASS-PT-DNIQ, was present in triplicate (3 of 23; 12%)(p = 0.06) (Table 4).

A Vb3 clonal expansion (clone BO44T3.2;Vb3.1Db1.1Jb1.6, CDR3: LCASRPGLLGSP LH),was identified in a solid tumor specimen from patientOV44 with EOC, after Vb3-specific PCR amplificationfollowed by cloning and sequencing (Table 4). CloneBO44T3.2 accounted for 6 of 22 (27%) of the b-chainTCR transcripts sequenced (p = 0.0003) (Table 4).

Vb6-specific PCR amplification followed by cloningand sequencing revealed a clonally expanded TCR tran-script (Table 4). Clone BO44T6.5; Vb6.2Db1.1Jb2.7,CDR3: CASSLEVAQGWYEQY was identified in a sol-

Table 4Sequence analysis of b-chain TCR transcripts (CDR3 Region) expressed in tumor specimens from patients with EOC after Vb-specific PCRamplification and cloning


Table 4 (continued)

(continued on next page)


Table 4 (continued)


Table 4 (continued)

NS, not significant.


id tumor specimen from patient OV44 and accountedfor 12 of 28 (43%) of the b-chain TCR transcripts se-quenced (p < 0.0001) (Table 4).

Sequencing analysis of b-chain TCR transcripts from asolid tumor specimen from patient OV45 after Vb5-spe-cific PCR amplification and cloning, revealed a strongclonal expansion (clone 45-2, Vb5.1Db1.1Jb2.1, CDR3:CASSQAETEQFF (p < 0.0001) (Table 4)which account-ed for 8 of 31 (25.8%) of the b-chain TCR transcripts se-quenced. Another prominent clonal expansion wasidentified in the same solid tumor specimen from patientOV45 after Vb8-specific PCR amplification, cloning,and sequencing and accounted for 21 of 27 b-chainTCR transcripts sequenced (clone 45-5; Vb8.2Db2.1Jb2.2, CDR3: CASSLYGEL) (p < 0.00001) (Table 4).

These results demonstrate that TIL in solid tumor ormalignant ascites from seven out of nine patients withEOC contain substantial proportions of monoclonal/oligoclonal T cells. Clonally expanded T cells can be de-rived only by specific-antigen driven activation, prolifer-ation, and clonal expansions in vivo, at the site of thetumor, in response to tumor antigens.

When two amplification cycles of TCR transcriptsusing two different pairs of primers are carried out, it istheoretically possible that erroneous results may be ob-tained, resembling the clonal expansions shown in Tables3 and 4. It is possible that each pair of TCR primers willamplify transcripts from a very small number of T cells,resulting in such an artifact. We have demonstrated thatindeed this is not the case here and that our results rep-resent true monoclonal/oligoclonal expansions of T cells.We used PBMC from normal donors as a methodologi-cal control, to address in a series of experiments these is-sues [25,27]. We prepared cell mixtures containingvarious proportions of PBMC from normal donors andcells from the ovarian tumor line CAOV3, which doesnot express b-chain TCR transcripts, totaling 1 · 106

cells [25,27]. RNA was isolated from cell mixtures con-taining 6 and 0.6% T cells, as described under Section2. Fifty nanograms of RNA from each mixture was used

for NPA-PCR amplification, cloning, and sequencing.Sequence analysis revealed that the 6 and the 0.6% mix-tures were comprised entirely of unique transcripts whencompared to each other, typical of polyclonal popula-tions of T cells [25,27]. Following the commonly accept-ed value that 50,000 cells are needed to obtain 50 ng ofRNA, these two mixtures contained TCR transcripts de-rived from 3000 and 300 T cells, respectively.

Immunohistochemical staining using an anti-CD3mAb revealed that CD3+ T cells in solid tumor EOCspecimens were 16.83 ± 2.93% (mean ± SEM; range11–30%, n = 6; see Section 2). In the NPA-PCR ampli-fication experiments of b-chain TCR transcripts frompatients with EOC 250 ng of RNA was used. To preparethis amount of RNA 250,000 total cells are needed,16.83% of which are CD3+ T cells, or 42,075 CD3+ Tcells. These numbers of T cells are considerably higherthan those used in our control experiments, i.e., 3000and 300 T cells. Therefore, the clonal expansions thatwe observed after NPA-PCR, cloning and sequencing(Table 3) are true monoclonal/oligoclonal expansionsof T cells, and are not due to either PCR artifacts orto the presence of too few T cells in the specimens.

Additional control experiments were carried outregarding the Vb-specific amplification, cloning, andsequencing experiments of TCR transcripts from pa-tients with EOC. Three mixtures of cells from CAOV3and PBMC from a normal donor were prepared (totalcells 1 · 106) and each contained, respectively, 6, 2.5,and 0.6% T cells [25,27]. Fifty nanograms of RNA pre-pared from these three mixtures containing 3000, 1250,and 300 T cells, respectively, was amplified by Vb2-spe-cific PCR, followed by cloning and sequencing. The Vb2family was selected as a representative Vb family [39–42]. Vb2+ T cells account for 8% of T cells in PBMC.The number of Vb2+ T cells in the three mixtures was240, 100, and 24 cells, respectively. Sequence analysisafter PCR and cloning from the first two mixturesrevealed unique transcripts when compared to eachother, typical of polyclonal populations of T cells

Table 5Sequence analysis of b-chain TCR transcripts (CDR3 region) expressed in PBMC from normal donors after Vb-specific PCR amplification andcloning



Table 5 (continued)


Table 6CDR3 epitopes of b-chain TCR transcripts conserved in tumor specimens for patients with EOCa

CDR3motif

Patients NormalPBMCOV36 OV50 OV31 OV32 OV29 OV40 OV43 OV44 OV45

GT 25/34 (74%) 0 2/12 (17%) 1/18 (6%) 4/65 (6%) 1/23 (2%) 1/23 (2%) 8/73 (11%) 0 18/139 (13%)QG 26/34 (74%) 0 1/12 (8%) 7/18 (39%) 3/65 (5%) 0 6/23 (3%) 19/73 (26%) 5/58 (9%) 8/139 (6%)GS 0 3/20 (15%) 3/12 (25%) 0 7/65 (11%) 0 0 14/73 (19%) 2/58 (3%) 13/139 (9%)GG 0 0 4/12 (30%) 6/18 (33%) 13/65 (20%) 11/23 (48%) 2/23 (9%) 8/73 (11%) 3/58 (5%) 15/139 (11%)GV 0 0 0 1/18 (6%) 20/65 (31%) 19/23 (83%) 0 2/73 (3%) 3/58 (5%) 5/139 (4%)VG 0 0 0 0 18/65 (28%) 5/23 (22%) 0 2/73 (3%) 0 2/139 (1.5%)AG 0 5/20 (25%) 0 1/18 (6%) 7/65 (11%) 16/23 (70%) 0 6/73 (8%) 12/58 (21%) 18/139 (13%)LY 0 0 1/12 (8%) 0 1/65 (2%) 0 0 0 21/58 (36%) 0

a b-chain TCR transcripts were amplified by NPA-PCR or Vb-specific PCR followed by cloning and sequencing. Results from PBMC from normaldonors include, in addition to results shown in Table 5, certain results shown in [25,27].


