GENOMICS 13, 389-394 (19%)

Strand-Separating Conformational Polymorphism Analysis: Efficacy of Detection of Point Mutations in the Human

Ornithine &Aminotransferase Gene

JACQUES MICHAUD,” LAWRENCE C. BRoDy, t GARY STEEL,t GIS~LE FONTAINE,* LAURA S. MARTIN,t DAVID VALLE, t AND GRANT MITCHELL*

*Section de g&&ique medicale and the Canadian Network of Centers of Excellence in Human Genetics, Centre de recherche, H6pital Sainte-Justine, Montreal, Quebec, Canada; and tDepartment of Pediatrics and Howard Hughes Medical Institute

Laboratory of Genetics, Johns Hopkins University School of Medicine, Baltimore, Maryland

Received November 1, 1991; revised February 14, 1992

We tested the use of a modified method of single-strand con- formational polymorphism (SSCP) analysis for the detection of point mutations in the human ornithine-&aminotransferase gene. Using a combination of three different electrophoretic conditions, we detected 20120 known mutations. In a prospec- tive study of 24 previously uncharacterized mutant OAT genes, we found 13 different mutations accounting for 19 (79%) of the 24. We conclude that SSCP is an efficient tech- nique with high sensitivity and specificity. Q 1992 Academic

Press,lnc.

INTRODUCTION

The detection of single-strand conformational poly- morphisms (SSCP),’ first described by Orita et al. (1989a,b), has become a popular way of searching for small mutations (Cawthon et al., 1990; Dean et al, 1990; Orita et al., 1990; Suzuki et al., 1990; Dietz et al., 1991; Labrune et al., 1991). In this technique, DNA fragments are first denatured and then electrophoresed under non- denaturing conditions, allowing single strands of DNA to assume a secondary structure determined by their nu- cleotide sequence. Sequence changes as small as a single nucleotide substitution can alter the secondary struc- ture and allow resolution of wildtype and mutant strands.

As part of our ongoing study of the molecular basis of the hereditary deficiency of human ornithine b-amino- transferase (OAT),’ which causes the blinding autoso- ma1 recessive disorder gyrate atrophy of the choroid and

’ Abbreviations used: PCR, polymerase chain reaction; OAT, or- nithine 6-aminotransferase; SSCP, strand-separating conformational polymorphism.

* OAT allele nomenclature: OAT missense alleles are designated using the single-letter abbreviation for amino acids and codon num- bers with codon 1 corresponding to the initiation methionine. The first letter and the following number indicate the normal residue and codon number, respectively. For missense mutations, the final letter indicates the replacement residue. Nonsense mutations are indicated

retina (Valle and Simell, 1989), we developed a modified SSCP protocol. To test the sensitivity of our modified SSCP method, we examined 20 alleles containing known mutations previously detected by a variety of other tech- niques (Brody et al., 1991). Then, we performed a pro- spective study of the utility of this technique in 24 un- characterized OAT mutant genes.

MATERIALS AND METHODS

PCR conditions. The 50-~1 PCR amplication mixture contained 10 pmol of each primer; 12.5 pCi [35S]dATP (New England Nuclear, NEG 034H); 12.5 aCi [3’S]dCTP (New England Nuclear, NEG 036H); 2.5 units Tao DNA polymerase; dATP, dCTP, dGTP, and dTTP, each at 12.5 p&f; Tris-HCl, pH 8.3, 10 mM; KCl, 50 mM; MgCl, 1.5 mmol/ liter, and gelatin 0.0001% (w/v).

Each of the nine coding exons and their flanking splice consensus sequences were amplified using primers located within the surround- ing intronic sequences. As template we used 100 ng of genomic DNA isolated from leukocytes as previously described (Kunkel et al., 1977) or in some cases 10 pg of cloned plasmid DNA either of normal se- quence or containing a known mutation. We performed 30 cycles of PCR amplification, cycling between the annealing temperature (15 s) and 94°C (15 s), with a terminal 72°C extension for 5 min. Primers, annealing temperatures, and amplified fragment lengths for each exon studied are listed in Table 1. To ensure that the amplification pro- duced a single fragment of the appropriate size, 10 ~1 of the reaction mixture was electrophoresed in a 2% agarose gel and stained with ethidium bromide.