[25,27]. Sequence analysis of the specimen containing 24Vb2+ T cells revealed a restricted pattern of expressionresembling clonally expanded T cells. In the Vb-specificPCR amplification experiments described here we used100 ng of RNA equivalents (cDNA) which was obtainedfrom 100,000 total cells. Immunostaining experimentshave shown that 16.83% of the cells in solid tumor spec-imens are CD3+ T cells. Therefore, CD3+ T-cellsaccounted for 16,830 of the cells in the mixture. Of these16,830 CD3+ T cells [32–35]: (i) 11% were Vb13+ (1851cells); (ii) 11% were Vb6+ (1851 cells); (iii) 4.5% wereVb3+ (757 cells). These cell numbers are clearly abovethose used in our control experiments (240 and 100 Tcells, see above) that yielded polyclonal populations ofT cells after Vb-specific PCR [25,27]. These results dem-onstrate that the clonal expansions shown in Table 4 aretrue clonal expansions and are not due to PCR artifactsor to the presence of very few T cells.

We have identified in this study prominent clonalexpansions of b-chain TCR transcripts restricted to tu-mor specimens from individual patients with EOC.Identical b-chain TCR transcripts were not found in dif-ferent patients, however, high proportions of identicalCDR3 motifs were evident within individual patientsand between different patients (Table 6). SeveralCDR3 motifs are utilized in high proportions in tumorspecimens from two or more patients.

Comparison of the nucleic acid and the deduced ami-no acid sequences of the b-chain TCR transcripts iden-tified in this study to those in the GenBank/EMBL/SWISS PROT databases revealed that all sequencesidentified here are novel and typical of b-chain TCR.However, several b-chain TCR transcripts identified intumor specimens from patients with EOC exhibited sub-stantial CDR3 homology to TCR sequences previouslyreported in the GenBank (Table 7).

4. Discussion

We report here the presence of monoclonal/oligoclo-nal populations of T cells in solid tumor specimens or

malignant ascites from patients with EOC. We amplifiedusing NPA-PCR and/or Vb-specific PCR [21–29]b-chain TCR transcripts from these specimens. Theamplified transcripts were cloned and sequenced.Sequence analysis revealed the presence of substantialproportions of identical b-chain TCR transcripts thatwere statistically significant in tumor specimens fromseven of nine patients (Tables 3 and 4). Because of thevery large size of the TCR repertoire (see Section 1)[16–20], the probability of finding by chance multipleidentical copies of TCR transcript within an indepen-dent sample of T cells is negligible. Multiple identicalcopies of TCR transcripts can be derived only by specificantigen-driven activation, proliferation, and clonalexpansion of the T-cell clones which recognize theseantigens. These clonal expansions may have taken placein situ in the tumor, in response to as yet unidentified tu-mor antigen(s). These results demonstrate that T cellsinfiltrating solid tumor specimens or malignant ascitesof patients with EOC contain monoclonal/oligoclonalpopulations of T cells.

T cells recognize through their ab TCR small pep-tides derived from endogenous or exogenous antigens,in association, in general, with MHC class I or II (re-viewed in [64]). In contrast, at least certain cells express-ing the cd TCR recognize whole proteins in a mannerindependent of MHC [65,66]. In addition, certain T cellsexpressing either ab TCR or cd TCR recognize in anMHC-independent manner, lipids, carbohydrates, gly-colipids, and other ligands [67–71]. T cells are comprisedof large number of different T-cell clones, each express-ing a different TCR molecule, which serves as a uniquefingerprint of the T-cell clone [16–19]. The T-cell reper-toire is acquired in the thymus, where bone marrow-de-rived precursor thymocytes express unique TCR whencompared to each other. These TCR are highly poly-morphic molecules and are generated by several diversi-ty mechanisms including somatic recombination of thevarious TCR gene segments, imprecise joining, junction-al diversity, and pairing of the TCR chains [16–19].Although the maximum theoretical number of differentab TCR may be in the order of 1018 [16,18,19] and the

Table 7CDR3 homologies of b-chain TCR transcripts in patients with EOC with sequences in the GenBank/EMBL/SwissProt databasesd

Patient Clone CDR3 CDR3 sequence(this study)

Homologous (database) Source Reference

OV36 ov36t07 CASSQAGEETQYFGP CASSFAGEETQYFGP Normal donor PBMC [43]CASSKQGEETQYFGP Spinal cord lesions of HAM/TSPe [44]

ov36t11a CASSQDSSGYNEQFFGP CASSQDSGGYNEQFFGP Muscle-infiltrating T cells [45]CASSQDTSSYNEQFFGP vSAG9e stimulated PBMC [46]CASSQDSTVYNEQFFGP Ankylosing spondylitis patient [47]

OV31 ov31a10 CAMSPGTGLPATNEKL CAISPGTGLPATNEKL Normal donor PBMC [22]ov31ab12 CASSLGMGPYEQYFG CASSLGLAGPYEQYFG T cells non-Hodgkin�s lymphoma [48]

OV32 ov32t14 CASSLVSGTEAFF CASSLVGAGTEAFF HLA-Be2703 autoreactive CTL [49]ov32t07 CSSLGGQGYGYTF CASSGGQGYGYTF MS brain lesion [50]

OV29 bo29t13.20 CASSSPTSTYEQY CASSSRSSYEQY HLA-A0201-restricted influenza A CTL [51]bo29t13.3 CASRSGGDYEQY CASRSSGGIYEQY MBP-specific clone from an MS patient [52]bo29t13.4 ASSYSDRTLSYEQ SDRGLSYEQ Human T-lymphocyte a

bo29t13.8 ASSYDSSYEQ SSIDSSYEQ Synovial T cells from patient with RA [53]bo29t13.9 CASRTGGSEAFF CASSTGGTEAFF Synovial T cells b

CASRTGLTEAFF HIV-1 infected pediatric patient (PBMC) [54]bo29t3.9 LCASSLGSSADTQY CASSLGSNSDTQY Synovial T cell from reactive arthritis [55]bo29t6.16 LCASSLGQAYEQY LCASSLGQAYEQY Anti-EBV TCR [56]

LCASSLGQGAYEQY HIV-1 infected pediatric patient (PBMC) [54]LCASSLGAEAYEQY T cell from PBL from CBD patiente [57]

bo29t6.15 LCASSLGRAYEQY LCASSLDRAYEQY HIV-1 infected pediatric patient (PBMC) [54]LCASSLGQAYEQY Anti-EBV TCR [56]LCASSLGQGAYEQY HIV-1 infected pediatric patient (PBMC) [54]LCASSLGQGAYEQY T cell clone from MS patient [58]LCASSLGSYEQY T cells non-Hodgkin�s lymphoma [48]

OV43 bo43t13.2 CASSYSSTGELFF CASSYTSEGELFF HIV-1 infected pediatric patient (PBMC) [54]CASSDSTTGELFF Normal donor PBMC [22]

OV44 bo44t13.4 CASSTGTLTDTQYF CASSPGTVTDTQYF Intestinal mucosa T cells from ulcerative colitis [59]bo44t13.13 CASSFVGSTDTQYF CASSFIGGTDTQYF Anti-Melan-A/MART-1 CTL [60]bo44t3.3 LCASSNPIPSNQP LCASSNLPSN T cells non-Hodgkin�s lymphoma [48]bo44t3.14 LCASSLTGGRYEQY CASSLTGGTYEQY Coronary artery from patient with GA [23]bo44t3.15 LCASSLSGQGSE LCASSLSTQGTE T cells non-Hodgkin�s lymphoma [48]bo44t3.16 LCASSLAGSGNT LCASSLGGTGNT snRNP-reactive T-cells c

bo44t3.22 LCASSHLAGVTGEL LCASSQLAGVTGEL Muscle-infiltrating T cells [45]LCASSQLAGVTGEL Synovial T cells from RA [61]

bo44t3.23 LCASSLWGAEAFF LCASSLYGAEAFF Normal donor PBMC [22]bo44t6.21 RCASSMGPNYEQY CASSMGGSYEQY HLA-A0201-restricted influenza A CTL [51]bo44t6.8 RCASSSGPNYEQY CASSSGPTYEQY GvH T cells [62]

CASSSGDYEQY T cells from BAL from CBDe [57]bo44t6.28 RCASSVGPNYEQY CASSVGQDYEQY T cells non-Hodgkin�s lymphoma [48]

OV45 45-35 CASSLYGELFFGE CASSLTGELFFGE Normal donor PBL [63]

a B.J. Manfras, GenBank Accession No.: AAC97316.b M.A. Trevino, E. Teixeiro, and R. Bragado, GenBank Accession No.: AAN78481.c B.L. Talken, M.-M. Holyst, and R.W. Hoffman, GenBank Accession No.: AAB63916.d The comparisons shown in this Table reflect at maximum one conservative base substitution and one non-conservative base substitution in the

CDR3 region of the b-chain TCR clones from tumor specimens from patients with EOC sequenced in this study versus to those already reported inthe GenBank/EMBL/SwissProt databases.e HAM/TSP: HTLV-1-associated myelopathy/tropical spastic paraparesis, VSAG9: viral superantigen 9, BAL: broncho alveolar lavage, CBD:

chronic beryllium disease, GA: graft arteriosclerosis, snRNP: small nuclear ribonucleoprotein, RA: rheumatoid arthritis, GvH: graft vs. host disease.


maximum theoretical number of b-chain TCR tran-scripts in the order of 1012 [16], most of the thymocytesare eliminated in the thymus by negative or positiveselection. Only a small proportion (3–5%) of thymocytessurvive to became post-thymic mature T lymphocytes,which brings the actual number of T cells at the levelof 1011 to 1012 [19,20]. It is estimated that 106 differentb-chain TCR transcripts are expressed in peripheralblood T cells of normal donors, and each one is pairing,on the average, with at least 25 different a-chains [20]. In

any event, these numbers of different T-cell clones arestill very large and clearly sufficient to recognize anyconceivable antigenic epitope. Therefore, the probabilityof finding by chance multiple identical copies (two ormore) of a particular b-chain TCR transcript withinan independent sample of T cells is negligible. Theappearance of multiple identical copies of one or fewb-chain TCR transcripts would be the result of specificantigen-driven proliferation and clonal expansion ofthe T-cell clones that recognize this antigen.


T cells are undergoing activation and proliferationeither in response to specific antigens (antigen-drivenor antigen-dependent proliferation) or in response tonon-specific stimulatory agents (antigen-independentproliferation), such as chemokines, mitogens or super-antigens. Activation and proliferation in response tochemokines or mitogens will result in proliferation of ahighly heterogeneous population comprised of manydifferent T-cell clones (polyclonal T cells) expressing un-ique transcripts when compared to each other. Activa-tion and proliferation in response to superantigens willalso result in proliferation of many different T-cellclones (polyclonal T cells). The TCR transcripts of thesesuperantigen-responding T cells will utilize b-chain TCRtranscripts comprised of a restricted number of Vb genesegments and unique CDR3 regions. These TCR tran-scripts will be unique when compared to each other.

In contrast, specific antigen-driven activation andproliferation of T cells would result in clonal expansionof only those T-cell clones that recognize the specificantigen. Therefore, a specific-antigen driven T-cell re-sponse elicits monoclonal/oligoclonal T-cell expan-sion(s), identified by the presence of multiple identicalTCR transcripts. The presence of clonally expandedTCR transcripts in EOC tumors demonstrate that thesetumors are immunogenic and elicit antigen-specificT-cell responses in vivo. This specific anti-tumor re-sponse appears to be suppressed by regulatory T cells(Treg) or suppressor T cells primarily of theCD4+CD25+ phenotype [72]. These Treg cells havebeen reported previously to play a role in autoimmunity,transplantation, and tumor immunology, includinglung, breast, pancreatic, and ovarian tumors [72–75].These Treg inhibited in vitro proliferative responses,cytokine production, and the cytolytic activity of autol-ogous T cells that were stimulated with dendritic T cellspulsed with the appropriate peptides [75]. CD4+CD25+Treg cells are attracted to the tumor site through theCCL22 chemokine, which is produced by tumor cellsand macrophages [75]. After activation these suppressorT cells exhibit antigen-non-specific suppressor activity invitro [76], that may be mediated through the productionof immunosuppressive cytokines, including IL-10and TGF-b. In addition, we have identified in themalignant ascites of patients with EOC an IL-10-pro-ducing HLA-DR-, CD25-negative subset of monocytes(CD14+CD16+CD54+). IL-10-producing monocytescultured with autologous peripheral blood T cells inhib-ited their proliferation in response to polyclonal activa-tion [77]. This inhibition of T-cell proliferation wasreversed by the addition of neutralizing antibodies spe-cific for the IL-10 receptor and for TGF-b2 [77]. It wouldbe of interest to amplify, clone and sequence, using theapproaches employed in this study, b-chain TCR tran-scripts expressed on purified CD4+CD25+FoxP3+ Tcells isolated from solid tumor specimens or malignant

ascites of patients with EOC, to examine whether theyare clonally expanded and to compare them with the b-chain TCR transcripts utilized by purified CD4+CD25�or CD8+ T cells from the same patients. Autoantibodiesare also present in patients with EOC [78]. Identificationof clonally expanded TCR transcripts in EOC tumorsmay permit the identification of the tumor antigens thatare responsible for eliciting these immune responses invivo. These antigens may be more suitable candidatesfor the development of tumor vaccines than others thatmay not elicit immune responses in vivo.

To determine whether monoclonal/oligoclonal T cellsare present in tumor specimens from patients with EOC,we employed NPA-PCR amplification or Vb-specificPCR amplification, followed by cloning and sequencing.The NPA-PCRmethod has been previously developed inour laboratory for the amplification of transcripts withunknown or variable 5 0 end, such as the TCR and Igs[21–28], and has certain distinct advantages over classi-cal PCR techniques. The major advantage is that onlyone amplification is needed for each of the a-chain orof the b-chain TCR transcripts [21–28]. Amplificationby V-specific PCR requires separate PCR amplificationsfor each one of the 32 Va and 26 Vb families, to which allknown human Va and Vb segments have been classified[17,39–42]. Using either one of the two different PCRamplification methods followed by cloning and sequenc-ing we demonstrated that monoclonal/oligoclonal T cellsare present in tumor specimens from patients with EOC.These studies were carried out with the objective todetermine whether b-chain TCR clonal expansions arepresent in T cells infiltrating EOC tumors. These studieswere not aimed in identifying all the b-chain TCR clonalexpansions that may be present in these EOC tumors.However, when used in the same specimen the two inde-pendent PCR amplification methods followed by cloningand sequencing yielded identical results, because theclonally expanded b-chain TCR transcripts identifiedafter NPA-PCR amplification were identical to the clon-ally expanded b-chain TCR transcripts identified afterthe corresponding Vb-specific PCR amplification. Thisis shown here in patient OV36 where the two amplifica-tion methods identified the same clonal expansion (Table3) and with clonally expanded b-chain TCR transcriptsexpressed in endomyocardial biopsies ([22,26] and Plat-soucas, Lin, Singhal, Slachta, Jeevanandam, and Oles-zak, unpublished results) and in coronary arteries[22,26] of cardiac allografts from patients with chronicrejection, in skin biopsies from patients with systemicsclerosis of recent onset [25], in the brain of pediatricpatients with AIDS [27], in glioblastoma multiformetumors [28], and in lesions from patients with abdominalaortic aneurismal disease (Lu, White, Lin, Solomides,Oleszak, and Platsoucas, manuscript in preparation).