SSCP analysis. For SSCP analysis, l-10 ~1 of PCR products was added to a solution containing 0.1% SDS and 10 mMEDTA to obtain a final volume of 25 ~1. Of the resulting solution, 4 pl was mixed with 4 pL of a solution containing 95% formamide, 0.05% bromphenol blue, 0.05% xylene cyan01 FF, and 20 mmol/liter EDTA. The sample was heated to 80°C for 5 min, then immediately placed on ice. Of this mixture, 3 ~1 was used in each lane. Although we typically performed

by the suffix “ter” following the codon number, e.g., G40lter. Small (l-2 bp) deletions or insertions are indicated by “fs” (for frameshift) after the codon number followed by the number of bases inserted or deleted, e.g., 1127fs(+l). The suffix A indicates deletion of a single codon, e.g., A184A. For intronic mutations we specify the intron and the position of the mutation relative to the donor (+) or acceptor (-) splice junction. Thus IVS6(+14) indicates a mutation 14-bp 3’ to the donor splice junction of intron 6.

389 0888-7543/92 $5.00

Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

390 MICHAUD ET AL.

FIG. 1. SSCP analysis of 31 mutations from OAT exons 3-11. Three different gel conditions were used, indicated on the left. For each group of samples, the extremities represent normal control fragments (C), and the internal lanes represent mutant fragments containing the muta- tions indicated at the top. For exons 6 and 10, two normal amplified fragments are shown, each of which contains one form of a neutral polymorphism (IVS6(+14) and N378N, respectively). A nondenatured control sample (nd) is shown at the left. One patient is a genetic compound who has two mutant alleles in exon 11, C394R and P417L/L437F. We amplified cloned genomic fragments containing each of these mutations in isolation, for comparison with the pattern of the patient’s genomic DNA. In the examples chosen here, exons 3,4,6,8, and 9 were run on a 6% gel and exons 5, 7, 10, and 11 on a 5% gel (see Materials and Methods).

SSCP analysis within 1-2 days after PCR, good results were obtained Electrophoresis was performed in either 5% polyacrylamide gels (ac- when diluted samples were kept at 4°C for as long as 2 weeks. Nonde- rylamide:bis ratio 29:l) or in 6% polyacrylamide gels (ratio 19:l) with natured controls were included to identify double-stranded fragments. comparable results. Each mutation was tested under three different

TABLE 1

Amplified Fragment Lengths, Annealing Temperatures, and Oligonucleotide Primers for PCR Amplification of Human OAT Exons 3-l 1

Amplified Annealing Oligonucleotide primer” fragment temperature

Exon length (bp) (“0 5’ 3

3 336 46 BAAGAATTCAAGAAAAGGGAAAAGACGJ 5’GCTAAGCTTATAGGCATAAGCCAAGJ 4 322 46 TTGAATTCTATGCCGTATAGTAATTGTC AGAAGCTTTAACAAAAAAAGGAAATG 5 275b 46 TTGAATTCCACAAAGTTCTTCCTATG CAAAGCTTGAAGTTAATATTTAATTTC 6 250 46 CGGAATTCGTGCTTATTGAATTTTGG AAAAGCTTTAATTTCTATTCC 7 193 46 TGGAATTCACTTATTCCTGTTTCTTC GCAAGCTTAGCCTTATCACAAACAGC 8 219 46 GAAAGCTTTCACTAATAGGGGTATTTTTTTTC TAAAGCTTACAAGAGTAGGAAATGG 9 191 54 AAGAATTCGGTGAATTGACTGTCT CAGAATTCCTTTAAAGAATAGACACTGTG

10 224 46 TTGAATTCTGTATAATTTTTCTTTAAAC GGAAGCTTAATTATCTTGAGTAAATG 11 181 54 CGGAATTCTTTGAGCATGTACGTTTTAC TAAAGCTTTTACAGGACCAC

D The oligonucleotides contain EcoRI or HindIII cloning sites and 2-bp 5’ extensions, which do not necessarily correspond to the genomic sequences. The oligonucleotide sequences are presented from 5’ (left) to 3’ (right).

b The amplification product of exon 5 includes the portion of exon 4 located 3’ to residue 399, as well as intron 4.