The presence of clonally expanded T cells has beenwell documented in tumor specimens from patients with


melanoma [79–83], non-small cell lung carcinoma[84,85], brain tumors [28,86], and other cancers (reviewedin [1]). In general, these clonal expansions were not foundin PBMC of these patients. However, very limited infor-mation is available for T cells infiltrating EOC tumors.Results from only one patient with EOC are reported[87] using spectratyping, suggesting identical TCR clonesin TIL and PBMC from this patient. Obviously, studieswith additional patients are needed to determine whetheroligoclonal T cells are present in tumor specimens frompatients with EOC. This issue is addressed in this study.The presence of oligoclonal T cells in TIL from patientswith EOC strongly suggests the presence of a T-cell re-sponse against the tumor. TIL are very different fromPBMC [88] and contain activated and clonally expandedT cells. Along these lines, TIL-derived T-cell lines can beexpanded in low concentrations (e.g., 20 IU/ml) of re-combinant IL-2 to several thousand fold without theneed for antigenic stimulation [29,88]. These TIL-derivedrIL-2-dependent T-cell lines have been used in clinicaltrials for treatment of patients with ovarian carcinoma[30], or malignant melanoma [89,90].

Tumor antigens have been identified in human andmouse tumors, on the basis of their ability to elicitMHC-restricted T-cell responses (reviewed in [1]). Tu-mor antigens of the MAGE family [91,92] were identi-fied initially in melanoma and they are expressed alsoin EOC and other tumors [93–98]. These tumor antigensare not expressed on normal tissues except testis [91,92]and possibly placenta [96] and are known as cancer testisantigens. These tumor antigens are expressed only on aproportion of EOC tumors. MAGE-1 is expressed on 7–55%, MAGE-2 on 9%, MAGE-3/6 on 19–30%, MAGE-4a/4b on 7–57%, BAGE on 63%, GAGE on 30%, andNY-ESO-1 on 19–43% of the EOC tumors examined[93–98]. While expressed on individual tumors, these tu-mor antigens are not expressed on all tumor cells [97].

Another tumor antigen expressed on EOC is theher-2/neu proto-oncogene, which is expressed on manynormal and malignant cells [99,100]. Her-2/neu is over-expressed in 10–30% of patients with EOC [101] and in20–30% of patients with breast cancer [101]. Cytotoxicand helper T-cell responses specific for her-2/neu-MHC epitopes and anti-her-2/neu antibodies have beenobserved in these patients [102,103]. However, certainher-2/neu peptides may not be expressed on tumor cells.Immunization with the HLA-A2-restricted her-2/neupeptide p369–377 of HLA-A2+ patients with ovarian,breast or colorectal tumors, overexpressing her-2/neu,induced peptide specific CTL. However, these CTL didnot recognize the her-2/neu+ tumor cells of these pa-tients [104]. In the remaining 70–90% of patients withEOC or breast cancer which do not overexpress her-2/neu, it is not known whether her-2/neu peptides are ex-pressed (in association with MHC, in density sufficientto be detected by anti-her-2/neu CTL).

Lineage-specific tumor antigens have not been identi-fied on tumor cells from patients with EOC. These typesof antigens have been identified in malignant melanomas(reviewed in [1]). The advantage of these lineage-specifictumor antigens is that they are expressed, in general, onall tumor cells. It remains to identify the antigens that elic-it the clonal expansions found in this study, and to deter-mine whether they are lineage specific tumor antigens.

Acknowledgments

This work was supported in part by Grant RO1CA57884 from the National Institutes of Health andby a grant from the Commonwealth of Pennsylvania,Health Research Formula Fund Award. We thank Dr.Rodriquez-Villanueva for help with the processing ofone of the ovarian tumor specimens.

References

[1] C.D. Platsoucas, J.E. Fincke, J. Pappas, W.-J. Jung, M. Heckel,R. Schwarting, E. Magira, D. Monos, R.S. Freedman, Immuneresponses to human tumors: development of tumor vaccines,Anticancer Res. 23 (2003) 1969.

[2] R.S. Freedman, C.D. Platsoucas, Immunotherapy for peritonealovarian carcinoma metastasis using ex vivo expanded tumor-infiltrating lymphocytes, Cancer Treatment Res. 82 (1996) 115.

[3] R.S. Freedman, A.P. Kudelka, C.F. Verschraegen, C.D. Plat-soucas, Progress toward tumor specific immunity in carcinomasof the ovary and breast, in: J.J. Kavanagh, S.E. Singletary, N.Einhorn, A.D. DePetrillo (Eds.), Cancer in Women, BlackwellScience Publication, Malden, Oxford, London, Berlin, Tokyo,1998, p. 30.

[4] S.A. Rosenberg, Progress in human tumor immunology andimmunotherapy, Nature 411 (2001) 382.

[5] C.G. Ioannides, C.D. Platsoucas, S. Rashed, J.T. Wharton, C.L.Edwards, R.S. Freedman, Tumor cytolysis by lymphocytesinfiltrating ovarian malignant ascites, Cancer Res. 51 (1991) 4257.

[6] C.G. Ioannides, R.S. Freedman, C.D. Platsoucas, S. Rashed,Y.P. Kim, Cytotoxic T cell clones isolated from ovariantumor-infiltrating lymphocytes recognize multiple antigenic epi-topes on autologous tumor cells, J. Immunol. 146 (1991) 1700.

[7] S. Kooi, R.S. Freedman, J. Rodriguez-Villanueva, C.D. Plat-soucas, Cytokine production by T-cell lines derived from tumor-infiltrating lymphocytes from patients with ovarian carcinoma.Tumor-specific immune responses and inhibition of antigen-independent cytokine production by ovarian tumor cells, Lym-phokine Cytokine Res. 12 (1993) 429.

[8] G.E. Peoples, M.P. Davey, P.S. Goedegebuure, D.D. Schoof,T.J. Eberlein, T cell receptor V beta 2 and V beta 6 mediatetumor-specific cytotoxicity by tumor-infiltrating lymphocytes inovarian cancer, J. Immunol. 151 (1993) 5472.

[9] G.E. Peoples, P.S. Goedegebuure, J.V. Andrews, D.D. Schoof,T.J. Eberlein, HLA-A2 presents shared tumor-associated anti-gens derived from endogenous proteins in ovarian cancer, J.Immunol. 151 (1993) 5481.

[10] G.E. Peoples, P.S. Goedegebuure, R. Smith, D.C. Linehan, I.Yoshino, T.J. Eberlein, Breast and ovarian cancer-specificcytotoxic T lymphocytes recognize the same HER2/neu-derivedpeptide, Proc. Natl. Acad. Sci. USA 92 (1995) 432.