MUTATION DETECTION IN OAT WITH SSCP 391

Exon 9 Exon 10 Exon 11

FIG. l-Continued

electrophoretic conditions: (1) without glycerol at 4”C, (2) with 10% glycerol at 4”C, and (3) with 10% glycerol at room temperature. To aid in the detection of subtle differences in migration, mutant samples were loaded in adjacent lanes to control samples using a sharkstooth comb. Autoradiography was performed for 18 to 72 h. Any difference in migration between patient and control samples was scored as posi- tive.

Analysis of DNA samples from GA patients. All GA probands ex- hibited characteristic ocular findings and hyperornithinemia and had less than 5% of normal OAT activity in cultured skin fibroblasts. The 20 OAT alleles containing known mutations had been detected by a variety of other methods (Brady et al., 1991), including RNase A cleav- age (Myers et al., 1985), genomic cloning (Mitchell et al., 1989), and exonic and cDNA amplification and sequencing (Mitchell et al., 1988, 1989; Brody et al., 1992). One mutant allele contains two missense mutations within exon 11 (P417/L437F), which were always included in the same amplified fragment. All other mutant alleles contained one alteration at a single site on the amplified fragment. The biologi- cal significance of these OAT mutations is described elsewhere (Brody et al., 1991).

For our prospective study, we examined 14 probands, 4 of which were known genetic compounds of a characterized and an uncharac- terized allele. Hence we studied a total of 24 OAT genes with unknown mutations.

RESULTS

SSCP Detection of 20 Known Mutations

We used a set of 20 known mutations to test our modi- fication of the SSCP technique. Although each of the electrophoretic conditions detected only 80-90% of the

20 known mutations, by combining them we detected all 20 (see Fig, 1 and Table 2). For certain amplified frag- ments, one set of electrophoretic conditions was supe- rior. For example, mutations in the fragment containing exon 10 were better resolved in the presence of glycerol. In contrast, L62P could be distinguished only in the ab- sence of glycerol. In total, 7 mutations (H53fs(-l), L62P, C93F, R271K, G375A, N378N, L402P) were missed under at least one of the electrophoretic condi- tions. Under some conditions, interpretation was diffi- cult because the fragments were not sharply resolved (for example, exons 4 and 5 in the presence of glycerol).

Although SSCP showed high sensitivity and reproduc- ibility, the alteration of migration produced by particu- lar mutations was unpredictable. In some instances, the mutation had different effects upon the migration of each of the complementary strands. For instance, in the Ml1 homozygote (see Fig. 1) one strand migrated nor- mally, whereas the other showed a marked mobility shift in glycerol-containing gels. In several lanes, multiple fragments were observed, possibly corresponding to dif- ferent conformational variants. For example, in the ab- sence of glycerol the fragment containing A270P, ampli- fied from a homozygote, showed two fragments that co- migrated with those of the control, as well as two fragments with a markedly abnormal migration. Under the two other conditions, the abnormally migrating fragments greatly predominate.

Prospective SSCP Study of Uncharacterized OAT Mutations

In 24 previously uncharacterized mutant OAT genes, 19 (79%) had abnormal migration of OAT exonic frag- ments under one or more of the three electrophoretic conditions. Upon sequencing, we detected a mutation in all 19, which we confirmed by another method (allele- specific oligonucleotide hybridization or restriction di- gestion in those cases in which a restriction site was altered). We found 13 different mutant OAT alleles in these chromosomes. Three had been described previ- ously in GA patients (N89K, R180T, T2671), and 10 were previously unknown. One of these 10 proved to be an intronic splicing mutation (IVS4(-2)). The others fell within the coding sequence, producing either a mis- sense or a frameshift mutation (Table 2). In addition, two neutral polymorphisms, IVS6(+14) and N378N (Martin et al., 1991), were also detected prospectively.

Interestingly, the nondenatured (duplex) fragment showed abnormal migration in some patients. These ab- normally migrating duplexes allowed us to detect IVS4(-2) in a glycerol-containing gel at 4”C, whereas under these conditions, no mobility shift was observed in the single-stranded fragments. The same was true for G353D in the absence of glycerol.