[11] G.E. Peoples, I. Yoshino, C.C. Douville, J.V. Andrews, P.S.Goedegebuure, T.J. Eberlein, TCR Vbeta3+ and Vbeta6+ CTLrecognize tumor-associated antigens related to HER2/neuexpression in HLA-A2+ ovarian cancers, J. Immunol. 152(1994) 4993.

[12] I. Yoshino, P.S. Goedegebuure, G.E. Peoples, A.S. Parikh, J.M.DiMaio, H.K. Lyer, A.F. Ganzar, T.J. Eberlein, Her2/neu-derived peptides are shared antigens among human non-smallcell lung cancer and ovarian cancer, Cancer Res. 54 (1994) 3387.

[13] V. Ramakrishna, D.R. Negri, V. Brusi, R. Fontanelli, S.Canevari, G. Bolis, C. Castelli, G. Parmiani, Generation andphenotypic characterization of new human ovarian cancer celllines with the identification of antigens potentially recognizableby HLA-restricted cytotoxic T cells, Int. J. Cancer 73 (1997) 143.

[14] A. Yamada, K. Kawano, N. Harashima, F. Niiya, K. Nagai, K.Kobayashi, T. Mine, K. Ushijima, T. Nishida, K. Itoh, Study ofHLA class I restriction and the directed antigens of cytotoxic Tlymphocytes at the tumor sites of ovarian cancer, CancerImmunol. Immunother. 48 (1999) 147.

[15] D. Monos, J. Pappas, E. Magira, J. Gaughan, R. Aplenc, L.I.Sakkas, R.S. Freedman, J.D. Reveille, C.D. Platsoucas, Identi-fication of HLA-DQalpha and -DRbeta residues associated withsusceptibility and protection to epithelial ovarian cancer, HumanImmunology 66 (2005) 554.

[16] T. Boehm, T.H. Rabbitts, The human T-cell receptor genes aretargets for chromosomal abnormalities in T-cell tumors, FASEBJ. 3 (1989) 2344.

[17] B. Arden, S.P. Clark, D. Kabelitz, T.W. Mak, Human T-cellreceptor variable gene segment families, Immunogenetics 42(1995) 455.

[18] C.A. Janeway, P. Travers, W. Mark, J.D. Capra (Eds.), fourthed., Immunobiology: The Immune System in Health andDisease, Current Biology Publications, New York, 1999, p. 635.

[19] J.E. Slansky, Antigen-specific T cells: analyses of the needles inthe haystack, PLoS Biol. 1 (2003) 329.

[20] T.P. Arstila, A. Casrouge, V. Baron, J. Even, J. Kanellopoulos,P. Kourilsky, A direct estimate of the human alphabeta T cellreceptor diversity, Science 286 (1999) 958.

[21] P.F. Chen, C.D. Platsoucas, Development of the non-palin-dromic adaptor polymerase chain reaction (NPA-PCR) for theamplification of alpha- and beta-chain T-cell receptor cDNAs,Scand. J. Immunol. 35 (1992) 539.

[22] C.A. Slachta, V. Jeevanandam, B. Goldman, W.L. Lin, C.D.Platsoucas, Coronary arteries from human cardiac allograftswith chronic rejection contain oligoclonal populations of T cells.Persistence of identical clonally expanded b-chain T-cell receptortranscripts from the early posttransplantation period (endomyo-cardial biopsies) to chronic rejection (coronary arteries), J.Immunol. 165 (2000) 369.

[23] C.A. Slachta, V. Jeevanandam, B. Goldman, W.L. Lin, C.D.Platsoucas, Coronary arteries with chronic rejection containoligoclonalT cells. Persistenceof clonally expandedT-cell receptor(TCR) transcripts from the early post-transplantation periodthrough chronic rejection, Transplant. Proc. 33 (2001) 452.

[24] E.L. Oleszak, W.L. Lin, A. Legido, J. Melvin, H. Hardison,B.E. Hoffman, C.D. Katsetos, C.D. Platsoucas, Oligoclonal Tcells are present in the CSF of a child with a recurrentdisseminated MS-like demyelinating disease following HepatitisA infection, Clin. Diag. Lab. Immunol. 8 (2001) 984.

[25] L.I. Sakkas, B. Xu, C.M. Artlett, S. Lu, S.A. Jimenez, C.D.Platsoucas, Oligoclonal T cell expansion in the skin of patientswith systemic sclerosis, J. Immunol. 168 (2002) 3649.

[26] B. Xu, L.I. Sakkas, B.I. Goldman, V. Jeevanandam, J. Gaughan,E.L. Oleszak, C.D. Platsoucas, Identical alpha-chain T-cellreceptor transcripts are present on T cells infiltrating coronaryarteries of cardiac allografts with chronic rejection, Cell Immu-nol. 225 (2003) 75.

[27] W.L. Lin, J.E. Fincke, L. Sharer, D. Monos, S. Lu, J. Gaughan,C.D. Platsoucas, E.L. Oleszak, Oligoclonal T cells are infiltratingthe brain of children with AIDS: sequence analysis revealed highproportions of identical beta-chain T-cell receptor (TCR) tran-scripts, Clin. Exp. Immunol. 141 (2005) 338.

[28] J.E. Fincke, W.L. Lin, D.W. Laske, A. Kendler, M. Curtis, R.Schwarting, C.D. Platsoucas, Oligoclonal tumor infiltratinglymphocyte populations in glioblastoma, J. Neuroimmunol.154 (2004) 176.

[29] R.S. Freedman, B. Tomasovic, S. Templin, E.N. Atkinson, A.Kudelka, C.L. Edwards, C.D. Platsoucas, Large-scale expansionin interleukin-2 of tumor-infiltrating lymphocytes from patientswith ovarian carcinoma for adoptive immunotherapy, J. Immu-nol. Methods 167 (1994) 145.

[30] R.S. Freedman, C.L. Edwards, J.J. Kavanagh, A. Kudelka, R.L.Katz, C.H. Carrasco, E.N. Atkinson, B. Tomasovic, S. Templin,C.D. Platsoucas, Intraperitoneal adoptive immunotherapy ofovarian carcinoma with tumor-infiltrating lymphocytes and lowdose of rIL2. A pilot trial, J. Immunother. 16 (1994) 198.

[31] L.I. Sakkas, C. Scanzello, N. Johanson, J. Burkholder, A.Mitra, P. Salgame, C.D. Katsetos, C.D. Platsoucas, T cells andT-cell derived cytokine transcripts in the synovial membrane ofpatients with osteoarthritis, Clin. Diag. Lab. Immunol. 5 (1998)430.

[32] D.G. Spinella, J.M. Robertson, Analysis of human T-cellrepertoires by PCR, in: K.B. Mullis, F. Ferre, R.A. Gibbs(Eds.), The Polymerase Chain Reaction, 1994, p. 110..

[33] Y.W. Choi, B. Kotzin, L. Herron, J. Callahan, P. Marrack, J.Kappler, Interaction of Staphylococcus aureus toxin ‘‘superan-tigens’’ with human T cells, Proc. Natl. Acad. Sci. USA 86 (1989)8941.

[34] U. Malhotra, R. Spielman, P. Concannon, Variability in T-cellreceptor Vb gene usage in human peripheral blood lymphocytes;studies of identical twins, sublines, and insulin-dependent diabe-tes mellitus patients, J. Immunol. 149 (1992) 1802.