To test the reproducibility of the technique, we re- peated multiple amplifications of four mutant exons in which we had found subtle migration differences and compared their migration with that of simultaneous controls (not shown). Three mutations were always de-

392 MICHAUD ET AL.

TABLE 2

SSCP Analysis of 28 OAT Mutations

Exon Mutation” Change Position*

SSCP detectionc Glycerol (temperature)

- (4”) + (4O) f WI’) Discovery

of mutation

1 2 3 4 5 6 7 8 9

10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 21 28 29 30

3d

4

5

6

7

8

9 10

11

Ml1 G-+A H53fs(-1) de1 C Y55H T-C L62P T+C N89K C-A C93F G-+A 1127fs(+l) insT IVS4(-2) A-G R154L G+T R180T G-f.2 A184a de1 GCT A184T G+A IVS6(+14) G-+A P241L C-+T Y245C A-G R250P G-C T2671 C-T A270P G+C R271K G+A E318fs(-1) de1 G N334fs(-1) de1 A G353D G+A G375A G-C N378N C-T W391ter G+A C394R T-C R396ter C+T G4Olter G+T L402P T-+C P417L C-T /L437F G-T

159 163 185 267 278 380-l 2bp 5’ to acceptor site 461 539 550-2 550 14bp 3’ to donor site 122 734 749 800 808 812 947-50 1028-31 1058 1124 1134 1171 1180 1186 1201 1205 1250 1311

+

+ + +

+ + -e

t t

+ +

+

+

+ + + + + +

+

R R R. R

P/R R P P R

P/R R P

P/R P R P

P/R R R I’ R P R P/R P P R P R

R

a Twenty previously known mutations (two polymorphisms, N378N and IVS6(+14), and 18 mutations found only in GA patients) were studied retrospectively and are indicated by “R” in the right-hand column. Thirteen mutations were detected prospectively by the SSCP technique. Three of these had previously been described in other patients (indicated by “P/R”), and 10 were discovered by SSCP (indicated by “P”).

’ “Position” refers to the nucleotide number of the OAT mRNA, where +l is the A residue of the initiation methionine codon. ’ A difference in migration of the single-stranded fragments is detected (+) or not detected (-) with respect to the normal allele. d Exons 5, 7, 10, and 11 were analyzed in a 5% polyacrylamide gel, and exons 3, 4, 6, 8, and 9 were analyzed in a 6% gel (see Materials and

Methods). e A migration difference is detectable only for the duplex fragments with respect to the normal allele.

tectable: H53fs(-1) (5/5 amplifications) and Y55H (5/5 beled, we reduced the concentrations of all four dNTPs amplifications), both at 4°C without glycerol, and to preserve the fidelity of Taq polymerase (Gelfand, G375A (5/5 amplifications) at room temperature with 1989). The use of [35S]dNTPs has the added advantage glycerol. L62P, which produced the least migration of reducing radiation exposure to laboratory personnel. change, was detectable at 4°C without glycerol in 6/11 We loaded mutant and control fragments in adjacent gels. 35S labeling provided slightly better resolution than lanes, using a sharkstooth comb, as another aid in the “P labeling in these studies. detection of subtle migration abnormalities.

DISCUSSION

We modified the SSCP method to enhance the detec- tion of small migration differences between mutant and wildtype amplified fragments. To obtain sharper bands, we used 35S-labeled nucleotides rather than [32P]dNTPs, and to achieve high specific activity, we reduced the con- centrations of nucleotides added to the amplification mixture. Although only two of the nucleotides were la-

Results of the study of 20 known point mutations showed that this technique has high sensitiv+ity and spec- ificity, comparable with other methods of mutation de- tection including RNase A protection analysis (Myers et al., 1985), denaturing gradient gel electrophoresis (Shef- field et al., 1989; Traystman et al., 1990), chemical cleav- age (Cotton et al., 1988),,and the systematic sequencing of amplified products (Gibbs et al., 1990). SSCP has the advantage that it requires fewer preliminary studies

MUTATION DETECTION IN OAT WITH SSCP 393

than the other techniques and does not use toxic chemi- cals or large amounts of 32P-labeled radioactive isotopes. In a recent report (Ainsworth et al., 1991), silver staining of SSCP gels obviates the need for radioactive isotopes and should increase the speed of the analysis. In addi- tion, in our hands, the efficiency of SSCP can be in- creased by the use of multiplex PCR methods (not shown).

Our study does not address the question of the effect of fragment size upon the sensitivity of detection. Al- though we have detected a single basepair substitution in an amplified fragment of 800 bp (data not shown), the fragments studied in this article ranged from 181 to 336 bp. Hayashi (1991) has reported that the detection of mutations by SSCP is optimal in fragments shorter than 300 bp.