[35] J. Even, A. Lim, I. Puisieux, L. Ferradini, P.-Y. Dietrich, A.Toubert, T. Hercend, F. Triebel, C. Pannetier, P. Kourilsky, T-cell repertoires in healthy and diseased human tissues analysedby T-cell receptor b-chain CDR3 size determination: evidence foroligoclonal expansions in tumours and inflammatory diseases,Res. Immunol. 146 (1995) 65.

[36] D. Hanahan, Studies on transformation of Escherichia coli withplasmids, J. Mol. Biol. 166 (1983) 557.

[37] S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang,W. Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: anew generation of protein database search programs, NucleicAcids Res. 25 (1997) 3389.

[38] G.W. Snedecor, W.G. Cohran, in: Statistical Methods, IowaState University Press, Ames, Iowa, 1989, p. 503.

[39] C. Genevee, A. Diu, J. Niierat, A. Caignard, P.Y. Dietrich, L.Ferradini, S. Roman-Roman, F. Triebel, T. Hercend, Anexperimentally validated panel of subfamily-specific oligonucleo-tide primers (Valpha1-w29/Vbeta1-w24) for the study of T-cellreceptor variable V gene segment usage by polymerase chainreaction, Eur. J. Immunol. 22 (1992) 1261.

[40] S. Wei, P. Charmley, M.A. Robinson, P. Concannon, The extentof the human germline T-cell receptor Vb gene segmentrepertoire, Immunogenetics 40 (1994) 27.

[41] L. Ferradini, S. Roman-Roman, J. Azocar, H. Michalaki, F.Triebel, T. Hercend, Studies on the human T cell receptor alpha/beta variable region genes. II. Identification of four additionalVbeta subfamilies, Eur. J. Immunol. 21 (1991) 935.

[42] S.P. Clarke, B. Arden, D. Kabelitz, T.W. Mak, Comparison ofhuman and mouse T-cell receptor variable gene segmentsubfamilies, Immunogenetics 42 (1995) 531.

[43] K. Andreassen, S. Bendiksen, E. Kjeldsen, M. Van Ghelue, U.Moens, E. Arnesen, O.P. Rekvig, T cell autoimmunity to


histones and nucleosomes is a latent property of the normalimmune system, Arthritis Rheum. 46 (2002) 1270.

[44] H. Hara, M. Morita, T. Iwaki, T. Hatae, Y. Itoyama, T.Kitamoto, S. Akizuki, I. Goto, T. Watanabe, Detection ofhuman T lymphotrophic virus type I (HTLV-I) proviral DNAand analysis of T cell receptor V beta CDR3 sequences in spinalcord lesions of HTLV-I-associated myelopathy/tropical spasticparaparesis, J. Exp. Med. 180 (1994) 831.

[45] M. Saito, I. Higuchi, A. Saito, S. Izumo, K. Usuku, C.R.Bangham, M. Osame, Molecular analysis of T cell clonotypes inmuscle-infiltrating lymphocytes from patients with human Tlymphotropic virus type 1 polymyositis, J. Infect. Dis. 186 (2002)1231.

[46] C. Ciurli, D.N. Posnett, R.P. Sekaly, F. Denis, Highly biasedCDR3 usage in restricted sets of beta chain variable regionsduring viral superantigen 9 response, J. Exp. Med. 187 (1998)253.

[47] R. Duchmann, C. Lambert, E. May, T. Hohler, E. Marker-Hermann, CD4+ and CD8+ clonal T cell expansions indicate arole of antigens in ankylosing spondylitis; a study in HLA-B27+monozygotic twins, Clin. Exp. Immunol. 123 (2001) 315.

[48] K. Willenbrock, A. Roers, C. Seidl, H.H. Wacker, R. Kuppers,M.L. Hansmann, Analysis of T-cell subpopulations in T-cellnon-Hodgkin�s lymphoma of angioimmunoblastic lymphade-nopathy with dysproteinemia type by single target gene ampli-fication of T cell receptor- beta gene rearrangements, Am. J.Pathol. 158 (2001) 1851.

[49] D.F. Barber, D. Obeso, R. Garcia-Hoyo, J.A. Villadangos, J.A.Lopezde Castro, T-cell receptor usage in alloreactivity againstHLA-B*2703 reveals significant conservation of the antigenicstructure of B*2705, Tissue Antigens 47 (1996) 478.

[50] H. Babbe, A. Roers, A. Waisman, H. Lassmann, N. Goebels,R. Hohlfeld, M. Friese, R. Schroeder, M. Deckert, S. Schmidt,R. Ravid, K. Rajewsky, Clonal expansions of CD8(+) T cellsdominate the T cell infiltrate in active multiple sclerosis lesions asshown by micromanipulation and single cell polymerase chainreaction, J. Exp. Med. 192 (2000) 393.

[51] P.J. Lehner, E.C. Wang, P.A. Moss, S. Williams, K. Platt, S.M.Friedman, J.L. Bell, L.K. Borysiewicz, Human HLA-A0201-restricted cytotoxic T lymphocyte recognition of influenza A isdominated by T cells bearing the V beta 17 gene segment, J. Exp.Med. 181 (1995) 79.

[52] G. Giegerich, M. Pette, E. Meinl, J.T. Epplen, H. Wekerle, A.Hinkkanen, Diversity of T cell receptor alpha and beta chaingenes expressed by human T cells specific for similar myelin basicprotein peptide/major histocompatibility complexes, Eur. J.Immunol. 22 (1992) 753.

[53] M.D. Howell, J.P. Diveley, K.A. Lundeen, A. Esty, S.T. Winters,D.J. Carlo, S.W. Brostoff, Limited T-cell receptor beta-chainheterogeneity among interleukin 2 receptor-positive synovial Tcells suggests a role for superantigen in rheumatoid arthritis,Proc. Natl. Acad. Sci. USA 88 (1991) 10921.

[54] H. Soudeyns, P. Champagne, C.L. Holloway, G.U. Silvestri, N.Ringuette, J. Samson, N. Lapointe, R.P. Sekaly, Transient T cellreceptor beta-chain variable region-specific expansions of CD4+and CD8+ T cells during the early phase of pediatric humanimmunodeficiency virus infection: characterization of expandedcell populations by T cell receptor phenotyping, J. Infect. Dis.181 (2000) 107.

[55] N. Dulphy, M.-A. Peyrat, V. Tieng, C. Douay, C. Rabian, R.Tamouza, S. Laoussadi, F. Berenbaum, A. Chabot, M. Bonne-ville, D. Charron, A. Toubert, Common intra-articular T cellexpansions in patients with reactive arthritis: identical beta-chainjunctional sequences and cytotoxicity toward HLA-B27, J.Immunol. 162 (1999) 3830.

[56] L. Kjer-Nielsen, C.S. Clements, A.W. Purcell, A.G. Brooks,J.C. Whisstock, S.R. Burrows, J. McCluskey, J. Rossjohn, A

structural basis for the selection of dominant alphabeta T cellreceptors in antiviral immunity, Immunity 18 (2003) 53.

[57] A.P. Fontenot, M.T. Falta, B.M. Freed, L.S. Newman, B.L.Kotzin, Identification of pathogenic T cells in patients withberyllium-induced lung disease, J. Immunol. 163 (1991) 1019.

[58] J. Hong, Y.C. Zang, M.V. Tejada-Simon, M. Kozovska, S. Li,R.A. Singh, D. Yang, V.M. Rivera, J.K. Killian, J.Z. Zhang,A common TCR V-D-J sequence in V beta 13.1 T cellsrecognizing an immunodominant peptide of myelin basic proteinin multiple sclerosis, J. Immunol. 163 (1999) 3530.

[59] A. Chott, C.S. Probert, G.G. Gross, R.S. Blumberg, S.P. Balk,A common TCR beta-chain expressed by CD8+ intestinalmucosa T cells in ulcerative colitis, J. Immunol. 156 (1996) 3024.

[60] M.J. Maeurer, D.M. Martin, W.J. Storkus, M.T. Lotze, TCRusage in CTLs recognizing melanoma/melanocyte antigens,Immunol. Today 16 (1995) 603.

[61] T. Maruyama, I. Saito, S. Miyake, H. Hashimoto, K. Sato,H. Yagita, K. Okumura, N. Miyasaka, A possible role oftwo hydrophobic amino acids in antigen recognition bysynovial T cells in rheumatoid arthritis, Eur. J. Immunol. 23(1993) 2059.

[62] L. Wang, K. Tadokoro, K. Tokunaga, S. Uchida, S. Moriyama,M. Bannai, S. Mitsunaga, K. Takai, T. Juji, Restricted use of T-cell receptor V beta genes in posttransfusion graft-versus-hostdisease, Transfusion 37 (1997) 1184.

[63] P. Concannon, L.A. Pickering, P. Kung, L. Hood, Diversity andstructure of human T-cell receptor b-chain variable region genes,Proc. Natl. Acad. Sci. USA 83 (1986) 6598.

[64] M.M. Davis, J.J. Boniface, Z. Reich, D. Lyons, J. Hampl, B.Arden, Y. Chien, Ligand recognition by alpha beta T-cellreceptors, Annu. Rev. Immunol. 16 (1998) 523.

[65] H. Schild, N. Mavaddat, C. Litzenberger, E.W. Ehrich, M.M.Davis, J.A. Bluestone, L. Matis, R.K. Draper, Y.-H. Chien, Thenature of major histocompatibility complex recognition by cd Tcells, Cell 76 (1994) 29.

[66] H. Li, M.I. Labedeva, A.S. Llera, B.A. Fields, M.B. Brenner,R.A. Mariuzza, Structure of the Vd domain of a human cd T-cell antigen receptor, Nature 391 (1998) 502.

[67] S.P. Balk, E.C. Ebert, R.L. Blumenthal, F.V. McDermott,K.W. Wucherpfennig, S.B. Landau, R.S. Blumberg, Oligoclonalexpansion and CD1 recognition by human intestinal intraepi-thelial lymphocytes, Science 253 (1991) 1411.

[68] P.A. Sieling, D. Chatterjee, S.A. Porcelli, T.I. Prigozy, R.J.Mazzaccaro, T. Soriano, B.R. Bloom,M.B. Brenner, M. Kronen-berg, P.J. Brennan, R.I.Modlin, CD1-restricted T cell recognitionof microbial lipoglycan antigens, Science 269 (1995) 227.

[69] Y. Tanaka, C.T. Morita, Y. Tanaka, E. Nieves, M.B. Brenner,B.R. Bloom, Natural and synthetic non-peptide antigens recog-nized by human cd T cells, Nature 375 (1995) 155.

[70] C.T. Morita, E.M. Beckman, J.F. Bukowski, Y. Tanaka, H.Band, B.R. Bloom, D.E. Golan, M.B. Brenner, Direct presen-tation of nonpeptide prenyl pyrophosphate antigens to humangamma delta T cells, Immunity 3 (1995) 495.

[71] R. Sciammas, R.M. Johnson, A.I. Sperling, W. Brady, P.S.Linsley, P.G. Spear, F.W. Fitch, J.A. Bluestone, Unique antigenrecognition by a herpesvirus-specific TCR-cd cell, J. Immunol.152 (1994) 5392.

[72] E.M. Shevach, Regulatory T cells in autoimmunity, Annu. Rev.Immunol. 18 (2000) 423.

[73] U.K. Liyanage, T.T. Moore, H.G. Joo, Y. Tanaka, V. Herr-mann, G. Doherty, J.A. Drebin, S.M. Strasberg, T.J. Eberlein,P.S. Goedegebuure, D.C. Linehan, Prevalence of regulatory Tcells is increased in peripheral blood and tumor microenviron-ment of patients with pancreas or breast adenocarcinoma, J.Immunol. 169 (2002) 2756.

[74] E.Y. Woo, C.S. Chu, T.J. Goletz, K. Schlienger, H. Yeh, G.Coukos, S.C. Rubin, L.R. Kaiser, C.H. June, Regulatory


CD4(+)CD25(+) T cells in tumors from patients with early-stagenon-small cell lung cancer and late-stage ovarian cancer, CancerRes. 61 (2001) 4766.

[75] T.J. Curiel, G. Coukos, L. Zou, X. Alvarez, P. Cheng, P.Mottram, M. Evdemon-Hogan, J.R. Conejo-Garcia, L. Zhang,M. Burow, Y. Zhu, S. Wei, I. Kryczek, B. Daniel, A. Gordon,L. Myers, A. Lackner, M.L. Disis, K.I. Knutson, L. Chen, W.Zou, Specific recruitment of regulatory T cells in ovariancarcinoma fosters immune privilege and predicts reduced sur-vival, Nat. Med. 10 (2004) 942.

[76] A.M. Thornton, E.M. Shevach, Suppressor effector function ofCD4+CD25+ immunoregulatory T cells is antigen nonspecific,J. Immunol. 164 (2000) 183.

[77] A.E. Loercher, M.A. Nash, J.J. Kavanagh, C.L. Edwards, C.D.Platsoucas, R.S. Freedman, Identification of an IL-10-produc-ing, HLA-DR-negative, monocyte subset in the malignant ascitesof patients with ovarian carcinoma, which inhibits cytokineprotein expression and proliferation of autologous T cells, J.Immunol. 163 (1999) 6251.

[78] C.G. Ioannides, C.D. Platsoucas, J.M. Bowen, J.T. Wharton,R.S. Freedman, Increased ovarian tumor cell surface reactingantibodies in patients with ovarian adenocarcinoma after viraloncolysate therapy, Anticancer Res. 9 (1989) 81.

[79] P.-F. Chen, Y.-D. Li, R. Pollock, M. Ross, C.D. Platsoucas,Fresh tumor-infiltrating lymphocytes from certain patients withmalignant melanoma are comprised of oligoclonal T-cells:sequence analysis of the ab T-cell receptor cDNAs, Proc. Am.Assoc. Cancer Res. 33 (1992) 309.

[80] L. Ferradini, A. Mackensen, C. Genevee, J. Bosq, P. Duvillard,M.F. Avril, T. Hercend, Analysis of T cell receptor variability intumor-infiltrating lymphocytes from a human regressive mela-noma. Evidence for in situ T cell clonal expansion, J. Clin.Invest. 91 (1993) 1183.

[81] P. Thor Straten, J. Scholler, K. Hou-Jensen, J. Zeuthen,Preferential usage of T-cell receptor alpha beta variable regionsamong tumor-infiltrating lymphocytes in primary human malig-nant melanomas, Int. J. Cancer 56 (1994) 78.