SSCP is well suited to the analysis of genetic com- pounds. The presence of the two normally migrating fragments does not interfere with recognition of the ab- normal fragments. Furthermore, as exemplified by the patient who is a compound for two mutant alleles in exon 11 (C394R and P417L/L437F), both alleles migrate abnormally and independently.

Presumably, different electrophoretic conditions, such as the presence or absence of glycerol or differences in gel temperature, influence the migration of some mu- tant strands. Although each set of conditions detected roughly the same fraction of the mutations, the subsets of mutations are not identical, and to achieve high sensi- tivity of detection, at least two gel conditions should be used. We found no false positives in our series. When- ever a migration difference was detected, we found a mu- tation in the fragment. To maximize detection, we currently sequence all fragments in which migration differs perceptably from that of the control. We prefer to risk occasional false positives rather than to overlook extremely subtle changes such as those seen with L62P.

Despite the near-perfect sensitivity of SSCP detec- tion of known mutations, we identified only 19124 (79%) of unknown mutant OAT genes. At least three explana- tions may account for the undetected mutations. First, the mutation may be found outside the amplified region (e.g., promoter mutations or intronic mutations not in- cluded in the amplified fragment). Second, an intronic point mutation or a deletion within the sequence comple- mentary to PCR primers may interfere with amplifica- tion. In such cases genetic compounds would be particu- larly difficult to analyze because only one allele would be amplified, with the result that the patient would appear to be homozygous for that allele. In some cases, such alleles may be detected by family studies in which an apparently non-Mendelian segregation pattern may be observed. Third, the mutation may be present in the am- plified fragment but fail to produce a migration differ- ence. Different gel conditions, restriction digestion of the mutant fragment prior to electrophoresis, or reposi- tioning of the amplification primers may allow detection in these cases. However, given the excellent sensitivity of SSCP in the detection of known point mutations, the

first explanation is most likely. Lacking a rigorous theo- retical basis for predicting the behavior of mutant strands, we empirically perform electrophoresis under the three conditions described in this article. In practice, we find SSCP to be an efficient method of screening for small mutations.

ACKNOWLEDGMENTS

We thank the following physicians who provided GA cell lines: Bruce Gordon, Rod McInnes, Mary Abraham, and Jean-Marie Saudu- bray. We acknowledge the secretarial assistance of Sylvie Tasse. This work was supported by the Medical Research Council of Canada (GM), the National Eye Institute (2ROlEY02948) and the Howard Hughes Medical Institute (DV).

REFERENCES

Ainsworth, P. J., Surh, L. C., and Coulter-Mackie, M. B. (1991). Diag- nostic single strand conformational polymorphism, (SSCP): A sim- plified non-radioisotopic method as applied to a Tay-Sachs Bl vari- ant. Nucleic Acids Res. 19: 405-406.

Brody, L. C., Mitchell, G. A., Obie, C., Michaud, J., Steel, G., Fon- taine, G., Robert, M-F., and Valle, D. (1992). Omithine-&amino transferase mutations in gyrate atrophy: Allelic heterogeneity and functional consequences. J. Biol. &em. 267: 3302-7.

Cawthon, R. M., Weiss, R., Xu, G., Viskochil, D., Culver, M., Stevens, J., Robertson, M., Dunn, D., Gesteland, R., O’Connell, P., and White, R. (1990). A major segment of the neurofibromatosis type 1 gene: cDNA sequence, genomic structure, and point mutations. Cell 62: 193-201.

Cotton, R. G. H., Rodrigues, N. R., and Campbell, R. D. (1988). Reac- tivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations. Proc. N&l. Acad. Sci. USA 85: 4397-4401.

Dean, M., White, M. D., Amos, J., Gerrard, B., Stewart, C., Khaw, K-T., and Leppert, M. (1990). Multiple mutations in highly con- served residues are found in mildly affected cystic fibrosis patients. Cell61: 863-870.

Dietz, H. C., Cutting, G. R., Pyeritz, R. E., Maslen, C. L., Sakai, L. Y., Corson, G. M., Puffenberger, E. G., Hamosh, A., Nanthakumar, E. J., Curristin, S. M., Stetten, G., Meyers, D. A., and Francomano, C. A. (1991). Marfan syndrome caused by a recurrent de novo mis- sense mutation in the fibrillin gene. Nature 352: 337-339.

Gelfand, D. H. (1989). Thermus aquaticus DNA polymerase. In “Current Communications in Molecular Biology: The Polymerase Chain Reaction” (H. Erlich, R. Gibbs, and H. Kazazian, Jr., Eds.), pp. 11-17, Cold Spring Harbor Press, Cold Spring Harbor, NY.

Gibbs, R. A., Nguyen, P-N., Edwards, A., Civitello, A. B., and Caskey, C. T. (1990). Multiplex DNA deletion detection and exon sequenc- ing of the hypoxanthine phosphoribosyltransferase gene in Lesch- Nyhan families. Genomics 7: 235-244.

Hayashi, K. (1991). PCR-SSCP: A simple and sensitive method for detection of mutations in the genomic DNA. PCR Methods Appl. 1: 34-38.

Kunkel, L. M., Smith, K. D., Boyer, S. D., Borgaonker, D. S., Wachter, S. S., Miller, 0. J., Bregs, W. R., Jones, H. W., and Pary, J. M. (1977). Analysis of human Y-chromosome specific reiterated DNA in chromosome variants. Proc. Natl. Acad. Sci. USA 74: 1245- 1249.

Labrune, P., Melle, D., Rey, F., Berthelon, M., Caillaud, C., Rey, J., Munnich, A., and Lyonnet, S. (1991). Single-strandconformational polymorphism for detection of mutations and base substitutions in phenylketonuria. Am. J. Hum. Genet. 48: 1115-1120.

Martin, L. S., Mitchell, G. A., Michaud, J., Brody, L. C., and Valle, D. (1991). A polymorphic synonymous mutation in human ornithine- 6-aminotransferase (N378N). Nucleic Acids Res. 19: 1962.

394 MICHAUD ET AL.

Mitchell, G. A., Brody, L. C., Looney, J., Steel, G., Suchanek, M., Dowling, C., Derkalonstian, V., Kaiser-Kupfer, M. I., and Valle, D. (1988). An initiator codon mutation in ornithine-fi-aminotransfer- ase causing gyrate atrophy. J. Clin. Inuest. 81: 630-633.

Mitchell, G. A., Brody, L. C., Sipila, I., Looney, J. E., Wong, C., Engel- hardt, J. F., Patel, A. S., Steel, G., Obie, C., Kaiser-Kupfer, M. I., and Valle, D. (1989). At least two mutant alleles of ornithine-6- aminotransferase cause gyrate atrophy of the choroid and retina in Finns. Proc. Natl. Acad. Sci. USA 86: 197-201.

Myers, R. M., Larin, Z., and Maniatis, T. (1985). Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA:DNA duplexes. Science 230: 1242-1249.

Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya, T. (1989a). Detection of polymorphisms of human DNA by gel electro- phoresis as single-strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86: 2766-2770.

Orita, M., Suzuki, Y., Sekiya, T., and Hayashi, K. (1989b). Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Cenomics 5: 8744879.

Orita, M., Sekiya, T., and Hayashi, K. (1990). DNA sequence poly- morphisms in Alu repeats. Genomics 8: 271-278.

Sheffield, V. C., Cox, D. R., Lerman, L. S., and Myers, R. M. (1989). Attachment of a 40-base-pair G + C-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proc. Natl. Acad. Sci. USA 86: 232-236.

Suzuki, Y., Orita, M., Shiraishi, M., Hayashi, K., and Sekiya, T. (1990). Detection of ras gene mutations in human lung cancers by single-strand conformation polymorphism analysis of polymerase chain reaction products. Oncogene 5: 1037-1043.

Traystman, M.D., Higuchi, M., Kasper, C. K., Antonarakis, S. E., and Kazazian, H. H. (1990). Use of denaturing gradient gel electrophore- sis to detect point mutations in the factor VIII gene. Genomics 6: 293-301.

Valle, D., and Simell, 0. (1989). The hyperornithinemias. In “The Metabolic Basis of Inherited Disease” (C. R. &river, A. L. Beaudet, W. Sly, et al., Eds.), 6th ed., pp. 599-627, McGraw-Hill, New York.