[82] I. Puisieux, J. Even, C. Panuetiev, F. Joteveau, M. Faurof, P.Kourilsky, Oligoclonality of tumor-infiltrating lymphocytes fromhuman melanomas, J. Immunol. 153 (1994) 2807.

[83] S. Mandruzzato, E. Rossi, F. Bernardi, V. Tosello, B. Macino,G. Basso, V. Chiarion-Sileni, C.R. Rossi, C. Montesco, P.Zanovello, Large and dissimilar repertoire of Melan-A/MART-1-specific CTL in metastatic lesions and blood of a melanomapatient, J. Immunol. 169 (2002) 4017.

[84] H. Echchakir, I. Vergnon, G. Dorothee, D. Grunenwald, S.Chouaib, F. Mami-Chouaib, Evidence for in situ expansion ofdiverse antitumor-specific cytotoxic T lymphocyte clones in ahuman large cell carcinoma of the lung, Int. Immunol. 12 (2000)537.

[85] H. Echchakir, C. Asselin-Paturel, G. Dorothee, I. Vergnon, D.Grunenwald, S. Chouaib, F. Mami-Chouaib, Analysis of T-cell-receptor beta-chain-gene usage in peripheral-blood and tumor-infiltrating lymphocytes from human non-small-cell lung carci-nomas, Int. J. Cancer 81 (1999) 205.

[86] G. Perrin, V. Schnuriger, A.L. Quiquerez, P. Saas, C. Pannetier,N. de Tribolet, J.M. Tiercy, J.P. Aubry, P.Y. Dietrich, P.R.Walker, Astrocytoma infiltrating lymphocytes include major Tcell clonal expansions confined to the CD8 subset, Int. Immunol.11 (1999) 1337.

[87] K. Hayashi, K. Yonamine, K. Masuko-Hongo, T. Iida, K.Yamamoto, K. Nishioka, T. Kato, Clonal expansion of T cellsthat are specific for autologous ovarian tumor among tumor-infiltrating T cells in humans, Gynecol. Oncol. 74 (1999) 86.

[88] K. Itoh, C.D. Platsoucas, C.M. Balch, Autologous tumor-specific cytotoxic T lymphocytes in the infiltrate of humanmetastatic melanomas. Activation by interleukin 2 and autolo-

gous tumor cells, and involvement of the T cell receptor, J. Exp.Med. 168 (1988) 1419.

[89] S.A. Rosenberg, J.R. Yannelli, J.C. Yang, S.L. Topalian, D.J.Schwartzentruber, J.S. Weber, D.R. Parkinson, C.A. Seipp,J.H. Einhorn, D.E. White, Treatment of patients with metastaticmelanoma with autologous tumor-infiltrating lymphocytes andinterleukin-2, J. Natl. Cancer Inst. 86 (1994) 1159.

[90] M.E. Dudley, J.R. Wunderlich, P.F. Robbins, J.C. Yang, P.Hwu, D.J. Schwartzentruber, S.L. Topalian, R. Sherry, N.P.Restifo, A.M. Hubicki, M.R. Robinson, M. Raffeld, P. Duray,C.A. Seipp, L. Rogers-Freezer, K.E. Morton, S.A. Mavroukakis,D.E. White, S.A. Rosenberg, Cancer regression and autoimmu-nity in patients after clonal repopulation with antitumorlymphocytes, Science 298 (2002) 850.

[91] P. Chomez, O. De Backer, M. Bertrand, E. De Plaen, T. Boon,S. Lucas, An overview of the MAGE gene family with theidentification of all human members of the family, Cancer Res.61 (2001) 5544.

[92] M.J. Scanlan, A.O. Gure, A.A. Jungbluth, L.J. Old, Y.T. Chen,Cancer/testis antigens: an expanding family of targets for cancerimmunotherapy, Immunol. Rev. 188 (2002) 22.

[93] A. Yamada, A. Kataoka, S. Shichijo, T. Kamura, Y. Imai, T.Nishida, K. Itoh, Expression of MAGE-1, MAGE-2, MAGE-3/-6, and MAGE-4a/-4b genes in ovarian tumors, Int. J. Cancer 64(1995) 388.

[94] V. Russo, P. Dalerba, A. Ricci, C. Bonazzi, B.E. Leone, C.Mangioni, P. Allavena, C. Bordignon, C. Traversari, MAGEBAGE and GAGE genes expression in fresh epithelial ovariancarcinomas, Int. J. Cancer 67 (1996) 457.

[95] A.M. Gillespie, S. Rodgers, A.P. Wilson, J. Tidy, R.C. Rees,R.E. Coleman, A.K. Murray, MAGE, BAGE and GAGE:tumor antigen expression in benign and malignant ovarian tissue,Br. J. Cancer 78 (1998) 816.

[96] A. Hofmann, I. Ruschenburg, mRNA detection of tumor-rejection genes BAGE, GAGE and MAGE in peritoneal fluidfrom patients with ovarian carcinoma as a potential diagnostictool, Cancer 96 (2002) 187.

[97] E. Yakirevich, E. Sabo, O. Lavie, S. Mazareb, G.C. Spagnoli,M.B. Resnick, Expression of the MAGE-A4 and NY-ESO-1cancer-testis antigens in serous ovarian neoplasms, Clin. CancerRes. 9 (2003) 6453.

[98] K. Odunsi, A.A. Jungbluth, E. Stockert, F. Qian, S. Gnjatic, J.Tammela, M. Intengan, A. Beck, B. Keitz, D. Santiago, B.Williamson, M.J. Scanlan, G. Ritter, Y.-T. Chen, D. Driscoll,A. Sood, S. Lele, L.J. Old, NY-ESO-1 and LAGE-1 cancer-testis antigens are potential targets for immunotherapy inepithelial ovarian cancer, Cancer Res. 63 (2003) 6076.

[99] D.F. Stern, P.A. Heffernan, R.A. Weinberg, P185 a product of aneu protooncogene is a receptor-like protein associated withtyrosine kinase activity, Mol. Cell. Biol. 6 (1986) 1721.

[100] R.M. Neve, H.A. Lane, N.E. Hynes, The role of overexpressedHER2 in transformation, Ann. Oncol. 12 (Suppl. 1) (2001) S9.

[101] T. Cooke, J. Reeves, A. Lanigan, P. Stanton, HER2 as aprognostic and predictive marker for breast cancer, Ann. Oncol.12 (Suppl. 1) (2001) S23.

[102] M.L. Disis, J.W. Smith, A.E. Murphy, W. Chen, M.A. Cheever,In vitro generation of human cytolytic T cells specific forpeptides derived from the HER-2/neu protooncogene protein,Cancer Res. 54 (1994) 1071.

[103] M.L. Disis, E. Calenoff, G. McLaughlin, A.E. Murphy, W. Chen,B. Groner, M. Jeschke, N. Lydon, E. McGlynn, R.B. Livingston,et al., Existent T-cell and antibody immunity to HER-2/neuprotein in patients with breast cancer, Cancer Res. 54 (1994) 16.

[104] T.Z. Zaks, S.A. Rosenberg, Immunization with a peptide epitope(p369–377) from HER-2/neu leads to peptide specific cytotoxic Tlymphocytes that fail to recognize HER-2/neu+ tumors, CancerRes. 58 (1998) 4902.

Substantial proportions of identical β-chain T-cell receptor transcripts are present in epithelial...

Documents

Transcript of Substantial proportions of identical β-chain T-cell receptor transcripts are present in epithelial...